miRTarBase - #MIRT522778 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LAMP2   
Synonyms CD107b, LAMP-2, LAMPB, LGP-96, LGP110
Description lysosomal associated membrane protein 2
Transcript NM_002294   
Other Transcripts NM_001122606 , NM_013995   
Expression
Putative miRNA Targets on LAMP2
3'UTR of LAMP2
(miRNA target sites are highlighted)
>LAMP2|NM_002294|3'UTR
   1 AATCTGCAACCTGATTGATTATATAAAAATACATGCAAATAACAAGATTTTCTTACCTCTCAGTTGTTGAAACACTTTGC
  81 TTCTTAAAATTGATATGTTGAAACTTTAATTCTTTTATCAATCCCAGCATTTTGAGATCAGTCTTTATTAATAAAACCTG
 161 TTCTCTTTAATCAGCTTAAAATCCAAAGTGTCATATTTACTGGTCCTGGAGACAAACTTGTTCAAAAGAACATCAACGTG
 241 CAATGTTTTAAGGTCTATCTTAAGAAGCCCTGGCCAAATTTTGATCCTAACCTTGAAGTATGCCTTGAACTTATTAACAT
 321 GGCCATTATAAGAATAAAATATGTAGTTGTGTCTTAATGGAATTAATAAATGTCATTTCACTACTGGTGTTCTGTTTCAA
 401 TGTATAAGGACTATAGTGATTTAAACTCATCAATGTGCCTTTGCATAAAGTTCATTAAATAAATATTGATGTGGTATAAA
 481 TGCCCATCAGATATGCTTAAACTTGGTTTTCAGTTGAATGAAGTAGAGAATGTCCTCAGGACCATCAGCATTTTAAAGGT
 561 TATGTGACTTTTGCTGATTTCTCTGAGTTCAAGTTAAGCATGAAGTTAGTACCTCAAGCCTGTGATTTTTCCCTAGGGAT
 641 GATACAGACCCAAGAGGCTACAACAGAACTTAAACTGGCTTCGTAATTAGAGTTTTTAAGATAATTGTTTGTTTTTCAGC
 721 AATATAGACTGAAAAGATCCAAGCATATTTAGCCACTTGCTTTTTTGTTTCTTGTTTTGTTCTTCTTTGGATGCCTGATT
 801 AGTATTGAAAGATAGAAATATTCTATGAACTAATTAGGACAGATTGTGTTGTGTTTCTCTACCTCATCTTGTTGATCTCT
 881 GGAGCATTAAAATCTATTTAGTGTTGTCATCAGTGTGGTACTTATGAAATGTAAGCTAACAGCAATCTCAGAAGGGAGGC
 961 AGTGAAGCATAGCAACTAGGCTCTTGTTTCTTCAAGATGGCCCCTGTGGGGCAGTGCATAGATGGGGGTGTAAAGAGAAG
1041 CTGTTGGCATTAAAATGAGCTAGATAATCAGCCCTTGTTGAAGCATATTCCATGGTATAAGAGTAGCACAGACATGAAAC
1121 ATAGATAAAGAAGGAAGGCTTAATAGACTAGAAGACTTCCACATTGAAGTATTATTAACCCATTGTATGTATATAGGGGC
1201 ATGATCAGAGTCTCTATAACTTCCTGATTAACAATACAGTGTATCTTGTTACCCAGCTGTCAGTCTTTGAGAGCTTTCAG
1281 TAAAATATAGTAAATTCTTTCAGCATAGGCTAATGTGTGGTTACTGAGATGAGTGTTGTGTACTCAGAACCGTAGCAACA
1361 TTTTTATGAATGGTAAAAGTACAAGAGGAGGAAAAGTTAAAATTAGAAGAAAAGTACAAGTTATTGCTTAATCATAAATC
1441 ACACCAGATAACACATTTTGTTAATTTCATTAGCTATTACTGGAAAGGACCTTAACGATTATTTACAGAAAGGGGAGTGA
1521 AATTCATTGAGGTTCCATATCAAGTGGGCAACAAAACTATTACTAGCATTTTGATAAAAATTGCCCCTAATGAAATCTAG
1601 TCACTCAACAGTAAAACAACAGCTGGTTTACACTTGAAATTATGAGATCAGAATTGGGCACTTTGGGCTTCCGTACTATG
1681 TTTTGCTTAAGTTTTTTTTTTAATACTAATATGGGCTTTTTCAGTAGTAATATACCAAAACACTTCTATTTTAATCTCTG
1761 TTTGCTACTTCAAAACCTAATCCTCCTCAGATGGGATCATGAGCATAAGAGGAAAAGAGAAGAGAATGAATACTTGTTGA
1841 CCTCTTGATGTGTATCAGATGCTTTAGAAATGTAATTGTATTTAATCCTCAAATACCTTATAGGTATTATTATCCCCTTC
1921 TTACAGATGAGGAAAGTGAGGCCCAGTTTAAATAACTTGCCCAAGGTCCTTTGGCTAGTACTGGAAGGAGTCAAGATTTA
2001 AACACAGTTCTGTCTGAATCCAGAACTCAAAATCTACATTGCACATGTTGCTTTCCTGGTGGTTCGGTGGAATGGACTGC
2081 AACGCATTAGATACTGCTGTTATTCTTCCAGGCCACCGCTCAGCTAAAAATAATTGTGTGTGTGTGTATATATATATATA
2161 TGTACACACACACACATATATATACACACACACATATATATACACATATACATATATATACACATATATATACACACACA
2241 TATATATGTATATATATACTACATTCTTGATCCTAAGTCTTTTTTAACTTAAATTTTATTACTTATACAGAATTCTTATT
2321 TATACTTTAATTATAGGTGTGACGAAGAGAAAGAGAGTAGGGAAATACACAGGCAGTGGTTTTAAGTGTAGATGATGGCT
2401 CCTTAACCCAGTGTCATTAGATAATCAAACCTAAAGTCTTCCCATATTAGGCAAGCGCAATTCTCTATTTTGGACCCTTC
2481 CCATTCTTCCCTTACCTTCTGCTTTTCGTACTGAGGAATTTCGTGTGATTTTAGATAAAGTGATAATGAGATATTGAGCA
2561 AATAAGAAAATAGAGGTAATGCTATAAAAAACTAAGCTATGTACACTTTCAAAATGCATGTTTCTTGCATGCTTTTTACT
2641 ACTTAATTGCATTCTTTGCTAATTTCCTTTCCTTGCTGTCTGTTCTTTTCTAACAGCTGAAGAATGTTCTGCTGACTCTG
2721 ACCTCAACTTTCTTATTCCTGTTGCAGTGGGTGTGGCCTTGGGCTTCCTTATAATTGTTGTCTTTATCTCTTATATGATT
2801 GGAAGAAGGAAAAGTCGTACTGGTTATCAGTCTGTGTAATCAGTTAAATCTAGTGTTTGTTTGTTTTTTTCAATTAGAAG
2881 TTACGTTTCCATTGGCTAAAAGCCAGGACATGCTGTGCAATAGATTGTTTAAGATATGCAGACTAACTTCAGTGAGTTCC
2961 TAGCTAACTTGGGCATGAGTACACTTATTTAAGACAAAATATATTAGGACCAATTTTTTTCTGTTTTTTTTCTTCCTTTG
