miRTarBase - #MIRT533115 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol YIPF4   
Synonyms FinGER4, Nbla11189
Description Yip1 domain family member 4
Transcript NM_032312   
Expression
Putative miRNA Targets on YIPF4
3'UTR of YIPF4
(miRNA target sites are highlighted)
>YIPF4|NM_032312|3'UTR
   1 TCCAAGTTATACATGAATAGAAAAAGATGGTGTTAAATTTGTGTGTAGGCTGGGAATTCTTGCTGAAGGAATTGGAGAAA
  81 ACCTGTTGCTGCAAAATTTTACATGTTCCAGATGGAAAGGGAAGTCTAAGCGCTTTTTAAAACAATTTTTTTTTGTATTT
 161 AATTAAGCAATTGCAGTTATCTGGGATTTTTGGGTCAGAATTTTAAATTCTGTTTGATTCTCCATATTCCAGTGAATAAA
 241 ATACAAAAGCATTGTGTTTTTAAGATTGTGTCGATATTCACCTAAAAACTTGTGCCAAAAGCACCTGGATTGGTAATTAT
 321 ATTTCACTTAAAGGGTAAATTTGACAATATCTTGATAATCAAAAGTGCAATTTTTTTCTTCAAAATGTTTTCTCCAGCAT
 401 CACAGATCCTGCAGATATATATTTATATTTATACATATATATTTATGAAATAATTCTTACTCACAAAATATATTTCTGAT
 481 AAACATTAAGATATTAAATCTGATGCACAAACTTTTTAATTTGGCCATTAATCTTTTTTATTTAAAAATTTAAATTTGTT
 561 TTTAAAATTGTATATAGTTTTTAAAATCTCACACATGCTTCGATACTTCCTTGTTAAGAATTCTTAATAACTACTAAAAC
 641 TGATTTTTAATAGTTGCTGATATATATTTGGTTTGTTTGGGTATACTTTTCAAAACCATTTTTGAATGTCCAAACATCTG
 721 ATTTAAAGTTTCTGTTTATCTTTCTGACCAAAGGAGCAAGAGGTATAATGGATATGGCATTCATTAAAATCTTTACTATG
 801 TACAAAAACAGTAATATTTACAGCATCAGTAAATATTTTTAAGTGGTACTTCTAAATCATAAAAGTTGGGGAAAGAGACC
 881 TTTAAAATCTTGTGGTGTTGAACAATGTTATATGAAGTAGAAAAAATAAAATACTTCCCAGTTGTGTGTTTTGTTTTACA
 961 GCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuguggUAACA-GUGUGAGGu 5'
                  ||| | ||:|:||| 
Target 5' tctgtttgATTCTCCATATTCCa 3'
209 - 231 122.00 -10.30
2
miRNA  3' guuuGUG-GUAACAG--UGUGAGGu 5'
              ||| |||  |:  |:|||:| 
Target 5' atctCACACATGCTTCGATACTTCc 3'
586 - 610 120.00 -11.50
3
miRNA  3' guUUGUGG---UAAC----AGUGUGAGGu 5'
            |:||||   ||||    |:|:|:|:| 
Target 5' aaAGCACCTGGATTGGTAATTATATTTCa 3'
298 - 326 118.00 -14.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7765478 1 COSMIC
COSN13991369 27 COSMIC
COSN14939242 50 COSMIC
COSN30532832 70 COSMIC
COSN31612122 97 COSMIC
COSN30512991 120 COSMIC
COSN30112206 127 COSMIC
COSN13991372 133 COSMIC
COSN4991486 171 COSMIC
COSN31557211 274 COSMIC
COSN1237782 320 COSMIC
COSN20096461 517 COSMIC
COSN31515618 581 COSMIC
COSN30176229 745 COSMIC
COSN30176257 792 COSMIC
COSN9998939 896 COSMIC
COSN1836098 1386 COSMIC
COSN30761745 1470 COSMIC
COSN30676648 1566 COSMIC
COSN29442679 2256 COSMIC
COSN6178661 2264 COSMIC
COSN17068920 2444 COSMIC
COSN28412501 2720 COSMIC
COSN28077298 2922 COSMIC
COSN27104861 2968 COSMIC
COSN1237783 3111 COSMIC
COSN1237784 3116 COSMIC
COSN4911281 3253 COSMIC
COSN30731310 3456 COSMIC
COSN32061721 4067 COSMIC
COSN9370667 4286 COSMIC
COSN19273529 4385 COSMIC
COSN30669379 4571 COSMIC
COSN32062750 4704 COSMIC
COSN1237785 4756 COSMIC
COSN30648682 4962 COSMIC
COSN29877184 5026 COSMIC
COSN30712455 5047 COSMIC
COSN21081501 5256 COSMIC
COSN25688272 5266 COSMIC
COSN30654037 5266 COSMIC
COSN20186921 5386 COSMIC
COSN30548156 5438 COSMIC
COSN30567342 5549 COSMIC
COSN30594895 5549 COSMIC
COSN1237786 6262 COSMIC
COSN30720124 6491 COSMIC
COSN30613709 6501 COSMIC
COSN30646715 6533 COSMIC
COSN25460407 6818 COSMIC
COSN5791499 6897 COSMIC
COSN5502118 7506 COSMIC
COSN19083948 7708 COSMIC
COSN21694543 8011 COSMIC
COSN22220796 8195 COSMIC
COSN6178662 8228 COSMIC
COSN29308470 8557 COSMIC
COSN26685118 8578 COSMIC
COSN23138786 8917 COSMIC
COSN7245090 9193 COSMIC
COSN6178663 9311 COSMIC
COSN7802531 9368 COSMIC
COSN15826008 9468 COSMIC
COSN27656261 9654 COSMIC
COSN5791500 9670 COSMIC
COSN15143466 9948 COSMIC
COSN395559 10179 COSMIC
COSN25728792 10413 COSMIC
COSN23949218 10421 COSMIC
COSN20787207 10490 COSMIC
