miRTarBase - #MIRT522098 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NUFIP2   
Synonyms 182-FIP, 82-FIP, FIP-82, PIG1
Description NUFIP2, FMR1 interacting protein 2
Transcript NM_020772   
Expression
Putative miRNA Targets on NUFIP2
3'UTR of NUFIP2
(miRNA target sites are highlighted)
>NUFIP2|NM_020772|3'UTR
   1 AGGACCAGACTGCCTATTCGTAACCTTTCTGCAGCATTAGAGCCATCGTTCATGGGGGACACAAGGCTTTTATGCTCCTA
  81 GATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACAAATATATATATATACATATATATATAT
 161 ATAGTTATTTAAAAAAGGCAACTGAAAGTAATTAGACTTCTTAAGGAATCAAATTTATTTCAAGAGACTACACATGGTTA
 241 TTTAATCTCCGGTACTGAATAGGTTTTTTTTCTTCTGTTAGTTTTTGTTTTTAAGTGTGAATGCAAGTGATTAATGAATA
 321 CAGACTTAACAAGTGTGGTTCTAAAGTTCCTGCTGTCATCAACTTGGGCAACAAATGACCCACTGGAAAGGCAAATCCAC
 401 TTAAAAGATCTCTGTATCTTGTTCTGTGACTGAAGTGATACACTAATCACGGGGAACCCAGAATGATTCAACATTTTCCC
 481 CCCACTCCTCCCTTGATCTTTTTGGTTTTACTTTAATTAAGCCCTGCGAGAATGCTGGATAAATGCCTTGAAGTTAGCAG
 561 GGTGTATTTTTTTAGCGAATATGATTTGCATGTCTTGCCAGGAGTTAAGCGGCCTCTGGGGTGTTGGGGAAATACTTTAT
 641 TTCTTTCCATTTATTTTTTGTGGGGCGGGGATAGGGGAGGGCATTGAAGTTCTACAATTCTGGAATAGTTAGTTGATGGT
 721 ACATAGTTAACTTGGCTTCGGTTACATATTGGACTTTAACAACTGAAGAATCTATGCGTGTCATTTAAAGAAAAGTTGCA
 801 GAACAAGCAATTGGCTTAGATATACAATCTGGAAAAATATTCCTGTGCCCATATTTTAATGTAATTGTATAACTGGGAGC
 881 AAAAATATATTCTGCTTTTCAACTGTAGGTGCTCCAGACTTGCTCTCCGTCACTAACACTAAATGTGCTGTTTTCCTTGT
 961 TTTTCATCAAACATTTAAGACAAACTTAGACCTTTCTGTAAATTATCTTTTAATTTCTCAGCAAAATCTAAAAGGGGAAG
1041 AAAAAAGTCCATGAAAACTAAAACTTTTCATGTTTTTAGCCAGTGAGAAGATAATAAACCCTGACTGTAGAAGGTGTGTT
1121 TTCATGCAAACTATACTTCTGAGCTTGTTAGCTTCTAATTATATCTTAATAAATATATTTTATTACTAGAGCAAGATGGG
1201 TTTTTAAGGAAAATAATGTGAAATTCTGGAAATTTTCTTTGGGGCAGAGAAGAGCATTAGCCCTGTCTTATCATTACATT
1281 GCCATCCTGTTGCACTGCAGCTTGTGTATAGCATGCTAAAATAAATTTTTGTGTGTGTGTGCAGAAATTAAGGGTCCAAT
1361 TGAGATTGGGTGATGTTAGTAACATAATAACAAGTTGTCTGGCCTGACACAGCATCACATCACACACACAGAAATTAGTA
1441 TATCCATGTATGTCAAATACAGGTTAAAATATCAGGGCATTTATATAAAGAGTTGTAGTCTTCTGATAAAAGTAGACTGG
1521 ATCCCCTGGGGTATTTGGGGAGAAAGTAACTACTTTGGCTCTACCCCTAGAAATGTCCAGTTTTGAGTGACTGTAGTATG
1601 GATGGGTTTTCTTGTTTTGTTGATTATTTGAGGCTTTTAAAACAAGTAGTTCATGAAAGAAGCTGTTGGACTCAACATAG
1681 AGTAGAGTAACTATCTTTTTAGTCTGGATTTCTGCCCTGCTTAGATTTTAAAAGTATAAGCATGGATTGCCAATTCCACT
1761 TGATGTAAACAAAACTTTTTTTTATACATAATATATATATATATATATAAAATAACTTATTGTATCAGTCCAGGTTCAGA
1841 AACTTGTGGTAGGCCAGTTCCAGATAGTTTCATTTCACCTGTAAACTGTATCACTTTGACTGATATTGTAATTTTCAAAT
1921 GTATAATATGTTTACAGATGTGCCCTGCATTTAGTCTGCCTTGTTCCTATTTTGATTTTTGTTGAGTCTCCTGCCTGCTT
2001 GCCAAAAGCTAGGATGCTTCAGGCCCATGTACAATTGAAAGCAGAGGCATCCTTGAGCTTTAAAGCATTGAACAAACTGG
2081 AAAATGCAACATACCACATAACTGAAGTGAAAAAAGTCTGTGTTTTTGTGTTTTTTTAAATAAAAATTTTCAAAAAGTTA
2161 AAAAAAAAGACATATAAGGTTGATTAAAGGGAAAAAAGGCTCCAGTTTGTTTTACAGGTTTTAAAGTTCTGCTGTGTGTT
2241 CAATTGCCTTGTGTAACCACTTGTCGCCTTAGGGCCAGATTCCCCTCTCTAGTCCCCTTTTTTAAATGTCCATTTTGCTT
2321 GCCTGGAATTTTAAAGTTCTTCCGTCTCACAACTCACAAGAAACTTTCTGGGTTTGTGACATACAGAGGTTGAATTGAGT
2401 ATATATTTGAAAAGGAAAAAACAAAAAACAAACCCAGACCCCACCTGAATTGGGCTTTTTAACTTAGAAGCAACACTTGA
2481 TTAAACATCTTTAGAAAGCTATTGCTTTTCTAATTTCCTTCCATATCCCTCAGGCCTCAGTGTTCAGAGAAGCCAAAAAG
2561 AATGTATCACTTCTCTGTCTGTCCAAAGGTTTTTGAGAGTCTCACTTCTAAATGAAACAATGCAACATTTCACTTTGATT
2641 TCTCCACTGAAATTTCCTTGATTATATGGTTAGAGGTATGTAGTTAGGAATGTCTGTTAACTTTCTGAGAACCCTAGTGC
2721 CCCATCATATTAACTGTCAGTATTTTGGGGGCATTAGGTTAATAGACTTAATTGCCTAGGTACAAGCAGGACTTTGGGAC
2801 AAATCTCTTTGTGCTGTTTGGTAACACTTAACTCTATTTGTTGCAATCTTTCTCCTTAGGTCCTCACACAATTCCTTACA
2881 GAGCACTTATTAAAAAAAAATCTTAAGAGTTGATCTGTTTTCTGATTATTTTGTGTAAGCTTCTAAACAAACTTCAGCTG
2961 TGATTAATTTAGCACATTTAAATAACGTGTTATTGTTTGGTATAAAGAATTTTCCTTCAACTCAGAGTATTAGTACTGTA
3041 GCATAAACCAAATACAGTCTAGAGGGGATTTTTAACATCCCTCCATTATAAAGACTGAAAAAGGGGTGTGTGTGTGTGTG
3121 TGTGTTTATGTATGTATGTATGTGTGTGTGAGGAAAAGATGGAGATATTAAAAATTAGTAAATGAATGTGTATAAGACAT
3201 TAGTATTCAGAGAATGAACTTGTATTTATTTTGTGCCATTTGTTTTCATTACACAGAAAAAAGTCAGGTGGTTTAAATCC
3281 TTAAAAGGGTAGTATTGAAAAATGGCACTAAGAATGAAATTATGACCTATTTTTTTAATAGCTATGAAGATACTAATTAT
3361 GGGTGAAGATTTCTTTTTAAATCTGTTTTGATTATTGTAGGCTTCTGTGTCACATACCACTCTTGTAGGTGTCCTCAATA
3441 ATCCCCTTTTCCCACAAAATACACAGGGTGTATTATCTTTCTCTTTATTCACCCCCACTTTGCTGAACTGAAGTTAATTA
3521 CATAGCCTTTCTTCTAACCTCCTTAGTAATGAACCTTCACATAAAGTGTATTTACAGCGTCTGTGGTAGCCAGCCCTTCC
3601 TCCTCTACTTTCTAGGAGGGGATAGCCAATAACTAGGAATTTAATGACAGATTTTTTTTTCTTTGAAATAAATGGCCAGA
3681 GTTTCTCCATTTTAGAATTTTGTTGTCCTCCTTAATCATCTGCTTACCTAGTCATTACTCAATCTGCAGAAACTTCATAA
3761 AGGAAAAGTGCTGCATTGTTTTTACAAATAACAGTTTGTAGGGAAAATATGACAAACCTCAACTATGGGAGTTGTCCACA
3841 ATACAAAATTTTGAAAAAACATTACATAGTGATAATATCATACTTGGTTGTTAGGCTTGTTGCTTCCCCACATCAGAGGC
3921 ATCTAATGATTTATCTTTTGTAATTGCTGTGAACTTTTTTAAATAAGCCATTTAGTGTGAAATTGTCATGTATCAAATGG
4001 CTATTGGAAATGGACTTTACTCAATTTTAATTCCACTGTAAATAAGGACGGAGTCATTCCTACAAGGCTCTCTTCAGAGA
4081 AATAGATTAAAAGTCCAATTTCCAGGTATTATTAGTATAGTTATGCCGCTGGGCCACATCCTCAACAACAGCTGATCCCT
4161 CTTGTATAAATATGTTAACTGTGCAGAACAGTTATGTTATGGGACAAATATAATGGTCATTATGGTCAGATTGGTTGATG
4241 CCACACCAGTCAAGGTAGAGTCTGATAGGGCAGTATCTTAATAACCCTACCCATGACTTAACTGTTGGATTTGAAAGGAA
4321 AACGTAGGATTTGCTCTTGTCCCCTTACCCGCCACAAAATTTTGATAATTTGTTTAAAAGGGAGAGGCAGAGGAAAAGAC
4401 TAGAAGCATAAATAGCTGCTTTAGGTTTGCCAGAGGCACATAGCTTAACATTAGTTCTTAATATCGATGTTATTTTTACT
4481 AATGTAATTAATCAACAGAGCACCAAGATTCTTTCATGGTGAAAAGGGTGGGCTTCTGTTTTGGTATCTTAAAATGTTTC
4561 TTTTAAAATATACATCACCTGTGTGAGAACCAGGACCACCTGGGAGAGTGATGAATCATTGGCTCCACTCAAAAGCATTG
4641 CTTTACTGAGTTTTAAATTTCACACTGTTTTGCCGCTCAAGAAAGGTCTTAAAGTAGTTAAAGGATGCCAGCAATAGTGC
4721 GAATAGAATTTTCGGTTGTCTGCATAATAAAAACACCCATTGCAGCATGATTGGTATGTTGCTCTTGCATTATTGGGAAT
4801 GGTAAATCAGTTATGGGCTAGAAACTATGGAATGGCCGTCCTCATATGTGATGGGATTGCTGATTCAGACTTCCCTATTT
4881 TCCATACAATTTTGTTATGTGCAGAGTTCTAAAGCCATTTTATAATACTGCAGTATCCCCCCCCCCCCCACCTTTTTTTT
4961 TTTGAGACGGACTGTCTGTTGCCCAGGCTGGAGTACAGTGGCGCAATCTTGGCTCACTGCAACCTCCACCTCCCTGGTTC
5041 AAGCAATTCCCCTGCCTCAGCCTCCCATGTAGCTGGGATTACGGGCGCACACCACCACACCTGGCTAATTTGTATTCTTA
5121 GTAGAGACGGGGTTTCACCATGTTGACCAGACTGGTCTCGAACTCCTGACCTCAGGCAATCTGCCCGCCTCAGCCTCCCA
5201 AAGTGCTGGAATTACAGGTGTGAGCCACCGTGCCCGGCCAAGTATCTCTTTTCTACAGCCTTATTAAACTAACTACAAAC