3041 TTAAAGTATAATTAAAAGAAAAATTGTGGCTTAGAATTTTTTAAGTAAATAATGATTTTAAGCCCCTGGATCCAATTATG
3121 AAAGCATTTTTGCTGATGTGTAATTTTATATGTTACAGTTACTTATATTTTACTACTTTGATGTTATTTGCAAAATCAAA
3201 GGTGTTAAAGAATTTAACTTGCTTCAGGAAATAAATTCAAGAACATAGTGGATTCATTTTCATTGGTGGCAGACACGAAA
3281 TTTGGTTCATGATAAGACTTCCTTTCCCCACCTCCTGATCAGCATTATTTAAATCTGTATTTTTCTGTTAGTTAAGAAAG
3361 AAATGGCTTCATGATATTGTATTTAATAGCAAAAGTTTGGCTGTCTTCTTCATTACTGTTAATAGCTACTATATTTTAAC
3441 AAGGAGATTTCTTTTTTTGTTGTTGTTGTTCTAGAGTTTGGAATATACTGATTATCTCAGACTTGACATTTATACTGAAG
3521 GATGAAGTAAGACCTCCAGCTTTTTTTAAAAAAGGTGTTGATTTGGAACACCTGTATGGGTTATGGTTTATTAAGGTTAT
3601 GGTTTAGAAAGTTTTTTTCCCTCAGAGCCTTAACTTGTTAAGAAGGTTCATTTATCCTGCACTGAAAACAAAAACTCTAT
3681 ATACTTTGTTTGTGTGCCTCCTGCACTCTCCCATTCCCTATGTGAATATGCTCTAGTTGATATTTTTAATATATTGATTT
3761 CTTTTTTCTCACAGCAACAAGTGCTTACTCTAGAGGTTAGTGGGCCCTGATATGTCATCAGTCAGATGCCTGCCTAGCCA
3841 AAGCTGGACTAAGATTATTCTGTACATTTGTTGATCTTGATATAGACTTATATCCCTGTAGGGACTGCTAATGGCTCCGG
3921 CTTCTGGAGTAAGGTACTGGAGACCACTCATCCCTGTGTCTGCTTGATTGGTTCAGCTGTTGAATTGCCCTTTTATTTGG
4001 AAGCAGTGTTGAAGTTGTCTAGGGTTCAAATGGCTGCTTTGTACACCTGTCATTAGTATAAGGCAGATGTTTATTTTATC
4081 AAGCTATTTTATCTCTACATTTAACTAAAAACAAAAGTTCCCAAAGATCTGCCTTCACTTCAGAAATTTTTTTTGGATTA
4161 AAAAAATTAAGCCTGAACCTTAAATAAAGTGAGTTGGTTATTCATTCCAAGGATTAAGTCCCAATCTACCTCTCAGCACA
4241 ATGCAGAAGCTCACCACTGTATTGCTGCCATTAACTCATGCCAGAACCCTTTGCCAATAACTGGAATTACAAATTTTTGT
4321 TAAAGAAAATTTATCAAGATCTTTCTTTACTGCCTTCTCTATATGTACATCTCAAAAACATGTACATCTCAAAAACTGGA
4401 GTAGAAAGTTAGATTGCTCAACTACAACTCCTCTAGAACTCTATAGCTCTGACATACAGATTCACACTCTCCTCTATTTG
4481 CTAAGTATGTAAAGAATGTTTTCTTTTAAAATGTTCTCTTTTGAGAACAACTGCTTATTTGTTATAAAAGCATTTGGTTA
4561 AAATGATGTCATCATAAAAAACAGTGGCTTTGTTTCAATACATATTTTTGAGATGATTATCTAGAAGCCAGATTAATAAA
4641 ATCAGCTTGTGACCTTGCTAAGCATATAAACTGGAAATTCAGATACATTCAAAATTATGGGTTCATTTAAAAGTGTTCTA
4721 CCTTTTGGGTATGAGACTAATATCACTAATTCCTCAATAGTTATCATGGCTCTATCTTAATTAATTAGAAAATATGTGTG
4801 TTTAATTCTTTGAGAATTAAAATAGAGAATATTAACAGAGGGTTAAAAACTGCTTCAACTCCAATAAGATAAAGGAAGCT
4881 CAAAATCTATGAGCTGAGTGTTCAATTAGCTTTGCCTACTGAGTTCAATTTTATGTCAATACAACAGTGGATCAGACAGT
4961 ACGACTTTGAACTGGTGAATGTAAACAATTGTTTTTCACCTAAGCTGCTTTGGAAGAACTGATGCTTGCTGCTAACTAAA
5041 GTTTTGGATGTATCGATTTAGAGAACCAATTAATACCTGCAAAATAAAGCATACTGTGGTACTTCTGTTTGATCTAGTAT
5121 GTGTGATTTTAGATTGATGGATTAAAAATTAATAAAGATCATACATTCCATACCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :|||:: |:  ||||||| 
Target 5' gaaGAACTGATGCTTGCTGCTa 3'
5013 - 5034 155.00 -12.80
2
miRNA  3' guGUUUGGUAA--UA-CACGACGAu 5'
            |||  ||||  ||  |||||:| 
Target 5' tgCAACGCATTAGATACTGCTGTTa 3'
2078 - 2102 142.00 -12.00
3
miRNA  3' guGUUU--G--GUAA--UACACGACGAu 5'
            ||||  |  ||||  |  ||:|||| 
Target 5' ctCAAAATCTACATTGCACATGTTGCTt 3'
2026 - 2053 138.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
179016 15 ClinVar
367785 33 ClinVar
367784 205 ClinVar
1208755 237 ClinVar
912657 238 ClinVar
367783 297 ClinVar
367782 477 ClinVar
367781 486 ClinVar
367780 586 ClinVar
367779 653 ClinVar
367778 692 ClinVar
367777 721 ClinVar
367776 853 ClinVar
914618 975 ClinVar
367775 1071 ClinVar
367774 1096 ClinVar
367773 1191 ClinVar
914617 1243 ClinVar
367772 1314 ClinVar
367771 1356 ClinVar
914114 1413 ClinVar
367770 1589 ClinVar
367769 1617 ClinVar
367768 1632 ClinVar
367767 1672 ClinVar
367766 1702 ClinVar
367765 2005 ClinVar
914113 2147 ClinVar
367764 2148 ClinVar
367761 2162 ClinVar
367762 2162 ClinVar
367763 2162 ClinVar
367760 2183 ClinVar
367759 2195 ClinVar
367758 2261 ClinVar
367757 2395 ClinVar
367756 2460 ClinVar
913721 2476 ClinVar
913720 2518 ClinVar
367755 2524 ClinVar
367754 2538 ClinVar
912620 2575 ClinVar
367753 2736 ClinVar
43956 2746 ClinVar
1176953 2752 ClinVar
43957 2773 ClinVar
912619 2794 ClinVar