COSN1836100 10630 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs929449382 2 dbSNP
rs773351468 4 dbSNP
rs369230593 10 dbSNP
rs898548784 11 dbSNP
rs748218058 13 dbSNP
rs754711829 14 dbSNP
rs767379372 15 dbSNP
rs1306403242 19 dbSNP
rs1334119473 21 dbSNP
rs1431830956 23 dbSNP
rs201626027 24 dbSNP
rs772171615 28 dbSNP
rs1280400444 31 dbSNP
rs755619019 38 dbSNP
rs1430807350 44 dbSNP
rs890704291 45 dbSNP
rs200438765 62 dbSNP
rs185129629 65 dbSNP
rs1483482469 66 dbSNP
rs551358578 73 dbSNP
rs773624842 74 dbSNP
rs931390382 75 dbSNP
rs1464178991 81 dbSNP
rs1263333340 83 dbSNP
rs1017244662 89 dbSNP
rs1201784209 98 dbSNP
rs1047484050 99 dbSNP
rs1254887888 100 dbSNP
rs887129831 104 dbSNP
rs35368935 105 dbSNP
rs1309113942 114 dbSNP
rs1295162486 120 dbSNP
rs1434042475 122 dbSNP
rs190166753 132 dbSNP
rs1339002613 133 dbSNP
rs905484342 138 dbSNP
rs1394497744 140 dbSNP
rs1002292060 141 dbSNP
rs956107055 142 dbSNP
rs1463991861 143 dbSNP
rs1024669907 146 dbSNP
rs1445658366 146 dbSNP
rs200654668 146 dbSNP
rs971285037 146 dbSNP
rs1425150231 147 dbSNP
rs539331562 156 dbSNP
rs979991953 158 dbSNP
rs879724502 159 dbSNP
rs1032474954 161 dbSNP
rs546455874 162 dbSNP
rs1344272431 163 dbSNP
rs1466913525 166 dbSNP
rs1291937548 168 dbSNP
rs957095039 171 dbSNP
rs527281717 172 dbSNP
rs989870407 178 dbSNP
rs937958859 185 dbSNP
rs1393169715 192 dbSNP
rs973897246 192 dbSNP
rs1308015320 194 dbSNP
rs566781668 199 dbSNP
rs1020481871 200 dbSNP
rs967053361 205 dbSNP
rs535251785 215 dbSNP
rs1298960912 218 dbSNP
rs555548501 219 dbSNP
rs1367493833 221 dbSNP
rs1442081159 225 dbSNP
rs912025615 227 dbSNP
rs912472961 238 dbSNP
rs942602005 244 dbSNP
rs1490474053 245 dbSNP
rs193230225 252 dbSNP
rs537988557 263 dbSNP
rs1312731769 267 dbSNP
rs931359129 273 dbSNP
rs1048716 280 dbSNP
rs185678233 290 dbSNP
rs1254041174 292 dbSNP
rs1348770594 294 dbSNP
rs1287800556 299 dbSNP
rs577674716 306 dbSNP
rs1375287145 310 dbSNP
rs1322007391 316 dbSNP
rs949404308 319 dbSNP
rs1046836677 325 dbSNP
rs905412231 326 dbSNP
rs759536666 328 dbSNP
rs1054647936 329 dbSNP
rs891532438 337 dbSNP
rs1002428006 338 dbSNP
rs765042135 339 dbSNP
rs1480736516 340 dbSNP
rs1248348761 344 dbSNP
rs1219241742 345 dbSNP
rs1024159113 346 dbSNP
rs1032442539 355 dbSNP
rs893962887 358 dbSNP
rs1010172546 363 dbSNP
rs189375990 371 dbSNP
rs201901585 371 dbSNP
rs973418959 372 dbSNP
rs1487052529 373 dbSNP
rs1436377676 383 dbSNP
rs560575682 384 dbSNP
rs1320617811 387 dbSNP
rs1458501637 388 dbSNP
rs1385929054 393 dbSNP
rs1192266880 396 dbSNP
rs1157814512 400 dbSNP
rs574284164 407 dbSNP
rs920703975 415 dbSNP
rs967566444 416 dbSNP
rs1189461536 419 dbSNP
rs1477653993 422 dbSNP
rs1434277490 427 dbSNP
rs1242488063 432 dbSNP
rs1190200826 435 dbSNP
rs1463728845 438 dbSNP
rs983914337 439 dbSNP
rs1204526047 443 dbSNP
rs1178799441 447 dbSNP
rs1276589358 455 dbSNP
rs1376288120 459 dbSNP
rs1340606351 463 dbSNP
rs1242896503 464 dbSNP
rs1465851911 468 dbSNP
rs912071756 471 dbSNP
rs986449946 472 dbSNP
rs1019294247 478 dbSNP
rs963934931 480 dbSNP
rs1039301571 485 dbSNP
rs922180269 486 dbSNP
rs1413848366 490 dbSNP
rs1420078142 492 dbSNP
rs1447488345 495 dbSNP
rs180737618 495 dbSNP
rs1389307496 496 dbSNP
rs1054108708 497 dbSNP
rs1484322929 502 dbSNP
rs1235821049 506 dbSNP
rs1362658095 509 dbSNP
rs35832404 513 dbSNP
rs397689196 513 dbSNP
rs869158417 513 dbSNP
rs1277447868 529 dbSNP
rs1297681799 531 dbSNP
rs1226807625 534 dbSNP
rs1316164061 537 dbSNP
rs1228539607 541 dbSNP
rs919872588 573 dbSNP
rs139612096 575 dbSNP
rs931129193 589 dbSNP
rs983053526 594 dbSNP
rs1299094619 597 dbSNP
rs1045858720 602 dbSNP
rs907035604 603 dbSNP
rs908589409 605 dbSNP
rs542421477 621 dbSNP
rs1034300346 630 dbSNP