5281 ATTTATTTTCCAATTTAGTTTTACTTTCAGTGCATATCAAAGTTGTTGTACTCTTCAGACCAACAAATTAACTTGAGGGC
5361 AAATTACATAGCTTTCCATGTACCCTTTTTTCCTCAGGTGCTAATCAAAGGCTCTGAAAATGGATACTGCTTTAGTGATG
5441 TCTGCTTTATTCTTAAAATGCTTATTTCTTTTGCTAGATGTAAAGATTTGGTGTTAACAAAAGTGGTTTTAATATGTAAA
5521 TATGAATGAATGCCTTTAGTTTACCCTGTTTGTCTATTATTAATCTGTTTTCATTTATCCTTCATAGAGGAGGATCCTTT
5601 CATGATCTTGAATACATTTCATTAGATATTGTTGCATTTTAAGAATGAAAATACAACTGTTTTCTGTCTTAGATTAATCC
5681 TGCTGCTATGAGAAACTGAAAATCAAGAATGTGATGCACTTTTTACATTACTATATACCATACATATACCATAGGTTGCT
5761 TTGATACCTTTCCTGTAGCACAGCCACTAACAAGAGTGAATGAATTATAAAATTCTTTTTGGGAGGGAATCAATACAAGT
5841 AACTAATTCTTAGCTGATATTGTCCTATGAAGGACAATAACTTAGGAATATAAGAATTCTGTTAATAGTACACTTTTTGG
5921 CCTTAAATGTCTTCTACTACTGAAAATAGTTTAAATCTTAGCTTTGTTTCTATTATTCCCTCTCTCTGCCTCAGAAAGAG
6001 GAATTGGGAAGAATGGCTTAAAGGACGTGGTGTCATTGATTTGTTGCTGATCTTTTAGAAAACATTTGTCTATGTAAGCT
6081 GGGGACTTATTTTTTGTTTGTATATAGAGGGGAAATAGTGCTGCCCTGAACCAATCAGATTTAGTTTAAATCAAATCAAT
6161 CAAAACTCCAGCTGTTTCTCTTGTCTTTTTACTTAGCAAAGGAAAACTTTAGTGAATGCTACTTGACAAGAAGAAAAGTC
6241 ATTTCTCAAGCACATACCCAAACTTGAAGGTGATTGAACCCAAAATAATGGGTGGGAAACACCAAATGAGGTGGAGGAAT
6321 GAGAAAGATGTGTGGGCCAAAGCTATCTGGTTATATTTTGATGTTGCCAATATCGCAAAGCCAAAATTTTAATTTGCTTA
6401 TTTAATATATTTGTTGGCCAGAGATCTATTTTTATATCAATGTGCCTTGCATGTATATTAAAAAAAAAAAATTGGAAACG
6481 CCATGTAGTAATGCCTGAGATAGTCGATGGTTCTTACCACCTCACTAATTTTTATGCAGTATGAAATGCTCATTCTATTG
6561 CCCAACTGGTGCTCTCTGTTTAAAGTTACAGATCTTGCGAAACTGGAACTATTTTATAAGCTGGGGAAGTGATTTACTTT
6641 TTTTGTTGTATCTTTTTTGTTCTTAGTCTGTTAGTGGCTGTCCTGTAGTGGGAAATAGTAAAAGGATTCTTCACTCCCTT
6721 CTCCCCTCAGCACCTTCTTCAAGTAAACATTTCTTGTGTGCTTTGAAAAAAGTTTCAGCTTGCTGTCTCTTTTAGTGTTT
6801 TAAAGAAGTGTTATACAAAGCATTGTTTGCAAAATATAGGGAGATAATGGAGTCCACTTTAATTTGGAATTCTGTGTGAG
6881 CTATGATCCAAGTTATCAGCTCTTTCCAACTTTAAAAATTTTGTTAAAAGCACCTTGCTTAGAAAATTTTAAATATTTAT
6961 GTCTGCAACAATTGTCTCAAAATAATAAACTGTGCAATTCTTGTCATTAAAAAAAAAAAAGATCTGAATTTTCCCTAATG
7041 TGACTTGTTAGTTTCTCTCTGTATTTCCTGCCAGTGTAAATGTGAAAGCTTTGCTTGCATTACGTTTTAGAAATGCATTT
7121 TGCACACTCGAATTTTGCCGAAGCTCCGTGAAAAGGTTAGATCTAAGTAGATGAATAAAGCTATGCACATGTTTTGAAAG
7201 TTTAATTTGTGTGTCATTACCAAAAGTGACCGATTTGTCCTTACTACTTTGCTGTTGTTAGCTTTACCATCTTTGGAAAC
7281 TTGGCTCAAAGTTACATAGTTCTGGGCTAGCTCATCAGTGGAACTAGGAGAGAGGAAAACTGGCACCTATTTTAATAAAG
7361 TTCAATTTAAACGAGAGCTTGACTTGTATCTATTAAAGAGCTTTTCTTGAAACAGGGCAGTTTTATCAGCTTTACAAATC
7441 ATTGGATGCTCTTCCTTAGTAATATTTTGGTTTATTTGATCAAATAGAAATGGAAAGTAATTCAAACTGAAAGACCCTTT
7521 TTTGTCATATGGAACTTGGTGACGATTTTTTGTCTTAAAGCTGGTTTAAAGGTAGGATAGGCTTTTACCTTTATTGCTTT
7601 AGCATAAATTTGGTTTACTGAATTGACTGGCTTGAGATTAGAATTATTCAGTTGTTTGTAAGATCAAAGCACTGGTTGTT
7681 TTAAAGATAACGTGTATCTTTTAAAAAATTGCCCAAGCTGATTAGAACAAGTTTAGGAGTTGGGTACATTTGGTTCAAGT
7761 GCTGCAATCTGTATGTACTAAATAGCTTTACTTTGTGTATGTGTACTTATAATGTGTAGATGTACTACTACCCAGGTTTT
7841 GTCAAATCATCTTTTTTAAAGTTTTTTTTTTTTTAATTGGTTCAGGACCTTTGTAGGAGAGGCTAATATGTTTAAGTAGA
7921 AGATATTACTGATAGCATTTTCCCCATGCTCCTACATAAAAAATAAATATTTCCATTTTATAGCTTTTTCAATATACAGA
8001 AGAGGGTTACTTCTTCATCAAGTATATTGTTGCCTTTGAGGACACAGCAAAACCCTTCTATATGTATCTTCATTGATAGT
8081 GGCAGTTAAAAACTAAGTTATCCAGTTAAGACTTAAAAGGTGACCCATATTAATTGCATGGCCTTAAAAGGCAGAAATGC
8161 AGGAGTGTAGCAAGCATCATTTTAGATGGCTATGGTTCCTCTTCCGCATCTGTCAGTAGTTCACTTATGTTCAGTCTTAG
8241 AACCTACTGGAGGAGTGAAGTAATTTCTCTGTCTCGTGCAGAGGCACTAAGGAGCTGAGTTACCTCTTAATCTGGGGGAA
8321 TGGATAATAAGTGGAGTACAGTTATGTTAAAGGATGTTCCCCCCGCTCAAAAAAAAGTTTCAATGTTTGTTTTGCCCAGT
8401 CAAAAATATAGGTCTTTTCTACATATAAGAACAGTCACCAGAAATTTTCCCTTTTGCTAAATGCTTAGGTATTTGCTATA
8481 GCTGTTTCTGATGTCATGGATTCTGAGGAAGTGTCATTTACGTGATGATCTTCCTTTATTGATGTCTTCATCATGTTCAG
8561 TGTTTTAAAAATATAAATTACAAACACTCTACAACCATACCCAGATTTACTTATTTTATCAGAAAAAAAACTTGAGAAAT
8641 TTGTAGATCAAATTGAGAGACAATAAGTGTACATTGTTGAATAAAAAATTTTAAAGTTTCTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||:|  | |||||||:| 
Target 5' gaCAAATCTCTTTGTGCTGTTt 3'
2798 - 2819 156.00 -19.00
2
miRNA  3' guGUUUGGUAAUA-CACGACGAu 5'
            :|:|::|  ||  ||||||| 
Target 5' ctTAGATTA--ATCCTGCTGCTa 3'
5668 - 5688 148.00 -11.60
3
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            :|| ||:|  ||||||||:| 
Target 5' acTAACACTA-AATGTGCTGTTt 3'
932 - 953 147.00 -13.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26585560 32 COSMIC
COSN29989651 45 COSMIC
COSN31518337 48 COSMIC
COSN30127179 53 COSMIC
COSN30481959 58 COSMIC
COSN26987224 68 COSMIC
COSN8834169 99 COSMIC
COSN31956352 112 COSMIC
COSN26435219 115 COSMIC
COSN30126516 134 COSMIC
COSN31485289 134 COSMIC
COSN28882970 135 COSMIC
COSN30118087 146 COSMIC
COSN30509983 148 COSMIC
COSN30165385 150 COSMIC
COSN13709662 171 COSMIC
COSN20272340 180 COSMIC
COSN28753002 221 COSMIC
COSN26670103 250 COSMIC
COSN31590679 251 COSMIC
COSN1195083 256 COSMIC
COSN26465474 287 COSMIC
COSN31535753 309 COSMIC
COSN26603854 375 COSMIC
COSN26679074 380 COSMIC
COSN30542520 495 COSMIC
COSN30541609 610 COSMIC
COSN31573019 627 COSMIC
COSN23688827 669 COSMIC
COSN7163226 702 COSMIC
COSN31530248 739 COSMIC
COSN30240140 837 COSMIC
COSN8241404 916 COSMIC
COSN31488768 996 COSMIC
COSN15187998 1018 COSMIC
COSN31584334 1201 COSMIC
COSN7163225 1305 COSMIC
COSN21412049 1495 COSMIC
COSN17351216 1789 COSMIC
COSN6548041 1810 COSMIC
COSN31479531 1863 COSMIC
COSN30169874 1916 COSMIC
COSN30164814 2020 COSMIC
COSN20113752 2130 COSMIC
COSN31556194 2159 COSMIC
COSN8602843 2172 COSMIC
COSN31537967 2266 COSMIC
COSN28712779 2348 COSMIC
COSN20113749 2572 COSMIC
COSN26564360 2767 COSMIC
COSN22450957 2816 COSMIC
COSN31520055 2838 COSMIC
COSN22279257 2871 COSMIC
COSN31521631 2891 COSMIC
COSN31583336 2966 COSMIC
COSN20113747 3105 COSMIC
COSN20113748 3106 COSMIC
COSN25860346 3702 COSMIC
COSN1716077 4222 COSMIC
COSN6548040 4511 COSMIC
COSN29341335 4674 COSMIC
COSN19508514 4838 COSMIC
COSN7163223 4944 COSMIC
COSN7163222 4947 COSMIC
COSN27415058 4949 COSMIC
COSN17903974 5229 COSMIC
COSN15622613 5328 COSMIC
COSN29304395 5983 COSMIC
COSN20113745 6460 COSMIC
COSN29306599 6485 COSMIC
COSN25013307 6900 COSMIC
COSN6101311 7005 COSMIC
COSN28015538 7391 COSMIC
COSN22785586 7517 COSMIC
COSN21222608 7696 COSMIC
COSN27368356 7861 COSMIC