912618 2955 ClinVar
367752 3032 ClinVar
367751 3248 ClinVar
367750 3249 ClinVar
914581 3263 ClinVar
914580 3276 ClinVar
367749 3355 ClinVar
914579 3413 ClinVar
914578 3452 ClinVar
914577 3459 ClinVar
367748 3471 ClinVar
914576 3488 ClinVar
914575 3494 ClinVar
914067 3563 ClinVar
914066 3583 ClinVar
367747 3677 ClinVar
367746 3687 ClinVar
367745 3689 ClinVar
914065 4004 ClinVar
914064 4006 ClinVar
367744 4562 ClinVar
367743 4579 ClinVar
913670 4664 ClinVar
367742 4671 ClinVar
913669 4757 ClinVar
367741 4763 ClinVar
367740 4858 ClinVar
367739 4961 ClinVar
367738 4964 ClinVar
367737 5038 ClinVar
367736 5048 ClinVar
367735 5172 ClinVar
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1389561037 8 dbSNP
rs1193961180 9 dbSNP
rs376806600 15 dbSNP
rs935426216 20 dbSNP
rs1474057100 21 dbSNP
rs753374435 24 dbSNP
rs1315522163 26 dbSNP
rs1203163355 31 dbSNP
rs745798436 33 dbSNP
rs903963937 41 dbSNP
rs891188414 42 dbSNP
rs1332177028 45 dbSNP
rs1439372411 49 dbSNP
rs1196417658 72 dbSNP
rs1178770428 73 dbSNP
rs768475790 75 dbSNP
rs1480682300 84 dbSNP
rs1201495258 90 dbSNP
rs1050285762 96 dbSNP
rs1461524403 97 dbSNP
rs778938403 112 dbSNP
rs749090092 124 dbSNP
rs757173953 124 dbSNP
rs1403968956 139 dbSNP
rs898643725 150 dbSNP
rs542576305 152 dbSNP
rs1038575879 155 dbSNP
rs1272173313 172 dbSNP
rs1213705229 181 dbSNP
rs1366578608 203 dbSNP
rs41300191 205 dbSNP
rs1265758827 209 dbSNP
rs1238954574 224 dbSNP
rs908795462 236 dbSNP
rs143070918 237 dbSNP
rs1226004799 241 dbSNP
rs371031457 257 dbSNP
rs753133641 260 dbSNP
rs917617678 267 dbSNP
rs1801135 296 dbSNP
rs8160 297 dbSNP
rs1490448572 300 dbSNP
rs959191331 310 dbSNP
rs755520529 314 dbSNP
rs1224691745 319 dbSNP
rs766396944 321 dbSNP
rs1428020389 325 dbSNP
rs1375007847 342 dbSNP
rs758434357 350 dbSNP
rs1471971639 390 dbSNP
rs1032582981 400 dbSNP
rs1163163365 406 dbSNP
rs1366639073 428 dbSNP
rs749885888 430 dbSNP
rs1426913848 446 dbSNP
rs750939378 477 dbSNP
rs185972753 485 dbSNP
rs5957383 486 dbSNP
rs386827301 487 dbSNP
rs1318327300 492 dbSNP
rs1008155913 495 dbSNP
rs1452930600 514 dbSNP
rs1242228354 523 dbSNP
rs1313895378 525 dbSNP
rs1364360913 527 dbSNP
rs1247844288 541 dbSNP
rs756938982 550 dbSNP
rs891114974 555 dbSNP
rs916829066 557 dbSNP
rs1205641246 558 dbSNP
rs1028350037 560 dbSNP
rs997340226 565 dbSNP
rs1264020326 567 dbSNP
rs181333906 583 dbSNP
rs41312757 586 dbSNP
rs1038903198 590 dbSNP
rs918266438 620 dbSNP
rs1157168627 635 dbSNP
rs1363729461 638 dbSNP
rs1193866796 639 dbSNP
rs972481170 651 dbSNP
rs1057515744 653 dbSNP
rs1469587906 656 dbSNP
rs940187990 657 dbSNP
rs962764576 663 dbSNP
rs1259019950 683 dbSNP
rs184344224 684 dbSNP
rs1057515743 692 dbSNP
rs1351970339 693 dbSNP
rs1306892472 702 dbSNP
rs1316105982 707 dbSNP
rs1263051881 708 dbSNP
rs761300966 715 dbSNP
rs1057515742 721 dbSNP
rs887326511 721 dbSNP
rs985690345 725 dbSNP
rs1343002948 731 dbSNP
rs1203064520 736 dbSNP
rs1347623215 742 dbSNP
rs1243987669 756 dbSNP
rs1304698805 761 dbSNP
rs1462770076 767 dbSNP
rs1176993966 779 dbSNP
rs1250322565 788 dbSNP
rs1420025882 805 dbSNP
rs1046000020 806 dbSNP
rs1184651590 821 dbSNP
rs1376386724 825 dbSNP
rs1467793950 842 dbSNP
rs1175004894 843 dbSNP
rs1443366669 848 dbSNP
rs763861761 853 dbSNP
rs917570754 877 dbSNP
rs775142637 878 dbSNP
rs1391724158 886 dbSNP
rs937724187 890 dbSNP
rs925059882 896 dbSNP
rs1343497810 901 dbSNP
rs771496857 904 dbSNP
rs1222984901 909 dbSNP
rs762796984 924 dbSNP
rs901821982 925 dbSNP
rs1197038483 944 dbSNP
rs1250939471 950 dbSNP
rs1481181108 974 dbSNP
rs1179268991 975 dbSNP
rs1265890497 980 dbSNP
rs368723660 1002 dbSNP
rs1480436358 1006 dbSNP
rs966530783 1018 dbSNP
rs1031405542 1024 dbSNP
rs1481116418 1025 dbSNP
rs1432852397 1026 dbSNP