rs962605310 635 dbSNP
rs762430984 637 dbSNP
rs763659686 646 dbSNP
rs751221953 651 dbSNP
rs1489138055 659 dbSNP
rs1193493280 660 dbSNP
rs1482976664 661 dbSNP
rs938042076 664 dbSNP
rs1292976759 665 dbSNP
rs1265869140 666 dbSNP
rs1053945046 669 dbSNP
rs1027670246 670 dbSNP
rs1323174093 672 dbSNP
rs1179690626 679 dbSNP
rs771349685 681 dbSNP
rs531670977 693 dbSNP
rs1418112665 711 dbSNP
rs185090047 713 dbSNP
rs1289612626 716 dbSNP
rs911974452 717 dbSNP
rs1369821051 719 dbSNP
rs1459287650 722 dbSNP
rs1158202262 730 dbSNP
rs966216443 731 dbSNP
rs1164417001 732 dbSNP
rs1350604232 736 dbSNP
rs1457960925 739 dbSNP
rs1414283013 746 dbSNP
rs1180031574 749 dbSNP
rs1472561957 750 dbSNP
rs1270175451 755 dbSNP
rs1266834561 756 dbSNP
rs774902708 757 dbSNP
rs565055217 761 dbSNP
rs1042959353 764 dbSNP
rs1265225276 767 dbSNP
rs188383126 769 dbSNP
rs1008414016 770 dbSNP
rs547393198 772 dbSNP
rs1366786143 783 dbSNP
rs1329354262 786 dbSNP
rs1269504569 787 dbSNP
rs936284751 790 dbSNP
rs1019263363 795 dbSNP
rs963697253 800 dbSNP
rs1388434350 803 dbSNP
rs1365307344 807 dbSNP
rs1292662009 809 dbSNP
rs566610632 812 dbSNP
rs1457976693 814 dbSNP
rs1391044846 815 dbSNP
rs1374310468 820 dbSNP
rs373023973 829 dbSNP
rs1026893665 832 dbSNP
rs952743956 834 dbSNP
rs1238983678 840 dbSNP
rs982595282 849 dbSNP
rs1312982589 850 dbSNP
rs1178956938 854 dbSNP
rs945664390 857 dbSNP
rs1267127900 859 dbSNP
rs1218702079 862 dbSNP
rs908388485 866 dbSNP
rs906942235 871 dbSNP
rs1249552469 880 dbSNP
rs1206415769 881 dbSNP
rs1468443906 882 dbSNP
rs1327938965 892 dbSNP
rs1199754729 894 dbSNP
rs937185099 896 dbSNP
rs970807451 899 dbSNP
rs1310305924 902 dbSNP
rs1176894381 904 dbSNP
rs529230950 912 dbSNP
rs772186793 913 dbSNP
rs1414769287 918 dbSNP
rs1318839455 921 dbSNP
rs898305077 922 dbSNP
rs1403010822 923 dbSNP
rs548904461 924 dbSNP
rs1465006743 928 dbSNP
rs995446559 928 dbSNP
rs1377525811 935 dbSNP
rs1025945203 945 dbSNP
rs1388694126 947 dbSNP
rs982590913 962 dbSNP
rs926732487 963 dbSNP
rs1162813702 967 dbSNP
rs938010723 972 dbSNP
rs1005284619 985 dbSNP
rs1255378167 986 dbSNP
rs6741519 987 dbSNP
rs867622476 996 dbSNP
rs752540005 1005 dbSNP
rs1466091922 1006 dbSNP
rs538051210 1010 dbSNP
rs755339937 1018 dbSNP
rs779340329 1019 dbSNP
rs966083627 1021 dbSNP
rs549855780 1023 dbSNP
rs1397931935 1024 dbSNP
rs1394405111 1031 dbSNP
rs1401558482 1037 dbSNP
rs559891810 1038 dbSNP
rs1369098417 1040 dbSNP
rs890634094 1043 dbSNP
rs1474889834 1044 dbSNP
rs1368643615 1067 dbSNP
rs1009097226 1074 dbSNP
rs957736542 1085 dbSNP
rs571366724 1088 dbSNP
rs990419289 1088 dbSNP
rs539569183 1090 dbSNP
rs533728164 1096 dbSNP
rs553769942 1112 dbSNP
rs1219852089 1113 dbSNP
rs981089062 1115 dbSNP
rs1242870560 1117 dbSNP
rs1340019967 1118 dbSNP
rs1288998393 1128 dbSNP
rs1260534561 1138 dbSNP
rs996478247 1143 dbSNP
rs1456751157 1146 dbSNP
rs574247890 1148 dbSNP
rs1204223985 1166 dbSNP
rs1238374644 1168 dbSNP
rs1164692756 1179 dbSNP
rs181322536 1191 dbSNP
rs748672934 1192 dbSNP
rs567938895 1194 dbSNP
rs1182211811 1209 dbSNP
rs1473550828 1214 dbSNP
rs1249579985 1219 dbSNP
rs1015539496 1221 dbSNP
rs970948602 1237 dbSNP
rs981950039 1239 dbSNP
rs926702755 1246 dbSNP
rs1291760943 1249 dbSNP
rs556465603 1254 dbSNP
rs1334364186 1255 dbSNP
rs1268871158 1257 dbSNP
rs898332348 1273 dbSNP
rs1348670617 1274 dbSNP
rs772109577 1278 dbSNP
rs1279537644 1279 dbSNP
rs931139980 1285 dbSNP
rs1047008205 1294 dbSNP
rs989402045 1300 dbSNP
rs1321910529 1306 dbSNP
rs571319657 1309 dbSNP
rs1393228409 1311 dbSNP
rs1159404518 1312 dbSNP
rs1409259646 1324 dbSNP
rs915247433 1325 dbSNP
rs887012718 1331 dbSNP
rs1004864033 1333 dbSNP
rs1157995700 1335 dbSNP