COSN27237984 7862 COSMIC
COSN17182012 8126 COSMIC
COSN22366114 8185 COSMIC
COSN4768744 8203 COSMIC
COSN4768743 8246 COSMIC
COSN4768742 8373 COSMIC
rs3785961 232 GWAS
rs143960646 2576 GWAS
rs8614 2751 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773725068 3 dbSNP
rs768019365 5 dbSNP
rs1285728685 8 dbSNP
rs762259195 14 dbSNP
rs1350664023 16 dbSNP
rs774460218 19 dbSNP
rs201190853 20 dbSNP
rs189825211 25 dbSNP
rs770011613 29 dbSNP
rs374136415 31 dbSNP
rs780876515 41 dbSNP
rs757184414 44 dbSNP
rs1164166324 46 dbSNP
rs371560511 47 dbSNP
rs1411162728 52 dbSNP
rs757731261 54 dbSNP
rs1470472666 58 dbSNP
rs1160657301 59 dbSNP
rs1426614446 63 dbSNP
rs1468932310 65 dbSNP
rs1403971169 76 dbSNP
rs757961967 81 dbSNP
rs370091001 82 dbSNP
rs377244438 86 dbSNP
rs1307005397 89 dbSNP
rs1427471054 90 dbSNP
rs565691805 91 dbSNP
rs1167419372 122 dbSNP
rs778653778 124 dbSNP
rs1406396874 132 dbSNP
rs1022766511 134 dbSNP
rs879152719 135 dbSNP
rs566461350 146 dbSNP
rs1223036487 148 dbSNP
rs1263974824 148 dbSNP
rs1321460861 148 dbSNP
rs200721235 148 dbSNP
rs1484397435 150 dbSNP
rs1193790183 153 dbSNP
rs1016428621 155 dbSNP
rs1185847013 157 dbSNP
rs112392860 160 dbSNP
rs1438271050 160 dbSNP
rs1184295499 162 dbSNP
rs150387941 163 dbSNP
rs1266739847 164 dbSNP
rs373146104 164 dbSNP
rs752767473 164 dbSNP
rs529020414 171 dbSNP
rs1396257213 175 dbSNP
rs894451074 178 dbSNP
rs568177581 179 dbSNP
rs1344234763 185 dbSNP
rs999568376 194 dbSNP
rs1057233338 201 dbSNP
rs1003394824 206 dbSNP
rs1479814854 208 dbSNP
rs903256730 228 dbSNP
rs3785961 232 dbSNP
rs1225545825 234 dbSNP
rs945189909 240 dbSNP
rs1339797457 249 dbSNP
rs1321008806 250 dbSNP
rs1207097984 256 dbSNP
rs1266672545 259 dbSNP
rs1490186434 272 dbSNP
rs1199427033 274 dbSNP
rs1271225335 275 dbSNP
rs1011015804 284 dbSNP
rs1192065984 286 dbSNP
rs140777493 294 dbSNP
rs1329204274 301 dbSNP
rs1287242630 304 dbSNP
rs1364178256 307 dbSNP
rs1053669913 325 dbSNP
rs943030050 326 dbSNP
rs1424595994 329 dbSNP
rs1294133990 335 dbSNP
rs1369856869 341 dbSNP
rs1380641628 350 dbSNP
rs1295102213 353 dbSNP
rs1039211250 362 dbSNP
rs1407599443 363 dbSNP
rs1230338003 366 dbSNP
rs944833218 368 dbSNP
rs1349523312 378 dbSNP
rs910241566 379 dbSNP
rs987140806 383 dbSNP
rs1358571610 389 dbSNP
rs564519780 395 dbSNP
rs546479489 396 dbSNP
rs1266657162 399 dbSNP
rs1437667912 412 dbSNP
rs1204097368 413 dbSNP
rs933099150 416 dbSNP
rs527938481 424 dbSNP
rs1349760801 426 dbSNP
rs1163372860 430 dbSNP
rs919011101 437 dbSNP
rs1459319687 441 dbSNP
rs866037907 442 dbSNP
rs1412780719 444 dbSNP
rs972641822 448 dbSNP
rs1166062350 449 dbSNP
rs753067091 450 dbSNP
rs767938622 456 dbSNP
rs1427565061 460 dbSNP
rs1191508671 463 dbSNP
rs1288438511 468 dbSNP
rs1488025042 469 dbSNP
rs368660624 477 dbSNP
rs758264325 478 dbSNP
rs1210512521 479 dbSNP
rs183807581 480 dbSNP
rs1314753572 484 dbSNP
rs1465332507 487 dbSNP
rs541789991 492 dbSNP
rs1266872852 493 dbSNP
rs755324120 497 dbSNP
rs1268227391 498 dbSNP
rs1465933849 499 dbSNP
rs928996830 510 dbSNP
rs1242187304 521 dbSNP
rs1461127821 526 dbSNP
rs920279449 527 dbSNP
rs752110344 528 dbSNP
rs1158410380 534 dbSNP
rs1301568533 535 dbSNP
rs1458981607 551 dbSNP
rs1334936487 557 dbSNP
rs1405693226 562 dbSNP
rs948479067 566 dbSNP
rs1304375012 574 dbSNP
rs915619736 577 dbSNP
rs958930752 579 dbSNP
rs1223166635 581 dbSNP
rs1288380325 583 dbSNP
rs1330564751 584 dbSNP
rs1221202354 590 dbSNP
rs1036130931 591 dbSNP
rs1370674294 594 dbSNP
rs1324375836 596 dbSNP
rs1002869802 609 dbSNP
rs1437832315 610 dbSNP
rs992713001 611 dbSNP
rs960134470 617 dbSNP
rs750314684 626 dbSNP
rs1319926072 627 dbSNP
rs747646550 628 dbSNP
rs1451751089 629 dbSNP
rs1473601799 632 dbSNP
rs1174450647 638 dbSNP
rs903308487 641 dbSNP
rs1428774283 649 dbSNP
rs1379500107 651 dbSNP
rs1177906386 653 dbSNP
rs1177025079 660 dbSNP
rs1352572053 665 dbSNP
rs1432893332 666 dbSNP
rs1393026523 667 dbSNP
rs977725796 668 dbSNP
rs765286080 669 dbSNP
rs1402553647 670 dbSNP
rs1282097972 673 dbSNP
rs1022320390 677 dbSNP
rs150975868 686 dbSNP
rs1202802997 689 dbSNP
rs1483933185 693 dbSNP
rs76369956 694 dbSNP
rs1315253591 695 dbSNP
rs1306096742 706 dbSNP
rs1018104843 708 dbSNP
rs752869729 715 dbSNP
rs778336202 719 dbSNP
rs1484324105 722 dbSNP
rs191714504 723 dbSNP
rs890601025 725 dbSNP
rs943295204 726 dbSNP
rs1193100541 730 dbSNP
rs1417694157 737 dbSNP
rs1409139099 740 dbSNP
rs1169059481 742 dbSNP
rs1047866847 744 dbSNP
rs889030115 757 dbSNP
rs899389825 758 dbSNP
rs1331212380 761 dbSNP
rs1037330366 763 dbSNP
rs1231116841 774 dbSNP
rs1438039153 774 dbSNP
rs1051905954 776 dbSNP
rs1366498163 776 dbSNP
rs766765275 777 dbSNP
rs915695390 778 dbSNP
rs1247575588 779 dbSNP
rs1381064826 781 dbSNP
rs1344875260 810 dbSNP
rs576190500 815 dbSNP
rs992976664 823 dbSNP
rs1452226745 824 dbSNP
rs938552963 838 dbSNP
rs763116469 839 dbSNP
rs1449099052 840 dbSNP
rs977226091 847 dbSNP
rs1391811220 849 dbSNP
rs1442661225 851 dbSNP
rs919007170 853 dbSNP
rs773107649 859 dbSNP
rs765500329 867 dbSNP
rs1391425335 869 dbSNP
rs1465677871 872 dbSNP
rs143560518 879 dbSNP
rs1170202431 887 dbSNP
rs909408128 892 dbSNP
rs1344177230 895 dbSNP
rs536332644 902 dbSNP
rs1321593664 905 dbSNP
rs1367750784 919 dbSNP
rs958982260 928 dbSNP
rs1035944560 929 dbSNP
rs762190437 933 dbSNP
rs1230036448 945 dbSNP
rs539762285 950 dbSNP
rs1464576391 956 dbSNP
rs967373038 968 dbSNP
rs1209636193 970 dbSNP
rs1020802745 973 dbSNP
rs1009413766 977 dbSNP
rs954787705 980 dbSNP
rs1186649333 984 dbSNP
rs1368983630 992 dbSNP
rs1473743029 994 dbSNP
rs1484462904 1005 dbSNP
rs1011646651 1007 dbSNP
rs1026905994 1012 dbSNP
rs1410624777 1012 dbSNP
rs993584930 1017 dbSNP
rs1322107269 1019 dbSNP
rs1403516751 1034 dbSNP
rs565952000 1047 dbSNP
rs899461809 1049 dbSNP
rs1205491049 1053 dbSNP
rs1037907533 1059 dbSNP
rs768617332 1060 dbSNP
rs1277815930 1064 dbSNP
rs1251173493 1067 dbSNP
rs1229141602 1068 dbSNP
rs1270236857 1069 dbSNP
rs1225865363 1070 dbSNP
rs1199599680 1073 dbSNP
rs1256620709 1080 dbSNP
rs1444026314 1081 dbSNP
rs865941589 1093 dbSNP
rs1012563582 1099 dbSNP
rs1313441090 1100 dbSNP