rs1353514264 1027 dbSNP
rs1394247518 1027 dbSNP
rs1020774241 1028 dbSNP
rs999554973 1029 dbSNP
rs1174072762 1030 dbSNP
rs903930986 1031 dbSNP
rs759105844 1041 dbSNP
rs1455291415 1043 dbSNP
rs1043853074 1049 dbSNP
rs986663835 1057 dbSNP
rs955333158 1062 dbSNP
rs2285548 1071 dbSNP
rs770959886 1074 dbSNP
rs1206884588 1088 dbSNP
rs1264113499 1092 dbSNP
rs5957382 1096 dbSNP
rs1223939982 1124 dbSNP
rs181690821 1125 dbSNP
rs1017030849 1164 dbSNP
rs939598084 1182 dbSNP
rs1004327482 1191 dbSNP
rs1057515741 1191 dbSNP
rs887254365 1196 dbSNP
rs972792122 1200 dbSNP
rs1423729007 1204 dbSNP
rs941076536 1213 dbSNP
rs1485667008 1216 dbSNP
rs769587066 1216 dbSNP
rs1045970755 1220 dbSNP
rs1288433901 1222 dbSNP
rs147825361 1243 dbSNP
rs894734694 1248 dbSNP
rs1359219778 1257 dbSNP
rs1247115321 1269 dbSNP
rs985178749 1273 dbSNP
rs1294607737 1288 dbSNP
rs1377284400 1291 dbSNP
rs1445716143 1299 dbSNP
rs1215694016 1305 dbSNP
rs1241069282 1306 dbSNP
rs953856280 1308 dbSNP
rs1187937542 1312 dbSNP
rs5957381 1314 dbSNP
rs937710864 1322 dbSNP
rs140499497 1325 dbSNP
rs1398940569 1334 dbSNP
rs772626501 1334 dbSNP
rs1158260092 1350 dbSNP
rs1328263172 1351 dbSNP
rs188897063 1356 dbSNP
rs1432928705 1364 dbSNP
rs1335001085 1380 dbSNP
rs1382236383 1382 dbSNP
rs747215176 1391 dbSNP
rs976581946 1399 dbSNP
rs1317693811 1410 dbSNP
rs1348963259 1411 dbSNP
rs773379092 1413 dbSNP
rs1374827738 1428 dbSNP
rs772282965 1430 dbSNP
rs956130181 1435 dbSNP
rs1285534326 1442 dbSNP
rs1317021019 1450 dbSNP
rs1210002064 1465 dbSNP
rs1260880140 1469 dbSNP
rs986632884 1476 dbSNP
rs779447908 1486 dbSNP
rs1031625569 1489 dbSNP
rs185680374 1492 dbSNP
rs1468382621 1496 dbSNP
rs1166981048 1497 dbSNP
rs1176584373 1512 dbSNP
rs754306794 1527 dbSNP
rs1402541155 1547 dbSNP
rs1374286210 1560 dbSNP
rs1174287559 1568 dbSNP
rs1405439544 1570 dbSNP
rs1185206835 1573 dbSNP
rs73612906 1589 dbSNP
rs1258852927 1603 dbSNP
rs1022764315 1605 dbSNP
rs141881232 1617 dbSNP
rs1376092866 1623 dbSNP
rs1229701680 1626 dbSNP
rs755434692 1632 dbSNP
rs895288139 1639 dbSNP
rs752352307 1642 dbSNP
rs1017380403 1652 dbSNP
rs1203950659 1654 dbSNP
rs1004293028 1662 dbSNP
rs951483166 1666 dbSNP
rs1024440041 1672 dbSNP
rs1057515740 1672 dbSNP
rs1014439065 1673 dbSNP
rs1473573026 1686 dbSNP
rs1197178761 1702 dbSNP
rs1232779354 1702 dbSNP
rs373005118 1702 dbSNP
rs1480785684 1704 dbSNP
rs1178886772 1712 dbSNP
rs894689376 1715 dbSNP
rs1003736941 1730 dbSNP
rs1329883195 1743 dbSNP
rs1356635085 1758 dbSNP
rs1283170536 1776 dbSNP
rs759156736 1776 dbSNP
rs1344358027 1785 dbSNP
rs897397344 1789 dbSNP
rs1037293345 1793 dbSNP
rs940985042 1823 dbSNP
rs1213627201 1830 dbSNP
rs1273524163 1836 dbSNP
rs909567277 1856 dbSNP
rs551726898 1858 dbSNP
rs1056068322 1861 dbSNP
rs1268043547 1872 dbSNP
rs1000877206 1887 dbSNP
rs903504008 1894 dbSNP
rs1049439288 1896 dbSNP
rs1352527356 1902 dbSNP
rs1328008256 1903 dbSNP
rs1475247047 1914 dbSNP
rs1168697856 1941 dbSNP
rs770516462 1950 dbSNP
rs1392461928 1952 dbSNP
rs1410148476 1964 dbSNP
rs1423087921 1965 dbSNP
rs1303105440 1978 dbSNP
rs763011446 1979 dbSNP
rs148513908 1984 dbSNP
rs5956215 1993 dbSNP
rs747959447 1995 dbSNP
rs200014321 2005 dbSNP
rs913654360 2022 dbSNP
rs193230112 2023 dbSNP
rs1050858234 2029 dbSNP
rs372028662 2035 dbSNP
rs746044334 2035 dbSNP
rs976549455 2036 dbSNP
rs1344078248 2048 dbSNP
rs933860298 2051 dbSNP
rs955931127 2053 dbSNP
rs1359981474 2064 dbSNP
rs924491995 2065 dbSNP
rs978706985 2066 dbSNP
rs1194207669 2076 dbSNP
rs749840453 2077 dbSNP
rs1250082730 2079 dbSNP
rs1443183037 2081 dbSNP
rs1163266130 2083 dbSNP
rs921122080 2083 dbSNP
rs975344543 2084 dbSNP
rs1459953139 2086 dbSNP
rs780826840 2088 dbSNP
rs909882055 2091 dbSNP
rs756779550 2099 dbSNP