rs1018921246 1337 dbSNP
rs1334594432 1348 dbSNP
rs1360623713 1350 dbSNP
rs1445360138 1351 dbSNP
rs760917291 1352 dbSNP
rs978737975 1353 dbSNP
rs1401278338 1355 dbSNP
rs1280690283 1357 dbSNP
rs576195558 1358 dbSNP
rs1283643165 1360 dbSNP
rs866621398 1368 dbSNP
rs944869461 1370 dbSNP
rs1039225385 1378 dbSNP
rs532328211 1378 dbSNP
rs899542586 1384 dbSNP
rs957598124 1393 dbSNP
rs990715196 1399 dbSNP
rs932406506 1406 dbSNP
rs1320886310 1407 dbSNP
rs1436829349 1411 dbSNP
rs1385814561 1414 dbSNP
rs1314244637 1415 dbSNP
rs545220179 1417 dbSNP
rs76202333 1422 dbSNP
rs373521597 1423 dbSNP
rs888096869 1427 dbSNP
rs566208741 1428 dbSNP
rs113382677 1429 dbSNP
rs1015923773 1431 dbSNP
rs1294534193 1435 dbSNP
rs1463657632 1442 dbSNP
rs1490656787 1451 dbSNP
rs906484653 1457 dbSNP
rs1194677042 1463 dbSNP
rs1247783979 1465 dbSNP
rs1420422092 1471 dbSNP
rs1210860191 1475 dbSNP
rs527791512 1477 dbSNP
rs1384253590 1485 dbSNP
rs1442506938 1488 dbSNP
rs777319028 1489 dbSNP
rs1369465470 1498 dbSNP
rs1385726259 1499 dbSNP
rs1461410912 1504 dbSNP
rs761741807 1519 dbSNP
rs771225596 1523 dbSNP
rs919661894 1524 dbSNP
rs931192938 1527 dbSNP
rs765072880 1530 dbSNP
rs1408814263 1531 dbSNP
rs749009676 1542 dbSNP
rs1269108990 1545 dbSNP
rs1047319507 1549 dbSNP
rs1332239443 1552 dbSNP
rs908349731 1553 dbSNP
rs1244152939 1555 dbSNP
rs1317623690 1558 dbSNP
rs1360686323 1560 dbSNP
rs1311050413 1563 dbSNP
rs771182151 1564 dbSNP
rs541058707 1565 dbSNP
rs756968071 1566 dbSNP
rs1481302062 1573 dbSNP
rs1170183357 1580 dbSNP
rs1447912441 1603 dbSNP
rs901851757 1611 dbSNP
rs1182644269 1612 dbSNP
rs1473850888 1620 dbSNP
rs1360728524 1624 dbSNP
rs1401415354 1629 dbSNP
rs776595097 1635 dbSNP
rs989538654 1659 dbSNP
rs1277242377 1663 dbSNP
rs1022409588 1669 dbSNP
rs1430652501 1672 dbSNP
rs377561559 1673 dbSNP
rs1228517861 1675 dbSNP
rs978159840 1677 dbSNP
rs1370254424 1679 dbSNP
rs893197476 1680 dbSNP
rs912124865 1681 dbSNP
rs1217813532 1687 dbSNP
rs1279932388 1688 dbSNP
rs944940279 1690 dbSNP
rs974882655 1715 dbSNP
rs561383544 1719 dbSNP
rs922106146 1734 dbSNP
rs1020889344 1738 dbSNP
rs1415793378 1739 dbSNP
rs1354715942 1744 dbSNP
rs1218995793 1749 dbSNP
rs1283979576 1750 dbSNP
rs529157098 1754 dbSNP
rs549223234 1758 dbSNP
rs556759219 1767 dbSNP
rs149568516 1773 dbSNP
rs1254641433 1776 dbSNP
rs1248358781 1778 dbSNP
rs1476940698 1779 dbSNP
rs1192804371 1786 dbSNP
rs1048599381 1789 dbSNP
rs888242337 1790 dbSNP
rs1421153933 1791 dbSNP
rs1156391410 1802 dbSNP
rs769607322 1806 dbSNP
rs1383705379 1807 dbSNP
rs939673523 1814 dbSNP
rs1324838069 1820 dbSNP
rs958393932 1825 dbSNP
rs1329214186 1827 dbSNP
rs1352093388 1828 dbSNP
rs1036708064 1833 dbSNP
rs906403378 1834 dbSNP
rs1389601920 1835 dbSNP
rs991143129 1835 dbSNP
rs919713013 1836 dbSNP
rs1293844184 1848 dbSNP
rs1438907480 1853 dbSNP
rs1392507930 1861 dbSNP
rs1164437929 1862 dbSNP
rs952589470 1865 dbSNP
rs539075503 1866 dbSNP
rs982524894 1879 dbSNP
rs1157636129 1883 dbSNP
rs1003434571 1884 dbSNP
rs1193234879 1902 dbSNP
rs943832727 1903 dbSNP
rs116171455 1911 dbSNP
rs894971390 1912 dbSNP
rs932013133 1913 dbSNP
rs775360053 1916 dbSNP
rs1236812778 1926 dbSNP
rs1307331906 1931 dbSNP
rs1022801825 1936 dbSNP
rs1210472531 1941 dbSNP
rs186958895 1942 dbSNP
rs893111805 1950 dbSNP
rs966855955 1954 dbSNP
rs978456850 1961 dbSNP
rs1436076343 1963 dbSNP
rs762884398 1964 dbSNP
rs1287131210 1969 dbSNP
rs1453701612 1981 dbSNP
rs966253538 1983 dbSNP
rs974977437 1985 dbSNP
rs903392553 1996 dbSNP
rs1453029207 2005 dbSNP
rs1394855508 2014 dbSNP
rs1192624284 2026 dbSNP
rs922202408 2028 dbSNP
rs1263254314 2035 dbSNP
rs1202815044 2036 dbSNP
rs952187954 2040 dbSNP