rs893211120 1101 dbSNP
rs1160826357 1102 dbSNP
rs370862234 1105 dbSNP
rs1310060139 1106 dbSNP
rs938445251 1110 dbSNP
rs1172312330 1111 dbSNP
rs1007394538 1113 dbSNP
rs1395500302 1118 dbSNP
rs1165998543 1120 dbSNP
rs889032116 1122 dbSNP
rs1051652924 1139 dbSNP
rs1306694387 1161 dbSNP
rs1459319558 1163 dbSNP
rs1410513578 1182 dbSNP
rs1369020433 1186 dbSNP
rs535478804 1200 dbSNP
rs932994349 1209 dbSNP
rs186536865 1210 dbSNP
rs1035966574 1216 dbSNP
rs550719649 1217 dbSNP
rs947201549 1218 dbSNP
rs183694203 1226 dbSNP
rs1193912720 1232 dbSNP
rs908959151 1237 dbSNP
rs1250190494 1244 dbSNP
rs537495942 1250 dbSNP
rs1055928215 1254 dbSNP
rs571034167 1259 dbSNP
rs552315019 1262 dbSNP
rs1183636504 1265 dbSNP
rs771860217 1269 dbSNP
rs928891510 1270 dbSNP
rs1266566218 1271 dbSNP
rs1379062499 1273 dbSNP
rs1467889570 1278 dbSNP
rs1233259757 1282 dbSNP
rs981690803 1289 dbSNP
rs1370418070 1293 dbSNP
rs1430970826 1294 dbSNP
rs1290363737 1300 dbSNP
rs1309886544 1326 dbSNP
rs60639022 1329 dbSNP
rs913257619 1330 dbSNP
rs1335411108 1331 dbSNP
rs560439244 1331 dbSNP
rs990140700 1333 dbSNP
rs548455772 1336 dbSNP
rs1388322425 1339 dbSNP
rs200202665 1342 dbSNP
rs745400711 1342 dbSNP
rs957479642 1344 dbSNP
rs1224882232 1352 dbSNP
rs1018329866 1353 dbSNP
rs1007404287 1359 dbSNP
rs1296615179 1360 dbSNP
rs1342728440 1369 dbSNP
rs1207249697 1373 dbSNP
rs1289556884 1374 dbSNP
rs1325104465 1375 dbSNP
rs1487860835 1378 dbSNP
rs373927325 1386 dbSNP
rs78271230 1387 dbSNP
rs373132611 1394 dbSNP
rs997465168 1399 dbSNP
rs117954678 1411 dbSNP
rs910555483 1422 dbSNP
rs1036022003 1428 dbSNP
rs577235200 1431 dbSNP
rs987455021 1431 dbSNP
rs796185775 1443 dbSNP
rs1005841314 1456 dbSNP
rs1457467143 1458 dbSNP
rs1294198282 1461 dbSNP
rs193232088 1470 dbSNP
rs1453660438 1484 dbSNP
rs1319600639 1490 dbSNP
rs1268543018 1493 dbSNP
rs954962143 1495 dbSNP
rs1230401113 1499 dbSNP
rs1026394375 1506 dbSNP
rs1467570227 1510 dbSNP
rs759867714 1523 dbSNP
rs756789516 1524 dbSNP
rs1270029932 1529 dbSNP
rs937521379 1531 dbSNP
rs1207675426 1540 dbSNP
rs928797761 1544 dbSNP
rs1016495598 1552 dbSNP
rs77577638 1567 dbSNP
rs1190975949 1569 dbSNP
rs946351401 1572 dbSNP
rs913482211 1574 dbSNP
rs546048554 1575 dbSNP
rs990150465 1580 dbSNP
rs957322493 1593 dbSNP
rs1455748663 1598 dbSNP
rs911322143 1602 dbSNP
rs1437007196 1608 dbSNP
rs749000244 1615 dbSNP
rs1378279653 1622 dbSNP
rs777382980 1625 dbSNP
rs1396561818 1630 dbSNP
rs1314816207 1633 dbSNP
rs1326430737 1642 dbSNP
rs1227303787 1652 dbSNP
rs1057211204 1653 dbSNP
rs1330777269 1656 dbSNP
rs1218314243 1662 dbSNP
rs1483185719 1665 dbSNP
rs1182920645 1668 dbSNP
rs1258939593 1674 dbSNP
rs1438556169 1674 dbSNP
rs1181635944 1677 dbSNP
rs1390756977 1680 dbSNP
rs1320588688 1683 dbSNP
rs1358396970 1688 dbSNP
rs1466400958 1690 dbSNP
rs1030191462 1693 dbSNP
rs149709101 1693 dbSNP
rs1002504304 1694 dbSNP
rs902971480 1698 dbSNP
rs188914890 1702 dbSNP
rs1351897702 1704 dbSNP
rs1217146338 1709 dbSNP
rs947232757 1716 dbSNP
rs1311953940 1719 dbSNP
rs1211335786 1720 dbSNP
rs1283083677 1721 dbSNP
rs1482365414 1736 dbSNP
rs774751222 1737 dbSNP
rs1181481873 1749 dbSNP
rs962026725 1749 dbSNP
rs1173933938 1756 dbSNP
rs1014755647 1763 dbSNP
rs1005849858 1764 dbSNP
rs887417970 1767 dbSNP
rs1189669429 1774 dbSNP
rs1424793263 1776 dbSNP
rs1433548031 1782 dbSNP
rs554150380 1783 dbSNP
rs1177967078 1784 dbSNP
rs1368568483 1784 dbSNP
rs914425546 1784 dbSNP
rs1371833975 1786 dbSNP
rs1039528609 1787 dbSNP
rs535743301 1788 dbSNP
rs183633038 1790 dbSNP
rs1306107128 1792 dbSNP
rs987913755 1792 dbSNP
rs1360163836 1803 dbSNP
rs1205117985 1805 dbSNP
rs906935179 1806 dbSNP
rs1193419490 1807 dbSNP
rs1045936992 1808 dbSNP
rs869200731 1809 dbSNP
rs10595554 1810 dbSNP
rs1219548905 1810 dbSNP
rs555845291 1810 dbSNP
rs71660032 1810 dbSNP
rs71728958 1810 dbSNP
rs755375631 1810 dbSNP
rs933326862 1810 dbSNP
rs1169120374 1813 dbSNP
rs35981445 1813 dbSNP
rs946166229 1813 dbSNP
rs1392013683 1818 dbSNP
rs1403093136 1820 dbSNP
rs972103410 1820 dbSNP
rs892058261 1821 dbSNP
rs1054681581 1822 dbSNP
rs1016402155 1824 dbSNP
rs1446471855 1824 dbSNP
rs1282330574 1829 dbSNP
rs991640541 1830 dbSNP
rs959218988 1834 dbSNP
rs936005209 1844 dbSNP
rs1342085728 1847 dbSNP
rs911249815 1852 dbSNP
rs1002986815 1859 dbSNP
rs1231852890 1863 dbSNP
rs1289271571 1879 dbSNP
rs1452363393 1885 dbSNP
rs902836489 1887 dbSNP
rs1020071294 1890 dbSNP
rs985851221 1890 dbSNP
rs1367205083 1892 dbSNP
rs1298209908 1905 dbSNP
rs1243709297 1906 dbSNP
rs1471777619 1906 dbSNP
rs1162078121 1925 dbSNP
rs1011343292 1927 dbSNP
rs1429981215 1929 dbSNP
rs1406644171 1930 dbSNP
rs934123705 1930 dbSNP
rs1156480468 1939 dbSNP
rs922677301 1942 dbSNP
rs1434738597 1954 dbSNP
rs1335685817 1956 dbSNP
rs1414624834 1957 dbSNP
rs975944076 1958 dbSNP
rs537962144 1959 dbSNP
rs1039559829 1963 dbSNP
rs961819992 1969 dbSNP
rs1284166872 1981 dbSNP
rs1357113985 1984 dbSNP
rs891069041 1990 dbSNP
rs570421071 2001 dbSNP
rs1392463179 2009 dbSNP
rs1187612740 2011 dbSNP
rs1475409309 2013 dbSNP
rs1286117769 2030 dbSNP
rs1240374619 2036 dbSNP
rs1440592606 2038 dbSNP
rs933339481 2043 dbSNP
rs1238032800 2058 dbSNP
rs1475898282 2068 dbSNP
rs1179393129 2087 dbSNP
rs984651555 2098 dbSNP
rs1410689525 2103 dbSNP
rs1189716372 2105 dbSNP
rs919276610 2114 dbSNP
rs1486101064 2128 dbSNP
rs951947659 2137 dbSNP
rs1034049609 2138 dbSNP
rs1413166128 2138 dbSNP
rs34898821 2138 dbSNP
rs191779859 2153 dbSNP
rs1343996084 2157 dbSNP
rs1275169384 2158 dbSNP
rs1213906015 2159 dbSNP
rs1350052919 2160 dbSNP
rs1229281274 2164 dbSNP
rs1337381596 2165 dbSNP
rs187530036 2166 dbSNP
rs1448160506 2167 dbSNP
rs1199725203 2169 dbSNP
rs1279153716 2169 dbSNP
rs528420902 2169 dbSNP
rs909264242 2169 dbSNP
rs1202342031 2171 dbSNP
rs1250461809 2171 dbSNP
rs1354326168 2171 dbSNP
rs1310667699 2175 dbSNP
rs770350433 2177 dbSNP
rs1477241213 2178 dbSNP
rs148886657 2179 dbSNP
rs1376533677 2185 dbSNP
rs1437148935 2190 dbSNP
rs751882640 2199 dbSNP
rs1372786046 2201 dbSNP
rs1171580825 2232 dbSNP
rs891946258 2233 dbSNP
rs1309409230 2235 dbSNP
rs1409831806 2242 dbSNP