rs1381121136 2105 dbSNP
rs1469115449 2109 dbSNP
rs779000030 2117 dbSNP
rs1366841495 2118 dbSNP
rs867197855 2144 dbSNP
rs868133941 2146 dbSNP
rs1314194515 2147 dbSNP
rs1383239220 2148 dbSNP
rs756504749 2148 dbSNP
rs778330920 2148 dbSNP
rs187660648 2149 dbSNP
rs753072593 2149 dbSNP
rs1022319055 2150 dbSNP
rs1271545550 2151 dbSNP
rs1213081216 2154 dbSNP
rs1467961011 2162 dbSNP
rs753399289 2162 dbSNP
rs765988404 2162 dbSNP
rs767123866 2162 dbSNP
rs769125462 2162 dbSNP
rs1321481694 2163 dbSNP
rs1184952088 2165 dbSNP
rs1413592421 2165 dbSNP
rs1175294544 2167 dbSNP
rs1479152538 2167 dbSNP
rs1359320915 2169 dbSNP
rs751146184 2169 dbSNP
rs184297875 2171 dbSNP
rs191802231 2175 dbSNP
rs1395492431 2176 dbSNP
rs1309745569 2177 dbSNP
rs1343759570 2177 dbSNP
rs1410412183 2177 dbSNP
rs1222924760 2179 dbSNP
rs1275193178 2183 dbSNP
rs765214315 2183 dbSNP
rs1314093389 2184 dbSNP
rs1225506311 2185 dbSNP
rs1021874745 2188 dbSNP
rs1009203820 2189 dbSNP
rs1251160843 2191 dbSNP
rs1207970317 2195 dbSNP
rs13441024 2195 dbSNP
rs1481151389 2195 dbSNP
rs1197985068 2197 dbSNP
rs1371142804 2197 dbSNP
rs1434605690 2203 dbSNP
rs776510193 2203 dbSNP
rs1442685376 2207 dbSNP
rs1372325072 2208 dbSNP
rs1378603963 2219 dbSNP
rs1170442571 2221 dbSNP
rs1363580134 2221 dbSNP
rs1404419576 2222 dbSNP
rs768404397 2231 dbSNP
rs1323485755 2233 dbSNP
rs1369806539 2233 dbSNP
rs1295088140 2237 dbSNP
rs200167553 2237 dbSNP
rs1343356574 2238 dbSNP
rs1394559240 2241 dbSNP
rs959426611 2244 dbSNP
rs1359439180 2248 dbSNP
rs1050785935 2260 dbSNP
rs12395643 2261 dbSNP
rs1407924237 2277 dbSNP
rs556281238 2286 dbSNP
rs1159473441 2309 dbSNP
rs1184435156 2322 dbSNP
rs1260542600 2329 dbSNP
rs1471365499 2330 dbSNP
rs1170179224 2334 dbSNP
rs899658481 2337 dbSNP
rs1383153364 2338 dbSNP
rs1251315541 2343 dbSNP
rs752409883 2344 dbSNP
rs111473686 2350 dbSNP
rs1469123645 2353 dbSNP
rs771058435 2354 dbSNP
rs941248591 2361 dbSNP
rs539545568 2370 dbSNP
rs1288525214 2372 dbSNP
rs982751526 2378 dbSNP
rs1437540358 2387 dbSNP
rs1313448425 2388 dbSNP
rs10127185 2395 dbSNP
rs756620818 2398 dbSNP
rs917277564 2402 dbSNP
rs1229432628 2407 dbSNP
rs1292592488 2408 dbSNP
rs1315002948 2409 dbSNP
rs1283515005 2411 dbSNP
rs1212970747 2413 dbSNP
rs1224065159 2421 dbSNP
rs992912231 2446 dbSNP
rs959075617 2449 dbSNP
rs1241098501 2453 dbSNP
rs1443751521 2455 dbSNP
rs1034519722 2456 dbSNP
rs1415814201 2457 dbSNP
rs10127182 2460 dbSNP
rs781643131 2475 dbSNP
rs776684734 2476 dbSNP
rs1334928153 2494 dbSNP
rs1405847665 2502 dbSNP
rs1049364819 2507 dbSNP
rs932356911 2508 dbSNP
rs755322977 2514 dbSNP
rs922345485 2517 dbSNP
rs56158197 2518 dbSNP
rs766113990 2521 dbSNP
rs758046468 2522 dbSNP
rs934452871 2523 dbSNP
rs150119198 2524 dbSNP
rs187346492 2537 dbSNP
rs1057515739 2538 dbSNP
rs979060016 2551 dbSNP
rs772262558 2571 dbSNP
rs77126790 2575 dbSNP
rs202199842 2586 dbSNP
rs776369585 2596 dbSNP
rs968652018 2603 dbSNP
rs763889562 2606 dbSNP
rs915855009 2610 dbSNP
rs182654000 2625 dbSNP
rs200780311 2627 dbSNP
rs1397139677 2632 dbSNP
rs888341351 2634 dbSNP
rs1184811293 2644 dbSNP
rs201640841 2652 dbSNP
rs929905079 2661 dbSNP
rs1326365726 2666 dbSNP
rs750418202 2671 dbSNP
rs767422843 2674 dbSNP
rs990817509 2676 dbSNP
rs763082089 2677 dbSNP
rs775547188 2678 dbSNP
rs1425986613 2680 dbSNP
rs1168595457 2683 dbSNP
rs1350606806 2711 dbSNP
rs765285068 2720 dbSNP
rs1229647863 2721 dbSNP
rs769795421 2722 dbSNP
rs1280989303 2732 dbSNP
rs759814013 2734 dbSNP
rs1057515738 2736 dbSNP
rs776665496 2745 dbSNP
rs3827478 2746 dbSNP
rs1212813867 2752 dbSNP
rs1466883574 2753 dbSNP
rs1274595954 2755 dbSNP
rs1195888609 2766 dbSNP
rs747304113 2771 dbSNP
rs397516587 2773 dbSNP
rs372396556 2780 dbSNP
rs760540948 2782 dbSNP