rs1212132705 2041 dbSNP
rs1345545975 2045 dbSNP
rs985009627 2046 dbSNP
rs1302329410 2047 dbSNP
rs909589339 2053 dbSNP
rs1035974880 2059 dbSNP
rs1293559093 2060 dbSNP
rs762523276 2064 dbSNP
rs958928624 2070 dbSNP
rs763611405 2071 dbSNP
rs1176460634 2073 dbSNP
rs1013146768 2077 dbSNP
rs571354809 2080 dbSNP
rs1375236249 2090 dbSNP
rs1037081441 2105 dbSNP
rs1449736058 2111 dbSNP
rs1164528349 2113 dbSNP
rs927647511 2114 dbSNP
rs1137922 2115 dbSNP
rs1137923 2116 dbSNP
rs533919908 2118 dbSNP
rs939050518 2119 dbSNP
rs1189982252 2122 dbSNP
rs1484614620 2123 dbSNP
rs1279370957 2125 dbSNP
rs1205558743 2127 dbSNP
rs965215267 2128 dbSNP
rs865994314 2129 dbSNP
rs1460341840 2130 dbSNP
rs1226963021 2131 dbSNP
rs1341149395 2132 dbSNP
rs1137924 2140 dbSNP
rs1137925 2151 dbSNP
rs191707042 2158 dbSNP
rs866601748 2159 dbSNP
rs59285069 2161 dbSNP
rs1043577355 2162 dbSNP
rs761485468 2163 dbSNP
rs1461108737 2166 dbSNP
rs1286045505 2170 dbSNP
rs999627270 2174 dbSNP
rs1232676123 2175 dbSNP
rs1256767150 2187 dbSNP
rs1182782881 2188 dbSNP
rs1439413390 2190 dbSNP
rs535885693 2194 dbSNP
rs1458964212 2202 dbSNP
rs1357261401 2206 dbSNP
rs1275163936 2208 dbSNP
rs1231576701 2219 dbSNP
rs966015204 2220 dbSNP
rs556789195 2228 dbSNP
rs1249511594 2233 dbSNP
rs996218148 2236 dbSNP
rs1334353032 2244 dbSNP
rs576333142 2254 dbSNP
rs1189109452 2256 dbSNP
rs914560624 2258 dbSNP
rs1390952958 2266 dbSNP
rs1166604651 2272 dbSNP
rs1459458136 2274 dbSNP
rs1416507375 2280 dbSNP
rs1159819679 2282 dbSNP
rs1471087583 2283 dbSNP
rs1361874644 2284 dbSNP
rs556584701 2287 dbSNP
rs1451939652 2289 dbSNP
rs545158860 2295 dbSNP
rs947407624 2299 dbSNP
rs1225987246 2301 dbSNP
rs62134049 2301 dbSNP
rs1164891870 2302 dbSNP
rs1491329556 2302 dbSNP
rs869162903 2302 dbSNP
rs1157909967 2303 dbSNP
rs1191987698 2303 dbSNP
rs1248744105 2303 dbSNP
rs1320584959 2303 dbSNP
rs1382753395 2303 dbSNP
rs1393245641 2303 dbSNP
rs1396662066 2303 dbSNP
rs1402409635 2303 dbSNP
rs1453942621 2303 dbSNP
rs1462330807 2303 dbSNP
rs1491362024 2303 dbSNP
rs576364551 2303 dbSNP
rs70938335 2303 dbSNP
rs1217987229 2304 dbSNP
rs1284236038 2305 dbSNP
rs1201515872 2307 dbSNP
rs952281992 2314 dbSNP
rs558768707 2315 dbSNP
rs572207863 2316 dbSNP
rs868643224 2317 dbSNP
rs541545349 2318 dbSNP
rs1396834432 2319 dbSNP
rs1336399838 2320 dbSNP
rs1317640732 2321 dbSNP
rs961389497 2321 dbSNP
rs972497446 2322 dbSNP
rs868057626 2323 dbSNP
rs939019562 2324 dbSNP
rs1054755116 2325 dbSNP
rs1241590239 2326 dbSNP
rs916467113 2326 dbSNP
rs1057340784 2327 dbSNP
rs946672110 2327 dbSNP
rs1210669345 2328 dbSNP
rs868498943 2328 dbSNP
rs1319958687 2329 dbSNP
rs867680647 2330 dbSNP
rs561238891 2332 dbSNP
rs1250553721 2333 dbSNP
rs766019995 2342 dbSNP
rs1345446101 2345 dbSNP
rs1201880588 2354 dbSNP
rs1415343328 2357 dbSNP
rs1013594660 2361 dbSNP
rs1310959688 2362 dbSNP
rs1027198119 2365 dbSNP
rs1354883092 2369 dbSNP
rs1172891318 2374 dbSNP
rs530074253 2378 dbSNP
rs1418923035 2379 dbSNP
rs1163872470 2401 dbSNP
rs543453971 2404 dbSNP
rs1254932406 2405 dbSNP
rs1485079906 2406 dbSNP
rs757247691 2419 dbSNP
rs999787511 2420 dbSNP
rs1234896837 2421 dbSNP
rs1206203988 2422 dbSNP
rs562730382 2428 dbSNP
rs1305347225 2440 dbSNP
rs1264644290 2442 dbSNP
rs1233405836 2444 dbSNP
rs1479094752 2446 dbSNP
rs751211390 2447 dbSNP
rs1372936478 2454 dbSNP
rs1373791954 2457 dbSNP
rs1015323434 2459 dbSNP
rs1466867014 2465 dbSNP
rs901961557 2469 dbSNP
rs531675684 2470 dbSNP
rs1326804398 2471 dbSNP
rs976447768 2471 dbSNP
rs1028125432 2473 dbSNP
rs551597521 2486 dbSNP
rs1029000036 2488 dbSNP
rs1473174354 2489 dbSNP
rs953846375 2489 dbSNP
rs888005771 2492 dbSNP
rs1006487658 2499 dbSNP