rs766923122 2243 dbSNP
rs967592962 2244 dbSNP
rs758764489 2246 dbSNP
rs1349910693 2248 dbSNP
rs1226042702 2250 dbSNP
rs936266347 2251 dbSNP
rs890032747 2266 dbSNP
rs1475560978 2269 dbSNP
rs1197104015 2270 dbSNP
rs1256947497 2278 dbSNP
rs1011207120 2283 dbSNP
rs1198539623 2284 dbSNP
rs1049791926 2290 dbSNP
rs1455888347 2291 dbSNP
rs1186066845 2294 dbSNP
rs933946387 2296 dbSNP
rs1462561982 2297 dbSNP
rs182536783 2302 dbSNP
rs560527900 2303 dbSNP
rs1388779776 2317 dbSNP
rs1233184327 2318 dbSNP
rs190318237 2320 dbSNP
rs1326872229 2327 dbSNP
rs1372879006 2331 dbSNP
rs940549065 2333 dbSNP
rs1305653322 2339 dbSNP
rs185216073 2343 dbSNP
rs1342790542 2344 dbSNP
rs890942244 2344 dbSNP
rs1333519156 2352 dbSNP
rs77164190 2356 dbSNP
rs776154248 2357 dbSNP
rs1470100112 2359 dbSNP
rs1229790523 2363 dbSNP
rs1350736786 2367 dbSNP
rs1429648350 2371 dbSNP
rs1034639324 2376 dbSNP
rs765289573 2382 dbSNP
rs929924162 2383 dbSNP
rs761959467 2384 dbSNP
rs1457511548 2395 dbSNP
rs550675853 2397 dbSNP
rs1441970122 2399 dbSNP
rs897045191 2412 dbSNP
rs1353168159 2422 dbSNP
rs1319661157 2423 dbSNP
rs1326069506 2427 dbSNP
rs1383886815 2429 dbSNP
rs1243720806 2433 dbSNP
rs1036325790 2439 dbSNP
rs777030374 2451 dbSNP
rs1339347041 2456 dbSNP
rs1233431403 2460 dbSNP
rs776584342 2461 dbSNP
rs1417231164 2472 dbSNP
rs1207157815 2474 dbSNP
rs1267924159 2475 dbSNP
rs942035945 2479 dbSNP
rs181003945 2483 dbSNP
rs1473656420 2487 dbSNP
rs565414121 2492 dbSNP
rs891538255 2503 dbSNP
rs1420218431 2517 dbSNP
rs1455864076 2523 dbSNP
rs1158092539 2538 dbSNP
rs928838367 2550 dbSNP
rs981982569 2554 dbSNP
rs867639391 2558 dbSNP
rs1301001390 2566 dbSNP
rs540722276 2569 dbSNP
rs34366332 2576 dbSNP
rs1348193377 2577 dbSNP
rs143960646 2577 dbSNP
rs16731 2577 dbSNP
rs34835509 2577 dbSNP
rs369288812 2577 dbSNP
rs560341570 2579 dbSNP
rs544315393 2584 dbSNP
rs957011623 2585 dbSNP
rs760564841 2588 dbSNP
rs1254704213 2589 dbSNP
rs1270662272 2590 dbSNP
rs542115427 2593 dbSNP
rs1006657541 2600 dbSNP
rs1471675616 2602 dbSNP
rs1181705085 2610 dbSNP
rs890045660 2617 dbSNP
rs1029507686 2620 dbSNP
rs1173704222 2621 dbSNP
rs1305829092 2623 dbSNP
rs1435295088 2650 dbSNP
rs993923807 2663 dbSNP
rs1221750150 2665 dbSNP
rs775094093 2666 dbSNP
rs1050399122 2668 dbSNP
rs772055141 2669 dbSNP
rs1408748455 2670 dbSNP
rs897120238 2673 dbSNP
rs1277028798 2675 dbSNP
rs1375077727 2676 dbSNP
rs901146050 2678 dbSNP
rs1037018670 2687 dbSNP
rs1006207509 2691 dbSNP
rs1347741790 2695 dbSNP
rs1235625872 2698 dbSNP
rs1394398649 2699 dbSNP
rs1482108481 2707 dbSNP
rs1323924852 2713 dbSNP
rs1458906026 2714 dbSNP
rs887762182 2720 dbSNP
rs1345902737 2721 dbSNP
rs1481751606 2727 dbSNP
rs1189201044 2734 dbSNP
rs940139806 2735 dbSNP
rs759461603 2738 dbSNP
rs8614 2751 dbSNP
rs1426938783 2758 dbSNP
rs1428465831 2761 dbSNP
rs1048882967 2762 dbSNP
rs115363545 2768 dbSNP
rs1433888746 2780 dbSNP
rs927243228 2783 dbSNP
rs928670104 2785 dbSNP
rs1442176034 2788 dbSNP
rs1306267600 2795 dbSNP
rs1340670279 2796 dbSNP
rs980401196 2801 dbSNP
rs971320371 2805 dbSNP
rs557889713 2811 dbSNP
rs1252668606 2819 dbSNP
rs913515092 2821 dbSNP
rs537469189 2825 dbSNP
rs1475055748 2826 dbSNP
rs1485888783 2835 dbSNP
rs576756502 2836 dbSNP
rs1420988764 2839 dbSNP
rs1259698186 2843 dbSNP
rs1213190778 2844 dbSNP
rs916930811 2845 dbSNP
rs192242138 2846 dbSNP
rs533598165 2850 dbSNP
rs1282829158 2854 dbSNP
rs187405578 2854 dbSNP
rs1235517194 2866 dbSNP
rs1430600506 2868 dbSNP
rs957584492 2871 dbSNP
rs1364152762 2874 dbSNP
rs779225631 2879 dbSNP
rs1272705885 2883 dbSNP
rs1335741480 2884 dbSNP
rs985497410 2890 dbSNP
rs1266044861 2892 dbSNP
rs1029824109 2901 dbSNP
rs1193783982 2901 dbSNP
rs955154246 2901 dbSNP
rs993995666 2905 dbSNP
rs1418057027 2906 dbSNP
rs1032724128 2912 dbSNP
rs1167504798 2914 dbSNP
rs777434512 2933 dbSNP
rs143534853 2935 dbSNP
rs866251005 2941 dbSNP
rs1386876448 2943 dbSNP
rs1400547970 2947 dbSNP
rs1000375119 2950 dbSNP
rs1288380355 2951 dbSNP
rs536974611 2957 dbSNP
rs1445837177 2958 dbSNP
rs114691986 2960 dbSNP
rs1028593586 2969 dbSNP
rs1173976129 2974 dbSNP
rs1235333370 2986 dbSNP
rs565185008 2987 dbSNP
rs1349666512 2995 dbSNP
rs745682202 3000 dbSNP
rs1286181119 3002 dbSNP
rs1440647185 3006 dbSNP
rs1209472440 3009 dbSNP
rs1393079170 3019 dbSNP
rs1190433193 3021 dbSNP
rs1429111931 3025 dbSNP
rs1469884000 3025 dbSNP
rs1260367539 3028 dbSNP
rs1410735547 3030 dbSNP
rs1433434158 3036 dbSNP
rs901414090 3048 dbSNP
rs1376121859 3066 dbSNP
rs1184264757 3080 dbSNP
rs1484007422 3081 dbSNP
rs1306401766 3083 dbSNP
rs546444312 3085 dbSNP
rs1037029639 3086 dbSNP
rs1209771742 3089 dbSNP
rs1239430689 3093 dbSNP
rs1281096088 3104 dbSNP
rs1342741511 3106 dbSNP
rs1214584260 3107 dbSNP
rs34339676 3107 dbSNP
rs1281019838 3108 dbSNP
rs200395732 3108 dbSNP
rs1347604202 3109 dbSNP
rs747377100 3113 dbSNP
rs1202410006 3114 dbSNP
rs895028264 3118 dbSNP
rs1182931439 3122 dbSNP
rs68097310 3124 dbSNP
rs1230185646 3125 dbSNP
rs1166245465 3126 dbSNP
rs1368493075 3126 dbSNP
rs1395984134 3126 dbSNP
rs1436587999 3126 dbSNP
rs71986075 3126 dbSNP
rs766605601 3126 dbSNP
rs1439976121 3127 dbSNP
rs1303975380 3128 dbSNP
rs778657016 3129 dbSNP
rs900547659 3130 dbSNP
rs750074327 3131 dbSNP
rs750295345 3131 dbSNP
rs757241568 3131 dbSNP
rs1055799776 3132 dbSNP
rs1225480933 3132 dbSNP
rs140005524 3132 dbSNP
rs761397813 3132 dbSNP
rs1294892414 3135 dbSNP
rs1197158363 3136 dbSNP
rs1380624336 3141 dbSNP
rs1467367334 3144 dbSNP
rs202213662 3144 dbSNP
rs1193473429 3151 dbSNP
rs1254159078 3151 dbSNP
rs35476527 3151 dbSNP
rs758774325 3153 dbSNP
rs1191070102 3160 dbSNP
rs1372531669 3162 dbSNP
rs1462578124 3167 dbSNP
rs1414471852 3168 dbSNP
rs1392644634 3170 dbSNP
rs1373383083 3176 dbSNP
rs1048433890 3182 dbSNP
rs1326391772 3188 dbSNP
rs1373057455 3189 dbSNP
rs551243604 3199 dbSNP
rs867601231 3201 dbSNP
rs1462376999 3203 dbSNP
rs907316686 3237 dbSNP
rs1228979173 3242 dbSNP
rs927141140 3242 dbSNP
rs1263308379 3244 dbSNP
rs1333773915 3257 dbSNP
rs569870457 3263 dbSNP
rs545287766 3268 dbSNP
rs1274238635 3271 dbSNP
rs1044222989 3289 dbSNP