rs1035062584 2791 dbSNP
rs368937075 2794 dbSNP
rs749374058 2795 dbSNP
rs1252385133 2797 dbSNP
rs1484083055 2804 dbSNP
rs778580428 2807 dbSNP
rs754397650 2815 dbSNP
rs375994314 2816 dbSNP
rs1174359442 2817 dbSNP
rs1455569835 2820 dbSNP
rs143420310 2857 dbSNP
rs755988734 2860 dbSNP
rs1452279534 2864 dbSNP
rs769717509 2867 dbSNP
rs773163247 2867 dbSNP
rs1174515796 2871 dbSNP
rs761717112 2871 dbSNP
rs767240416 2871 dbSNP
rs373841690 2873 dbSNP
rs761747329 2875 dbSNP
rs376318727 2884 dbSNP
rs773987053 2884 dbSNP
rs759490403 2885 dbSNP
rs978931351 2887 dbSNP
rs780055219 2891 dbSNP
rs913433547 2896 dbSNP
rs749628026 2902 dbSNP
rs954998938 2905 dbSNP
rs1360650138 2908 dbSNP
rs190781020 2909 dbSNP
rs996431786 2910 dbSNP
rs1436800741 2914 dbSNP
rs1029292416 2915 dbSNP
rs780640930 2919 dbSNP
rs1374220732 2933 dbSNP
rs756720313 2937 dbSNP
rs1227318319 2942 dbSNP
rs1275264834 2955 dbSNP
rs963800915 2956 dbSNP
rs1344320251 2961 dbSNP
rs1220147800 2965 dbSNP
rs1266827259 2980 dbSNP
rs1018459771 2991 dbSNP
rs1452223693 3009 dbSNP
rs1240527784 3014 dbSNP
rs1449256764 3021 dbSNP
rs1189539814 3024 dbSNP
rs1040749550 3032 dbSNP
rs113549733 3032 dbSNP
rs755451497 3032 dbSNP
rs747372256 3036 dbSNP
rs934442233 3038 dbSNP
rs188577917 3043 dbSNP
rs1325129139 3045 dbSNP
rs878924268 3068 dbSNP
rs758148695 3074 dbSNP
rs1361043476 3090 dbSNP
rs888267430 3099 dbSNP
rs1046964683 3113 dbSNP
rs1298143968 3116 dbSNP
rs1367071084 3135 dbSNP
rs994081471 3136 dbSNP
rs1420310001 3144 dbSNP
rs1264756474 3158 dbSNP
rs902963068 3161 dbSNP
rs895736350 3162 dbSNP
rs1211656700 3169 dbSNP
rs1057096447 3178 dbSNP
rs1464669896 3197 dbSNP
rs1478734344 3203 dbSNP
rs1209571000 3212 dbSNP
rs750004511 3240 dbSNP
rs5957380 3248 dbSNP
rs41300908 3249 dbSNP
rs1042879151 3258 dbSNP
rs1472841082 3262 dbSNP
rs1164559557 3263 dbSNP
rs1385794924 3268 dbSNP
rs1043524915 3276 dbSNP
rs915823771 3277 dbSNP
rs183969784 3281 dbSNP
rs1257606942 3284 dbSNP
rs1390605341 3288 dbSNP
rs1202004582 3306 dbSNP
rs1311943735 3315 dbSNP
rs991413172 3329 dbSNP
rs947510985 3345 dbSNP
rs937970518 3348 dbSNP
rs764018077 3355 dbSNP
rs913402046 3373 dbSNP
rs1354066765 3377 dbSNP
rs192151171 3385 dbSNP
rs1415718480 3389 dbSNP
rs1270193585 3399 dbSNP
rs954925800 3400 dbSNP
rs1200168069 3403 dbSNP
rs923532725 3411 dbSNP
rs1444689286 3412 dbSNP
rs1180263874 3413 dbSNP
rs1409185570 3447 dbSNP
rs752469856 3452 dbSNP
rs961465393 3454 dbSNP
rs1413642174 3456 dbSNP
rs185990694 3459 dbSNP
rs1172857287 3462 dbSNP
rs1302115428 3462 dbSNP
rs1017967240 3469 dbSNP
rs199705754 3471 dbSNP
rs773236667 3488 dbSNP
rs180681121 3494 dbSNP
rs984295896 3505 dbSNP
rs1025442054 3507 dbSNP
rs1321750519 3508 dbSNP
rs1232785704 3512 dbSNP
rs1257008678 3534 dbSNP
rs994007432 3547 dbSNP
rs1251669182 3548 dbSNP
rs761785059 3548 dbSNP
rs1182187864 3553 dbSNP
rs895703713 3554 dbSNP
rs1431152994 3555 dbSNP
rs1257978983 3571 dbSNP
rs1175310889 3572 dbSNP
rs1480076407 3578 dbSNP
rs1057414175 3580 dbSNP
rs144504054 3583 dbSNP
rs905852522 3584 dbSNP
rs1467342475 3586 dbSNP
rs866262882 3589 dbSNP
rs1272052808 3590 dbSNP
rs997076114 3592 dbSNP
rs1410353566 3595 dbSNP
rs1309995359 3607 dbSNP
rs947436311 3608 dbSNP
rs189695743 3628 dbSNP
rs1053188410 3638 dbSNP
rs752459076 3648 dbSNP
rs1057515737 3677 dbSNP
rs1302201183 3682 dbSNP
rs185627568 3687 dbSNP
rs1057515736 3689 dbSNP
rs975386272 3689 dbSNP
rs1305246794 3694 dbSNP
rs943667258 3702 dbSNP
rs910876111 3704 dbSNP
rs998951184 3706 dbSNP
rs1276218532 3718 dbSNP
rs1374243903 3739 dbSNP
rs1333634473 3743 dbSNP
rs1439060551 3748 dbSNP
rs983789027 3750 dbSNP
rs1165805820 3789 dbSNP
rs1186510347 3790 dbSNP
rs1389302905 3796 dbSNP
rs1430383032 3813 dbSNP
rs1170384342 3825 dbSNP