rs374328872 2501 dbSNP
rs1298909339 2507 dbSNP
rs1015621867 2511 dbSNP
rs565103700 2517 dbSNP
rs947404706 2519 dbSNP
rs962218872 2519 dbSNP
rs977431762 2521 dbSNP
rs1380523685 2529 dbSNP
rs1294752140 2535 dbSNP
rs527380581 2536 dbSNP
rs1034726244 2541 dbSNP
rs547434930 2543 dbSNP
rs960453891 2544 dbSNP
rs938764161 2545 dbSNP
rs990409939 2547 dbSNP
rs916257951 2548 dbSNP
rs946401223 2553 dbSNP
rs979353469 2554 dbSNP
rs923892534 2555 dbSNP
rs1057206439 2556 dbSNP
rs935170299 2570 dbSNP
rs1454788593 2576 dbSNP
rs1185348331 2577 dbSNP
rs567272673 2588 dbSNP
rs948910400 2590 dbSNP
rs1049153803 2597 dbSNP
rs1193883072 2598 dbSNP
rs1455259665 2609 dbSNP
rs865784045 2612 dbSNP
rs888688445 2613 dbSNP
rs1485897115 2618 dbSNP
rs1262483991 2626 dbSNP
rs1213557106 2629 dbSNP
rs536198512 2630 dbSNP
rs901889454 2637 dbSNP
rs1280711214 2640 dbSNP
rs1236804706 2643 dbSNP
rs1004308726 2644 dbSNP
rs754602167 2650 dbSNP
rs1382893896 2651 dbSNP
rs13034684 2668 dbSNP
rs1015231589 2671 dbSNP
rs1287698256 2678 dbSNP
rs1453590648 2684 dbSNP
rs867786165 2685 dbSNP
rs887773206 2686 dbSNP
rs900817875 2695 dbSNP
rs1197711125 2703 dbSNP
rs1006659331 2705 dbSNP
rs1028027422 2706 dbSNP
rs1015174978 2710 dbSNP
rs1388392180 2713 dbSNP
rs937976570 2715 dbSNP
rs549376940 2717 dbSNP
rs1369884308 2719 dbSNP
rs1003011279 2720 dbSNP
rs1240511979 2725 dbSNP
rs1035825323 2726 dbSNP
rs960413482 2727 dbSNP
rs570006263 2730 dbSNP
rs778136724 2731 dbSNP
rs1413387213 2734 dbSNP
rs1265475305 2735 dbSNP
rs1171647705 2736 dbSNP
rs1489106848 2745 dbSNP
rs538995276 2751 dbSNP
rs558707394 2752 dbSNP
rs572341650 2754 dbSNP
rs1468307084 2759 dbSNP
rs1153122 2763 dbSNP
rs923846658 2764 dbSNP
rs1417514514 2766 dbSNP
rs1481712245 2767 dbSNP
rs757694224 2773 dbSNP
rs948926458 2774 dbSNP
rs1048534717 2783 dbSNP
rs1335534529 2789 dbSNP
rs935248287 2789 dbSNP
rs1459381912 2795 dbSNP
rs554998990 2801 dbSNP
rs910017278 2803 dbSNP
rs975890649 2811 dbSNP
rs371185985 2813 dbSNP
rs1398239104 2814 dbSNP
rs1393536506 2815 dbSNP
rs183995359 2822 dbSNP
rs1333003041 2824 dbSNP
rs1037210771 2826 dbSNP
rs530173969 2827 dbSNP
rs900849129 2837 dbSNP
rs1370772878 2841 dbSNP
rs1255936272 2843 dbSNP
rs373717458 2854 dbSNP
rs1050482689 2855 dbSNP
rs1312827325 2860 dbSNP
rs1212387968 2862 dbSNP
rs1356211109 2869 dbSNP
rs1205216227 2870 dbSNP
rs563717490 2871 dbSNP
rs1235736280 2872 dbSNP
rs1271798713 2876 dbSNP
rs1241692101 2877 dbSNP
rs1468350075 2878 dbSNP
rs1199695145 2879 dbSNP
rs576381594 2881 dbSNP
rs1304508511 2894 dbSNP
rs1445498892 2898 dbSNP
rs1394601401 2903 dbSNP
rs942035505 2920 dbSNP
rs1036780884 2940 dbSNP
rs1389976599 2944 dbSNP
rs1159062464 2946 dbSNP
rs1471076980 2947 dbSNP
rs1361779095 2952 dbSNP
rs1178269655 2957 dbSNP
rs1454834988 2961 dbSNP
rs889525399 2965 dbSNP
rs1191868538 2972 dbSNP
rs1451082880 2979 dbSNP
rs144768480 2984 dbSNP
rs1176762817 2987 dbSNP
rs1022144432 2990 dbSNP
rs1239007541 2991 dbSNP
rs1257029292 2992 dbSNP
rs1476222083 2993 dbSNP
rs1003100361 2998 dbSNP
rs1417042235 3001 dbSNP
rs565193598 3010 dbSNP
rs1318893703 3012 dbSNP
rs1402313324 3014 dbSNP
rs1034934136 3017 dbSNP
rs1172584544 3020 dbSNP
rs537978330 3026 dbSNP
rs527454019 3028 dbSNP
rs894627722 3029 dbSNP
rs960061229 3031 dbSNP
rs1303063493 3036 dbSNP
rs1380770963 3037 dbSNP
rs992812427 3040 dbSNP
rs1013075616 3043 dbSNP
rs1292091223 3044 dbSNP
rs1023374842 3045 dbSNP
rs1219717734 3048 dbSNP
rs1275554005 3049 dbSNP
rs1212097137 3053 dbSNP
rs1306118872 3058 dbSNP
rs1282100996 3059 dbSNP
rs916001950 3060 dbSNP
rs970185970 3061 dbSNP
rs1204158645 3063 dbSNP
rs879259092 3065 dbSNP
rs910057546 3077 dbSNP
rs1432842262 3078 dbSNP