rs1470129497 3290 dbSNP
rs946220980 3292 dbSNP
rs891987169 3314 dbSNP
rs950042493 3318 dbSNP
rs1195494346 3319 dbSNP
rs1257652442 3321 dbSNP
rs879177749 3325 dbSNP
rs936245139 3326 dbSNP
rs917169559 3327 dbSNP
rs985182659 3330 dbSNP
rs1396346569 3332 dbSNP
rs988477399 3336 dbSNP
rs1255766827 3337 dbSNP
rs1385664063 3339 dbSNP
rs933643674 3359 dbSNP
rs867313299 3362 dbSNP
rs532443304 3369 dbSNP
rs1290955416 3387 dbSNP
rs1354394129 3390 dbSNP
rs750938988 3393 dbSNP
rs922408203 3395 dbSNP
rs1251220090 3397 dbSNP
rs925707246 3398 dbSNP
rs1237427739 3420 dbSNP
rs1225923314 3422 dbSNP
rs972440862 3426 dbSNP
rs978483622 3428 dbSNP
rs1016738214 3446 dbSNP
rs1255442519 3452 dbSNP
rs571667723 3457 dbSNP
rs1028939946 3460 dbSNP
rs959356109 3460 dbSNP
rs140502530 3461 dbSNP
rs1330596254 3463 dbSNP
rs1001570155 3467 dbSNP
rs373267120 3468 dbSNP
rs1455317249 3470 dbSNP
rs907178990 3472 dbSNP
rs1374268500 3477 dbSNP
rs1015761584 3481 dbSNP
rs1024287810 3481 dbSNP
rs1004181027 3484 dbSNP
rs767670690 3488 dbSNP
rs1054631877 3490 dbSNP
rs1317932521 3493 dbSNP
rs146790287 3498 dbSNP
rs1002727757 3502 dbSNP
rs1347157992 3509 dbSNP
rs1211772131 3520 dbSNP
rs1163586633 3522 dbSNP
rs905268164 3524 dbSNP
rs149786154 3534 dbSNP
rs1176377297 3538 dbSNP
rs1413742115 3544 dbSNP
rs753916520 3549 dbSNP
rs1182137760 3551 dbSNP
rs933696873 3554 dbSNP
rs139798759 3558 dbSNP
rs922281866 3562 dbSNP
rs1434789208 3571 dbSNP
rs895744383 3573 dbSNP
rs1175032260 3575 dbSNP
rs1352373532 3576 dbSNP
rs972345204 3577 dbSNP
rs1374438975 3578 dbSNP
rs1052996912 3579 dbSNP
rs1301874999 3591 dbSNP
rs1370983218 3594 dbSNP
rs1235084760 3595 dbSNP
rs1280875338 3596 dbSNP
rs1305867687 3605 dbSNP
rs1194576210 3606 dbSNP
rs529877124 3612 dbSNP
rs925633295 3615 dbSNP
rs1273820337 3616 dbSNP
rs1213181044 3620 dbSNP
rs1332893767 3622 dbSNP
rs150649975 3639 dbSNP
rs959453044 3646 dbSNP
rs1252277313 3651 dbSNP
rs1195458409 3661 dbSNP
rs535846111 3661 dbSNP
rs1416711919 3664 dbSNP
rs932429523 3665 dbSNP
rs1408877977 3675 dbSNP
rs1170626321 3677 dbSNP
rs1355985521 3685 dbSNP
rs1467498214 3687 dbSNP
rs1324356387 3688 dbSNP
rs371075015 3695 dbSNP
rs1442229203 3702 dbSNP
rs1334943990 3705 dbSNP
rs1359881223 3706 dbSNP
rs1214063506 3710 dbSNP
rs1296552414 3713 dbSNP
rs970642368 3714 dbSNP
rs1211559806 3717 dbSNP
rs977329884 3720 dbSNP
rs965543520 3721 dbSNP
rs1015815754 3734 dbSNP
rs1240291173 3742 dbSNP
rs16964955 3761 dbSNP
rs891925334 3762 dbSNP
rs1033087202 3770 dbSNP
rs952950038 3801 dbSNP
rs1000398472 3810 dbSNP
rs889935805 3813 dbSNP
rs1442927267 3820 dbSNP
rs139596040 3827 dbSNP
rs374028305 3827 dbSNP
rs1462304322 3836 dbSNP
rs1326031616 3839 dbSNP
rs1344013032 3840 dbSNP
rs142911763 3842 dbSNP
rs1459391453 3844 dbSNP
rs1342490756 3845 dbSNP
rs1386545644 3849 dbSNP
rs1158778987 3854 dbSNP
rs901401498 3856 dbSNP
rs1036693679 3858 dbSNP
rs763173335 3860 dbSNP
rs1363529146 3869 dbSNP
rs1229888107 3872 dbSNP
rs1282050766 3878 dbSNP
rs939679665 3879 dbSNP
rs909661953 3880 dbSNP
rs1264655666 3881 dbSNP
rs1484416522 3889 dbSNP
rs905276994 3890 dbSNP
rs1455936025 3893 dbSNP
rs558091162 3895 dbSNP
rs1254205359 3896 dbSNP
rs1025024033 3899 dbSNP
rs1362479382 3901 dbSNP
rs62065195 3903 dbSNP
rs920359798 3903 dbSNP
rs895629790 3920 dbSNP
rs926461898 3923 dbSNP
rs1277595978 3925 dbSNP
rs1349729157 3931 dbSNP
rs1224221603 3934 dbSNP
rs1052921900 3949 dbSNP
rs1286514538 3954 dbSNP
rs934594367 3960 dbSNP
rs557052221 3965 dbSNP
rs752962193 3985 dbSNP
rs1209609960 3995 dbSNP
rs904435317 3996 dbSNP
rs12150225 4000 dbSNP
rs1179266652 4001 dbSNP
rs1231489550 4003 dbSNP
rs932297592 4004 dbSNP
rs1159714791 4015 dbSNP
rs913819224 4016 dbSNP
rs921023753 4033 dbSNP
rs1173148256 4036 dbSNP
rs1371518790 4037 dbSNP
rs1416341517 4038 dbSNP
rs1327126057 4039 dbSNP
rs976503842 4046 dbSNP
rs1442664870 4049 dbSNP
rs116593081 4050 dbSNP
rs571462792 4054 dbSNP
rs182402847 4060 dbSNP
rs1000709280 4070 dbSNP
rs1280371713 4074 dbSNP
rs1346538670 4078 dbSNP
rs1327661838 4079 dbSNP
rs1437607566 4080 dbSNP
rs1179721861 4083 dbSNP
rs1240548373 4090 dbSNP
rs1318427949 4098 dbSNP
rs551640755 4109 dbSNP
rs982904424 4111 dbSNP
rs1399693390 4115 dbSNP
rs998326919 4115 dbSNP
rs1166302921 4116 dbSNP
rs147533649 4117 dbSNP
rs1382368200 4118 dbSNP
rs1396124328 4124 dbSNP
rs953004138 4127 dbSNP
rs1157182384 4128 dbSNP
rs1333172760 4134 dbSNP
rs1436948267 4141 dbSNP
rs1396109693 4143 dbSNP
rs901465563 4158 dbSNP
rs1037230656 4159 dbSNP
rs1003855463 4162 dbSNP
rs569426779 4164 dbSNP
rs188776476 4173 dbSNP
rs1199632039 4174 dbSNP
rs981187650 4181 dbSNP
rs1467431679 4182 dbSNP
rs969388832 4184 dbSNP
rs1213553819 4191 dbSNP
rs143324719 4195 dbSNP
rs1434973074 4202 dbSNP
rs937766520 4204 dbSNP
rs1372695548 4207 dbSNP
rs1446587855 4209 dbSNP
rs1013695110 4210 dbSNP
rs1173125351 4211 dbSNP
rs1259885913 4212 dbSNP
rs1415322491 4220 dbSNP
rs376881055 4222 dbSNP
rs1460737426 4225 dbSNP
rs1294043157 4248 dbSNP
rs926353392 4249 dbSNP
rs1380005907 4256 dbSNP
rs1046698549 4257 dbSNP
rs114988914 4262 dbSNP
rs1220036416 4270 dbSNP
rs913850318 4275 dbSNP
rs1279407987 4277 dbSNP
rs1333061262 4298 dbSNP
rs765626229 4298 dbSNP
rs1009132236 4299 dbSNP
rs1266529329 4302 dbSNP
rs762473387 4304 dbSNP
rs373490940 4311 dbSNP
rs925958794 4323 dbSNP
rs998688755 4324 dbSNP
rs1196034363 4334 dbSNP
rs886703972 4340 dbSNP
rs184387882 4341 dbSNP
rs1474752578 4343 dbSNP
rs1042947428 4346 dbSNP
rs1048337785 4347 dbSNP
rs528615291 4348 dbSNP
rs996933743 4350 dbSNP
rs368931672 4351 dbSNP
rs978753095 4364 dbSNP
rs1401312533 4386 dbSNP
rs3744629 4391 dbSNP
rs1310691709 4394 dbSNP
rs1041094603 4396 dbSNP
rs781623700 4398 dbSNP
rs943822752 4401 dbSNP
rs1413223449 4416 dbSNP
rs954275158 4426 dbSNP
rs1422299124 4430 dbSNP
rs1028397568 4440 dbSNP
rs1285937760 4449 dbSNP
rs998787637 4451 dbSNP
rs965497406 4455 dbSNP
rs1255644447 4463 dbSNP
rs1485490842 4464 dbSNP
rs908296328 4466 dbSNP
rs762281067 4470 dbSNP
rs1004434785 4472 dbSNP
rs1417095363 4481 dbSNP
rs1047220561 4482 dbSNP
rs181093719 4486 dbSNP
rs529886704 4487 dbSNP
rs920183874 4490 dbSNP