rs1348241748 3828 dbSNP
rs1043232540 3829 dbSNP
rs1294359976 3866 dbSNP
rs1458330599 3873 dbSNP
rs952405441 3877 dbSNP
rs181132832 3894 dbSNP
rs1055691874 3896 dbSNP
rs1025409360 3910 dbSNP
rs1238343886 3911 dbSNP
rs1319417124 3918 dbSNP
rs1180108373 3919 dbSNP
rs1466911169 3929 dbSNP
rs972536036 3934 dbSNP
rs754740000 3940 dbSNP
rs1265505735 3941 dbSNP
rs960132878 3943 dbSNP
rs1489289233 3949 dbSNP
rs1206410992 3952 dbSNP
rs1035565163 3958 dbSNP
rs1209964388 3968 dbSNP
rs1449808254 3977 dbSNP
rs1190462536 4000 dbSNP
rs1001857275 4004 dbSNP
rs905784906 4006 dbSNP
rs1489731000 4008 dbSNP
rs1430103377 4019 dbSNP
rs1021547844 4049 dbSNP
rs908587886 4055 dbSNP
rs984613119 4069 dbSNP
rs1389868140 4082 dbSNP
rs772259249 4098 dbSNP
rs952860374 4100 dbSNP
rs1011547358 4124 dbSNP
rs1238710994 4132 dbSNP
rs891857427 4147 dbSNP
rs1229376154 4155 dbSNP
rs1317885695 4155 dbSNP
rs1312866594 4188 dbSNP
rs1336253984 4196 dbSNP
rs1053114556 4208 dbSNP
rs921447258 4212 dbSNP
rs1312008788 4224 dbSNP
rs933435483 4227 dbSNP
rs1217601223 4232 dbSNP
rs975584009 4236 dbSNP
rs745547671 4245 dbSNP
rs1232334651 4257 dbSNP
rs1370600476 4265 dbSNP
rs1326599244 4266 dbSNP
rs13460 4275 dbSNP
rs1388621940 4277 dbSNP
rs1471622484 4285 dbSNP
rs902000009 4289 dbSNP
rs778421977 4297 dbSNP
rs1158721773 4304 dbSNP
rs1392706920 4332 dbSNP
rs1459016292 4339 dbSNP
rs1332669697 4353 dbSNP
rs1358921964 4361 dbSNP
rs1039243091 4369 dbSNP
rs943576324 4373 dbSNP
rs1356842381 4382 dbSNP
rs1380677424 4386 dbSNP
rs1287334122 4399 dbSNP
rs1020326522 4424 dbSNP
rs998524759 4425 dbSNP
rs1276303973 4430 dbSNP
rs967458267 4431 dbSNP
rs1210768372 4434 dbSNP
rs909472598 4440 dbSNP
rs1259454725 4441 dbSNP
rs1452161976 4443 dbSNP
rs756862897 4452 dbSNP
rs1181634505 4457 dbSNP
rs1198872796 4463 dbSNP
rs1473721107 4468 dbSNP
rs1452848617 4485 dbSNP
rs1259129532 4519 dbSNP
rs1205058030 4534 dbSNP
rs142200759 4562 dbSNP
rs1288578426 4568 dbSNP
rs42885 4579 dbSNP
rs1429673988 4582 dbSNP
rs190092370 4583 dbSNP
rs540341520 4587 dbSNP
rs1306936755 4588 dbSNP
rs766259260 4619 dbSNP
rs959857358 4622 dbSNP
rs760657814 4623 dbSNP
rs752588468 4627 dbSNP
rs979968621 4629 dbSNP
rs1347371364 4631 dbSNP
rs970352116 4635 dbSNP
rs1366661875 4651 dbSNP
rs1219521665 4661 dbSNP
rs894257602 4664 dbSNP
rs1045953 4671 dbSNP
rs1204317993 4715 dbSNP
rs1275488466 4720 dbSNP
rs1055617941 4721 dbSNP
rs1197050071 4728 dbSNP
rs1246289335 4729 dbSNP
rs1478565221 4733 dbSNP
rs1324746602 4740 dbSNP
rs1195972189 4745 dbSNP
rs1388696376 4755 dbSNP
rs767652057 4757 dbSNP
rs891784102 4761 dbSNP
rs761928368 4763 dbSNP
rs1036694237 4771 dbSNP
rs1299757069 4774 dbSNP
rs1432634846 4797 dbSNP
rs759191240 4798 dbSNP
rs1374410218 4808 dbSNP
rs998005364 4814 dbSNP
rs901927831 4815 dbSNP
rs774576256 4823 dbSNP
rs1436732100 4851 dbSNP
rs1057515735 4858 dbSNP
rs943561186 4858 dbSNP
rs908554155 4859 dbSNP
rs1478845068 4862 dbSNP
rs1227610188 4864 dbSNP
rs888003967 4880 dbSNP
rs768765720 4890 dbSNP
rs776018861 4893 dbSNP
rs1208072789 4934 dbSNP
rs750715219 4939 dbSNP
rs1452471304 4953 dbSNP
rs765371462 4961 dbSNP
rs1036703651 4962 dbSNP
rs1449203872 4963 dbSNP
rs754879365 4964 dbSNP
rs975551192 4968 dbSNP
rs1472092614 4975 dbSNP
rs185156571 5006 dbSNP
rs11548982 5007 dbSNP
rs746415532 5013 dbSNP
rs1412417057 5015 dbSNP
rs980320947 5018 dbSNP
rs1327449734 5019 dbSNP
rs2748 5038 dbSNP
rs1202390187 5047 dbSNP
rs113285013 5048 dbSNP
rs1321149560 5049 dbSNP
rs1250809219 5050 dbSNP
rs990017688 5054 dbSNP
rs1340978348 5055 dbSNP
rs965552504 5056 dbSNP
rs1283726456 5065 dbSNP
rs955994867 5073 dbSNP
rs747621180 5079 dbSNP
rs1235404961 5090 dbSNP
rs912781664 5105 dbSNP
rs1464741159 5106 dbSNP
rs1209821820 5118 dbSNP
rs1354579914 5132 dbSNP