rs940152775 3093 dbSNP
rs1297477517 3099 dbSNP
rs775189274 3099 dbSNP
rs1000496615 3102 dbSNP
rs1037281128 3104 dbSNP
rs1031102874 3106 dbSNP
rs1414067128 3107 dbSNP
rs1420348855 3111 dbSNP
rs1169685950 3112 dbSNP
rs1474450584 3131 dbSNP
rs1256842799 3138 dbSNP
rs1478115019 3140 dbSNP
rs112218372 3141 dbSNP
rs1417212924 3144 dbSNP
rs933681685 3145 dbSNP
rs561000078 3146 dbSNP
rs191128113 3147 dbSNP
rs372089151 3148 dbSNP
rs1215862078 3152 dbSNP
rs1049404777 3153 dbSNP
rs1311753863 3154 dbSNP
rs572540716 3156 dbSNP
rs975984148 3157 dbSNP
rs542638330 3159 dbSNP
rs746412468 3165 dbSNP
rs889422955 3170 dbSNP
rs549365352 3172 dbSNP
rs868112008 3173 dbSNP
rs1272415894 3175 dbSNP
rs1464188095 3182 dbSNP
rs1422925728 3184 dbSNP
rs1166300752 3185 dbSNP
rs1360377248 3189 dbSNP
rs1416183615 3190 dbSNP
rs899217832 3193 dbSNP
rs1181676919 3195 dbSNP
rs1470702480 3196 dbSNP
rs1010666735 3201 dbSNP
rs1043829315 3206 dbSNP
rs902385751 3206 dbSNP
rs999349614 3211 dbSNP
rs1214273724 3212 dbSNP
rs1336808398 3214 dbSNP
rs1310449342 3215 dbSNP
rs1034961977 3221 dbSNP
rs923208055 3223 dbSNP
rs182110488 3234 dbSNP
rs1281493528 3237 dbSNP
rs953190703 3240 dbSNP
rs1444762885 3247 dbSNP
rs1012145321 3252 dbSNP
rs1022978820 3255 dbSNP
rs1328376997 3263 dbSNP
rs1279711722 3267 dbSNP
rs879443244 3274 dbSNP
rs1488656528 3275 dbSNP
rs1178594151 3277 dbSNP
rs1217940064 3278 dbSNP
rs1240250679 3279 dbSNP
rs1475019579 3284 dbSNP
rs113928105 3287 dbSNP
rs1469403161 3288 dbSNP
rs1263673210 3298 dbSNP
rs1220737418 3305 dbSNP
rs1317309587 3313 dbSNP
rs909266488 3318 dbSNP
rs1452187460 3320 dbSNP
rs1376488717 3321 dbSNP
rs1304408177 3323 dbSNP
rs577715410 3327 dbSNP
rs552422961 3330 dbSNP
rs1360669833 3331 dbSNP
rs1293461160 3338 dbSNP
rs984223701 3343 dbSNP
rs780128502 3345 dbSNP
rs566244538 3355 dbSNP
rs1157191909 3360 dbSNP
rs1401914756 3362 dbSNP
rs1320901921 3372 dbSNP
rs1343984097 3378 dbSNP
rs1430586920 3381 dbSNP
rs1304644306 3387 dbSNP
rs929426456 3387 dbSNP
rs1373565530 3389 dbSNP
rs1232456500 3392 dbSNP
rs1302938898 3393 dbSNP
rs1434466775 3397 dbSNP
rs1354567179 3400 dbSNP
rs1225566735 3404 dbSNP
rs1048302936 3405 dbSNP
rs1236684141 3405 dbSNP
rs1243743982 3405 dbSNP
rs1281391563 3405 dbSNP
rs1310535209 3405 dbSNP
rs1352693504 3405 dbSNP
rs1460184695 3405 dbSNP
rs1300623883 3414 dbSNP
rs942114003 3421 dbSNP
rs548645785 3425 dbSNP
rs1443265404 3426 dbSNP
rs1036344593 3427 dbSNP
rs919235453 3435 dbSNP
rs535177864 3437 dbSNP
rs961554104 3448 dbSNP
rs1222129192 3450 dbSNP
rs1254731613 3455 dbSNP
rs35890004 3456 dbSNP
rs938715516 3456 dbSNP
rs1375459541 3462 dbSNP
rs972858080 3462 dbSNP
rs1428570825 3468 dbSNP
rs922750483 3475 dbSNP
rs1380499790 3485 dbSNP
rs1057309390 3486 dbSNP
rs1487839963 3504 dbSNP
rs894771704 3509 dbSNP
rs1013000254 3515 dbSNP
rs1043625353 3521 dbSNP
rs910894828 3524 dbSNP
rs1255599911 3525 dbSNP
rs1156327668 3526 dbSNP
rs1228311771 3527 dbSNP
rs186830212 3529 dbSNP
rs1276940830 3530 dbSNP
rs1218492125 3531 dbSNP
rs1356521811 3534 dbSNP
rs1001041420 3536 dbSNP
rs758882377 3537 dbSNP
rs1394619379 3538 dbSNP
rs1406535335 3541 dbSNP
rs956346101 3551 dbSNP
rs1462107927 3554 dbSNP
rs75551242 3556 dbSNP
rs1030249414 3559 dbSNP
rs1397223961 3560 dbSNP
rs191756212 3560 dbSNP
rs1189412372 3565 dbSNP
rs1439134054 3567 dbSNP
rs200919653 3568 dbSNP
rs1043518332 3572 dbSNP
rs1255810371 3587 dbSNP
rs768765633 3591 dbSNP
rs557375919 3595 dbSNP
rs1459146961 3596 dbSNP
rs953276401 3598 dbSNP
rs1256175394 3600 dbSNP
rs985946176 3603 dbSNP
rs909049968 3604 dbSNP
rs1336160806 3610 dbSNP
rs963469342 3610 dbSNP
rs1295624915 3612 dbSNP
rs747041354 3616 dbSNP
rs1340240638 3618 dbSNP