rs1486127382 4496 dbSNP
rs375940958 4498 dbSNP
rs1207799344 4501 dbSNP
rs1304246945 4501 dbSNP
rs1027069204 4510 dbSNP
rs562698457 4514 dbSNP
rs1309159301 4522 dbSNP
rs1378362008 4523 dbSNP
rs981024050 4529 dbSNP
rs138600496 4533 dbSNP
rs904976240 4541 dbSNP
rs1046135772 4542 dbSNP
rs1257986374 4546 dbSNP
rs1201229228 4550 dbSNP
rs561831901 4555 dbSNP
rs747810904 4555 dbSNP
rs917954467 4571 dbSNP
rs368827438 4574 dbSNP
rs565861937 4576 dbSNP
rs562810097 4578 dbSNP
rs1191699260 4579 dbSNP
rs1052241564 4581 dbSNP
rs936583275 4591 dbSNP
rs1177789410 4594 dbSNP
rs1352464184 4610 dbSNP
rs866026782 4616 dbSNP
rs564561463 4619 dbSNP
rs1331146811 4620 dbSNP
rs1401521774 4623 dbSNP
rs1449593316 4632 dbSNP
rs979212308 4635 dbSNP
rs956815992 4636 dbSNP
rs932654109 4639 dbSNP
rs1303659699 4640 dbSNP
rs780874751 4644 dbSNP
rs1031053650 4653 dbSNP
rs998698668 4662 dbSNP
rs3744630 4664 dbSNP
rs1446245311 4665 dbSNP
rs1356682872 4666 dbSNP
rs572492688 4669 dbSNP
rs745540534 4669 dbSNP
rs1330136153 4671 dbSNP
rs147145225 4674 dbSNP
rs369410625 4675 dbSNP
rs1015722389 4681 dbSNP
rs1167193769 4682 dbSNP
rs899737925 4684 dbSNP
rs1040753802 4686 dbSNP
rs1475637671 4690 dbSNP
rs1417446998 4692 dbSNP
rs542705697 4698 dbSNP
rs1027229421 4705 dbSNP
rs1295398659 4706 dbSNP
rs1359988396 4707 dbSNP
rs1218194691 4711 dbSNP
rs886867396 4714 dbSNP
rs1002307317 4720 dbSNP
rs1231293041 4721 dbSNP
rs1233310983 4723 dbSNP
rs1046770132 4727 dbSNP
rs746201487 4729 dbSNP
rs1239813131 4733 dbSNP
rs1487684559 4734 dbSNP
rs575753976 4738 dbSNP
rs1025037929 4745 dbSNP
rs931499763 4746 dbSNP
rs920130901 4752 dbSNP
rs1045629060 4753 dbSNP
rs1213793741 4754 dbSNP
rs768141100 4759 dbSNP
rs1333579624 4760 dbSNP
rs1406414440 4764 dbSNP
rs1167550723 4776 dbSNP
rs1343446649 4785 dbSNP
rs1291022234 4788 dbSNP
rs948365329 4789 dbSNP
rs1342671491 4793 dbSNP
rs1412671283 4801 dbSNP
rs1052271694 4803 dbSNP
rs1356814079 4810 dbSNP
rs149474332 4813 dbSNP
rs1282071489 4819 dbSNP
rs1352328717 4826 dbSNP
rs539354703 4827 dbSNP
rs1375995758 4828 dbSNP
rs1280513229 4833 dbSNP
rs903795702 4835 dbSNP
rs992164732 4837 dbSNP
rs1375374406 4838 dbSNP
rs1186433760 4843 dbSNP
rs1050343617 4849 dbSNP
rs956660738 4851 dbSNP
rs1327956532 4852 dbSNP
rs1462011410 4868 dbSNP
rs578242371 4870 dbSNP
rs1184036429 4873 dbSNP
rs553678498 4874 dbSNP
rs188656647 4875 dbSNP
rs1162943845 4877 dbSNP
rs1159375407 4884 dbSNP
rs1362576403 4889 dbSNP
rs921285987 4898 dbSNP
rs1340778452 4902 dbSNP
rs976686764 4909 dbSNP
rs944128643 4917 dbSNP
rs1176416622 4922 dbSNP
rs1437694013 4924 dbSNP
rs1345141698 4931 dbSNP
rs1199466837 4934 dbSNP
rs1278893041 4937 dbSNP
rs77801180 4937 dbSNP
rs1212745379 4938 dbSNP
rs1254790255 4938 dbSNP
rs56721092 4939 dbSNP
rs908629888 4939 dbSNP
rs982945429 4940 dbSNP
rs1263227009 4941 dbSNP
rs1027674272 4942 dbSNP
rs1275054663 4943 dbSNP
rs868779013 4944 dbSNP
rs970016986 4945 dbSNP
rs1013221245 4946 dbSNP
rs796880169 4947 dbSNP
rs1239911000 4948 dbSNP
rs77869361 4949 dbSNP
rs10550408 4950 dbSNP
rs1213383788 4950 dbSNP
rs1317682592 4950 dbSNP
rs1385704729 4950 dbSNP
rs1394396760 4950 dbSNP
rs180737279 4950 dbSNP
rs565592466 4950 dbSNP
rs796502046 4950 dbSNP
rs141125053 4951 dbSNP
rs1038162724 4952 dbSNP
rs371772846 4952 dbSNP
rs749606166 4953 dbSNP
rs768213671 4953 dbSNP
rs12952681 4960 dbSNP
rs1030751425 4961 dbSNP
rs1366532704 4964 dbSNP
rs1457301828 4964 dbSNP
rs1478017580 4964 dbSNP
rs1163785882 4966 dbSNP
rs1392181863 4967 dbSNP
rs1417401779 4968 dbSNP
rs544679088 4969 dbSNP
rs1340801179 4978 dbSNP
rs1291875844 4979 dbSNP
rs1400957780 4980 dbSNP
rs183578563 4981 dbSNP
rs1244621576 4985 dbSNP
rs1266550790 4991 dbSNP
rs1358554658 4996 dbSNP
rs1000723094 4999 dbSNP
rs568974849 5002 dbSNP
rs550658930 5003 dbSNP
rs903701955 5006 dbSNP
rs756252278 5024 dbSNP
rs1253749922 5028 dbSNP
rs996114216 5029 dbSNP
rs901718523 5030 dbSNP
rs1174170964 5037 dbSNP
rs771768845 5040 dbSNP
rs192489282 5046 dbSNP
rs189047826 5050 dbSNP
rs1157572246 5052 dbSNP
rs1360640594 5063 dbSNP
rs1421085432 5066 dbSNP
rs944032309 5072 dbSNP
rs908661089 5078 dbSNP
rs1047118803 5082 dbSNP
rs1395878315 5083 dbSNP
rs1187791767 5086 dbSNP
rs931366602 5086 dbSNP
rs1238651685 5087 dbSNP
rs920119601 5090 dbSNP
rs1354521060 5097 dbSNP
rs556588318 5112 dbSNP
rs752914536 5117 dbSNP
rs1214053413 5118 dbSNP
rs1482799740 5122 dbSNP
rs918172794 5125 dbSNP
rs1258147978 5127 dbSNP
rs1351960737 5128 dbSNP
rs546484118 5129 dbSNP
rs767749116 5131 dbSNP
rs1235587063 5132 dbSNP
rs528124671 5140 dbSNP
rs1299234299 5154 dbSNP
rs1216380842 5159 dbSNP
rs1030646967 5171 dbSNP
rs1362796548 5179 dbSNP
rs1297815452 5181 dbSNP
rs1408791873 5183 dbSNP
rs560896144 5186 dbSNP
rs137976055 5187 dbSNP
rs575262888 5193 dbSNP
rs1313262799 5197 dbSNP
rs751320644 5198 dbSNP
rs1375877645 5203 dbSNP
rs1311873936 5204 dbSNP
rs1172510445 5210 dbSNP
rs1428565572 5218 dbSNP
rs1456285010 5225 dbSNP
rs766308257 5229 dbSNP
rs968166740 5232 dbSNP
rs563749572 5235 dbSNP
rs1259967986 5236 dbSNP
rs1212087318 5241 dbSNP
rs1423987849 5242 dbSNP
rs1433361692 5244 dbSNP
rs1177810951 5247 dbSNP
rs1431817859 5248 dbSNP
rs901791881 5250 dbSNP
rs996409175 5250 dbSNP
rs150331807 5253 dbSNP
rs1444430774 5257 dbSNP
rs1008206880 5266 dbSNP
rs1230340473 5271 dbSNP
rs1291821240 5280 dbSNP
rs887128557 5280 dbSNP
rs1387505681 5286 dbSNP
rs1293120189 5292 dbSNP
rs1047022392 5307 dbSNP
rs1315827052 5312 dbSNP
rs1217845539 5328 dbSNP
rs1258607514 5329 dbSNP
rs577607495 5330 dbSNP
rs1277660885 5338 dbSNP
rs578205601 5339 dbSNP
rs773118902 5341 dbSNP
rs1488525686 5346 dbSNP
rs1357634259 5347 dbSNP
rs1293625781 5354 dbSNP
rs1201129606 5368 dbSNP
rs1260664842 5372 dbSNP
rs553742222 5376 dbSNP
rs1395218853 5379 dbSNP
rs1045279140 5380 dbSNP
rs764774560 5384 dbSNP
rs948214173 5385 dbSNP
rs1353357024 5388 dbSNP
rs1349302181 5390 dbSNP
rs1167922466 5392 dbSNP
rs1458532374 5393 dbSNP
rs1305169336 5398 dbSNP
rs1475962218 5402 dbSNP
rs535331714 5408 dbSNP
rs1338779265 5423 dbSNP
rs1399131790 5426 dbSNP
rs918203721 5434 dbSNP
rs1186829594 5442 dbSNP