rs761270364 5134 dbSNP
rs978080600 5138 dbSNP
rs1187420547 5142 dbSNP
rs1334619906 5149 dbSNP
rs1475219042 5153 dbSNP
rs1415802245 5157 dbSNP
rs1409232559 5162 dbSNP
rs778592348 5172 dbSNP
rs1158994092 5173 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||| :|||   ||||||| 
Target 5' auCAAA-UAUUUCUUGCUGCUu 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine, ML_MM_6 ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000371335.4 | 3UTR | AUCAAAUAUUUCUUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000371335.4 | 3UTR | UUAACACAUCAAAUAUUUCUUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000371335.4 | 3UTR | UUAACACAUCAAAUAUUUCUUGCUGCUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000371335.4 | 3UTR | UUAACACAUCAAAUAUUUCUUGCUGCUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000371335.4 | 3UTR | UUAACACAUCAAAUAUUUCUUGCUGCUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer 0.359 4.3e-4 0.288 4.1e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.68 4.9e-4 0.759 5.2e-5 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.583 1.8e-3 0.577 2.0e-3 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.47 8.9e-3 0.502 5.3e-3 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.421 1.8e-2 0.385 2.9e-2 25 Click to see details
GSE21849 B cell lymphoma -0.296 5.9e-2 -0.083 3.3e-1 29 Click to see details
GSE19783 ER- ER- breast cancer -0.175 6.1e-2 -0.220 2.6e-2 79 Click to see details
GSE14794 Lymphoblastoid cells -0.151 7.8e-2 -0.088 2.0e-1 90 Click to see details
GSE28544 Breast cancer -0.217 1.5e-1 -0.650 2.9e-4 24 Click to see details
GSE27834 Pluripotent stem cells -0.225 2.0e-1 0.015 4.8e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.136 2.3e-1 -0.130 2.4e-1 32 Click to see details
GSE19536 Breast cancer -0.067 2.5e-1 -0.128 1.0e-1 100 Click to see details
GSE19350 CNS germ cell tumors -0.192 2.7e-1 0.294 1.8e-1 12 Click to see details
GSE17306 Multiple myeloma -0.081 2.9e-1 -0.064 3.3e-1 49 Click to see details
GSE21687 Ependynoma primary tumors -0.05 3.5e-1 -0.040 3.8e-1 64 Click to see details
GSE38226 Liver fibrosis 0.086 3.6e-1 0.025 4.6e-1 21 Click to see details
GSE17498 Multiple myeloma -0.046 3.9e-1 0.009 4.8e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.046 4.2e-1 -0.038 4.4e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.056 4.3e-1 -0.242 2.1e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.021 4.6e-1 0.015 4.7e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.021 4.6e-1 0.015 4.7e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.433 0.01 0.438 0.01 32 Click to see details
PAAD -0.959 0.02 -0.800 0.1 4 Click to see details
THCA -0.252 0.03 -0.292 0.01 59 Click to see details
KIRC 0.222 0.03 0.196 0.05 68 Click to see details
LIHC -0.17 0.12 -0.117 0.21 49 Click to see details
PRAD 0.15 0.15 0.148 0.15 50 Click to see details
COAD -0.415 0.15 -0.619 0.05 8 Click to see details
CHOL -0.37 0.16 -0.367 0.17 9 Click to see details
ESCA -0.307 0.18 -0.364 0.14 11 Click to see details
CESC 0.828 0.19 0.500 0.33 3 Click to see details
BLCA 0.192 0.22 0.271 0.14 18 Click to see details
UCEC 0.184 0.23 0.081 0.37 19 Click to see details
HNSC -0.112 0.24 -0.155 0.16 42 Click to see details
BRCA 0.047 0.34 0.090 0.21 84 Click to see details
LUAD 0.107 0.37 0.266 0.2 12 Click to see details
KICH 0.043 0.42 0.122 0.28 25 Click to see details
LUSC 0.022 0.45 0.005 0.49 38 Click to see details
PCPG -0.115 0.46 0.500 0.33 3 Click to see details
KIRP 0.011 0.48 -0.012 0.47 32 Click to see details
KIRP 0.011 0.48 -0.012 0.47 32 Click to see details
KIRP 0.011 0.48 -0.012 0.47 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*