rs992427247 5445 dbSNP
rs956912256 5455 dbSNP
rs1321781440 5463 dbSNP
rs1224141298 5464 dbSNP
rs565122760 5464 dbSNP
rs1283406191 5472 dbSNP
rs1487736679 5477 dbSNP
rs1193967278 5487 dbSNP
rs1242997038 5494 dbSNP
rs923607119 5495 dbSNP
rs1180616011 5501 dbSNP
rs16964954 5512 dbSNP
rs1165594653 5514 dbSNP
rs1029152036 5515 dbSNP
rs974631820 5517 dbSNP
rs965831591 5523 dbSNP
rs1481247003 5525 dbSNP
rs1257456453 5531 dbSNP
rs1196852578 5534 dbSNP
rs1337102614 5536 dbSNP
rs1283504888 5538 dbSNP
rs1379860955 5539 dbSNP
rs1248125217 5543 dbSNP
rs144205050 5554 dbSNP
rs1244426929 5556 dbSNP
rs1216795329 5560 dbSNP
rs1285990063 5563 dbSNP
rs555700152 5569 dbSNP
rs1449080108 5570 dbSNP
rs761353063 5583 dbSNP
rs1308900906 5589 dbSNP
rs1237380046 5595 dbSNP
rs1462124362 5597 dbSNP
rs1185988571 5602 dbSNP
rs1378486701 5609 dbSNP
rs185384878 5612 dbSNP
rs1025646987 5621 dbSNP
rs1410501736 5622 dbSNP
rs1412516581 5627 dbSNP
rs570160562 5629 dbSNP
rs1376106641 5639 dbSNP
rs1359551013 5641 dbSNP
rs898615235 5643 dbSNP
rs1454457788 5644 dbSNP
rs1329230469 5646 dbSNP
rs1375510850 5654 dbSNP
rs1045545505 5656 dbSNP
rs138715421 5664 dbSNP
rs896666749 5668 dbSNP
rs1056610786 5673 dbSNP
rs545302911 5682 dbSNP
rs1278299007 5688 dbSNP
rs1462054198 5688 dbSNP
rs1206119362 5700 dbSNP
rs1394667310 5703 dbSNP
rs1236946145 5704 dbSNP
rs1457354835 5711 dbSNP
rs1162267723 5714 dbSNP
rs776176084 5716 dbSNP
rs768301397 5717 dbSNP
rs1367015765 5718 dbSNP
rs1172228768 5727 dbSNP
rs193264698 5728 dbSNP
rs774794012 5733 dbSNP
rs1420148258 5734 dbSNP
rs1399517795 5736 dbSNP
rs946361817 5737 dbSNP
rs1177361943 5738 dbSNP
rs1469877229 5742 dbSNP
rs1328871151 5754 dbSNP
rs1435233601 5754 dbSNP
rs1275077683 5759 dbSNP
rs1324702201 5764 dbSNP
rs1225788095 5775 dbSNP
rs1256682010 5788 dbSNP
rs770888660 5793 dbSNP
rs921726373 5794 dbSNP
rs1209409941 5795 dbSNP
rs974917650 5797 dbSNP
rs1275138794 5800 dbSNP
rs965739107 5802 dbSNP
rs1018742612 5804 dbSNP
rs983210491 5808 dbSNP
rs1481280305 5809 dbSNP
rs1191282036 5822 dbSNP
rs1422693573 5825 dbSNP
rs1239534173 5850 dbSNP
rs1352778295 5852 dbSNP
rs950677805 5852 dbSNP
rs187407889 5853 dbSNP
rs1027978942 5859 dbSNP
rs1303356900 5860 dbSNP
rs569596788 5860 dbSNP
rs995552884 5862 dbSNP
rs1276648575 5870 dbSNP
rs1371019358 5873 dbSNP
rs546494696 5875 dbSNP
rs1228713551 5884 dbSNP
rs528330630 5885 dbSNP
rs1384672506 5894 dbSNP
rs1386707304 5896 dbSNP
rs1012343272 5903 dbSNP
rs896531054 5905 dbSNP
rs1158834270 5910 dbSNP
rs749212307 5912 dbSNP
rs1056684970 5913 dbSNP
rs1214748034 5915 dbSNP
rs935476894 5927 dbSNP
rs902795795 5929 dbSNP
rs1366698416 5947 dbSNP
rs1157372297 5948 dbSNP
rs1163626258 5963 dbSNP
rs1356403895 5979 dbSNP
rs1366925956 5988 dbSNP
rs1417420888 5989 dbSNP
rs1297211353 5997 dbSNP
rs560735955 5999 dbSNP
rs1383181773 6006 dbSNP
rs1044349767 6007 dbSNP
rs946965193 6015 dbSNP
rs771422099 6024 dbSNP
rs749870310 6026 dbSNP
rs1198289674 6027 dbSNP
rs1315759945 6040 dbSNP
rs1450035978 6043 dbSNP
rs1238160556 6052 dbSNP
rs183120372 6055 dbSNP
rs1205989446 6057 dbSNP
rs1285661087 6060 dbSNP
rs1486059895 6061 dbSNP
rs530401173 6062 dbSNP
rs974401957 6063 dbSNP
rs944464289 6064 dbSNP
rs368519635 6067 dbSNP
rs563428998 6069 dbSNP
rs545116142 6072 dbSNP
rs950541830 6073 dbSNP
rs1327720630 6083 dbSNP
rs920548379 6100 dbSNP
rs1400540864 6104 dbSNP
rs973748555 6115 dbSNP
rs533614033 6116 dbSNP
rs756190027 6125 dbSNP
rs1452472306 6130 dbSNP
rs1337965920 6131 dbSNP
rs559938554 6134 dbSNP
rs541754098 6140 dbSNP
rs1399077954 6143 dbSNP
rs1385079911 6154 dbSNP
rs574249267 6159 dbSNP
rs1360228955 6163 dbSNP
rs1296745178 6164 dbSNP
rs969965046 6172 dbSNP
rs1253969139 6173 dbSNP
rs748221062 6183 dbSNP
rs79357209 6184 dbSNP
rs1024057982 6190 dbSNP
rs374484745 6196 dbSNP
rs1204221510 6199 dbSNP
rs1012250004 6200 dbSNP
rs1456049741 6201 dbSNP
rs555764057 6210 dbSNP
rs960814370 6212 dbSNP
rs1173533370 6221 dbSNP
rs1477065063 6228 dbSNP
rs1376214069 6234 dbSNP
rs1469669796 6238 dbSNP
rs1035088787 6241 dbSNP
rs1408994502 6247 dbSNP
rs1445258521 6248 dbSNP
rs1297635396 6249 dbSNP
rs2661 6255 dbSNP
rs760347893 6256 dbSNP
rs1194583706 6273 dbSNP
rs755172017 6280 dbSNP
rs1374167074 6282 dbSNP
rs1393295781 6283 dbSNP
rs1299553323 6285 dbSNP
rs1344628304 6292 dbSNP
rs1223945634 6297 dbSNP
rs543834604 6304 dbSNP
rs1315940455 6316 dbSNP
rs1260716123 6318 dbSNP
rs1212777969 6323 dbSNP
rs1251321149 6325 dbSNP
rs1481330508 6332 dbSNP
rs1485902502 6334 dbSNP
rs1266304239 6336 dbSNP
rs1277787914 6340 dbSNP
rs576350087 6344 dbSNP
rs1198724142 6347 dbSNP
rs902698383 6350 dbSNP
rs372870738 6353 dbSNP
rs1270288443 6367 dbSNP
rs1170369618 6369 dbSNP
rs1043872976 6370 dbSNP
rs1463648189 6372 dbSNP
rs1338012702 6374 dbSNP
rs573408028 6375 dbSNP
rs559765484 6384 dbSNP
rs1405811036 6386 dbSNP
rs748282078 6387 dbSNP
rs1284902918 6396 dbSNP
rs1416986701 6398 dbSNP
rs1338157453 6408 dbSNP
rs1011582790 6413 dbSNP
rs1296290752 6420 dbSNP
rs1360151254 6424 dbSNP
rs1334081458 6428 dbSNP
rs1490397636 6434 dbSNP
rs900715627 6436 dbSNP
rs1038715958 6439 dbSNP
rs1398640174 6440 dbSNP
rs944370117 6450 dbSNP
rs911673125 6451 dbSNP
rs755063272 6458 dbSNP
rs1047454603 6460 dbSNP
rs557880250 6460 dbSNP
rs1305190738 6472 dbSNP
rs543770235 6472 dbSNP
rs973219343 6472 dbSNP
rs1289352752 6479 dbSNP
rs1421721980 6480 dbSNP
rs1364039256 6493 dbSNP
rs1190376325 6496 dbSNP
rs190172020 6501 dbSNP
rs1359543160 6502 dbSNP
rs758164741 6505 dbSNP
rs1283516537 6513 dbSNP
rs990847252 6538 dbSNP
rs1215578052 6543 dbSNP
rs1243083673 6549 dbSNP
rs1487106305 6552 dbSNP
rs960677012 6557 dbSNP
rs1236739063 6573 dbSNP
rs1384610741 6580 dbSNP
rs750398931 6585 dbSNP
rs765115469 6598 dbSNP
rs144842908 6599 dbSNP
rs1378751553 6606 dbSNP
rs1399864270 6609 dbSNP
rs552716711 6611 dbSNP
rs1346760098 6620 dbSNP
rs1197485531 6626 dbSNP
rs1315581256 6628 dbSNP
rs534633062 6629 dbSNP
rs187313606 6631 dbSNP
rs548988349 6634 dbSNP
rs1454165598 6643 dbSNP
rs530565251 6644 dbSNP
rs1380272331 6645 dbSNP
rs1224011122 6648 dbSNP
rs900786380 6662 dbSNP
rs758680300 6666