rs1311574368 3621 dbSNP
rs1391547114 3629 dbSNP
rs577275639 3640 dbSNP
rs546241670 3641 dbSNP
rs938683005 3642 dbSNP
rs1012178244 3644 dbSNP
rs1164919674 3648 dbSNP
rs565130716 3649 dbSNP
rs1456260479 3650 dbSNP
rs1367608526 3664 dbSNP
rs1332463436 3690 dbSNP
rs1182818489 3707 dbSNP
rs113668380 3713 dbSNP
rs535841518 3716 dbSNP
rs1468954664 3718 dbSNP
rs1057064317 3724 dbSNP
rs905901913 3729 dbSNP
rs916130300 3730 dbSNP
rs1261630145 3736 dbSNP
rs948986535 3740 dbSNP
rs1240467292 3747 dbSNP
rs1355463353 3748 dbSNP
rs1043207399 3749 dbSNP
rs1306606910 3762 dbSNP
rs1445480194 3767 dbSNP
rs78215657 3768 dbSNP
rs972763638 3769 dbSNP
rs934873543 3771 dbSNP
rs1389776744 3773 dbSNP
rs1158971173 3778 dbSNP
rs1231883657 3779 dbSNP
rs1472835249 3781 dbSNP
rs879748856 3787 dbSNP
rs1029795079 3790 dbSNP
rs955502808 3796 dbSNP
rs541211413 3802 dbSNP
rs560974518 3805 dbSNP
rs1248466740 3808 dbSNP
rs1197396771 3813 dbSNP
rs997143764 3814 dbSNP
rs1030008807 3842 dbSNP
rs979487657 3843 dbSNP
rs923575977 3844 dbSNP
rs1460290078 3845 dbSNP
rs1283527341 3848 dbSNP
rs1238891261 3850 dbSNP
rs1164671332 3852 dbSNP
rs1397571727 3860 dbSNP
rs1276061356 3862 dbSNP
rs1231018774 3868 dbSNP
rs1330498901 3872 dbSNP
rs1318872858 3874 dbSNP
rs1401683922 3882 dbSNP
rs1393424512 3892 dbSNP
rs554047659 3893 dbSNP
rs1335297493 3895 dbSNP
rs1467504637 3897 dbSNP
rs1170936708 3905 dbSNP
rs1477728287 3909 dbSNP
rs1056192930 3910 dbSNP
rs1374212772 3914 dbSNP
rs1415441550 3915 dbSNP
rs1196468552 3920 dbSNP
rs1007905624 3921 dbSNP
rs1016212672 3926 dbSNP
rs917758523 3941 dbSNP
rs963537959 3943 dbSNP
rs1295161949 3944 dbSNP
rs1442601145 3947 dbSNP
rs1280267413 3950 dbSNP
rs1353510330 3958 dbSNP
rs1232543565 3961 dbSNP
rs947876786 3966 dbSNP
rs529776177 3994 dbSNP
rs1026319528 3999 dbSNP
rs1193780020 4001 dbSNP
rs142911766 4004 dbSNP
rs563062994 4008 dbSNP
rs1442537871 4013 dbSNP
rs992760739 4014 dbSNP
rs1361172257 4016 dbSNP
rs1332425163 4017 dbSNP
rs1414049263 4034 dbSNP
rs531932394 4041 dbSNP
rs151121610 4043 dbSNP
rs948746614 4045 dbSNP
rs1477100543 4048 dbSNP
rs1474513128 4053 dbSNP
rs1423396459 4055 dbSNP
rs1189147018 4056 dbSNP
rs1200484165 4056 dbSNP
rs1207503449 4056 dbSNP
rs1228733221 4056 dbSNP
rs1257323467 4056 dbSNP
rs1258084235 4056 dbSNP
rs1282651435 4056 dbSNP
rs1316028568 4056 dbSNP
rs1333404122 4056 dbSNP
rs1381073049 4056 dbSNP
rs1441347576 4056 dbSNP
rs200229465 4056 dbSNP
rs557057155 4056 dbSNP
rs755932743 4056 dbSNP
rs766961746 4056 dbSNP
rs767432231 4056 dbSNP
rs979410686 4058 dbSNP
rs1187851731 4061 dbSNP
rs1374051457 4062 dbSNP
rs926258767 4063 dbSNP
rs1463831085 4065 dbSNP
rs1166412143 4067 dbSNP
rs1396078972 4068 dbSNP
rs1412001054 4069 dbSNP
rs1435521761 4070 dbSNP
rs934821780 4071 dbSNP
rs1053292098 4073 dbSNP
rs1373641744 4074 dbSNP
rs1238372848 4080 dbSNP
rs1222135126 4081 dbSNP
rs1414165227 4081 dbSNP
rs892184147 4081 dbSNP
rs1323302755 4082 dbSNP
rs1287408916 4083 dbSNP
rs566351150 4087 dbSNP
rs1296196305 4088 dbSNP
rs1311713873 4090 dbSNP
rs528829086 4097 dbSNP
rs1224931721 4099 dbSNP
rs183110377 4103 dbSNP
rs888764214 4104 dbSNP
rs994217570 4106 dbSNP
rs1212490087 4113 dbSNP
rs1164561980 4115 dbSNP
rs1007262780 4118 dbSNP
rs569976236 4124 dbSNP
rs1485051143 4125 dbSNP
rs1210856752 4127 dbSNP
rs1029701784 4128 dbSNP
rs1437286368 4128 dbSNP
rs1379097129 4131 dbSNP
rs899085995 4132 dbSNP
rs1489400623 4135 dbSNP
rs993704480 4138 dbSNP
rs1191517433 4140 dbSNP
rs1372810407 4145 dbSNP
rs572283132 4148 dbSNP
rs1018550391 4154 dbSNP
rs968723312 4155 dbSNP
rs1302017284 4158 dbSNP
rs979677060 4171 dbSNP
rs1366172387 4172 dbSNP
rs1175753905 4176 dbSNP
rs1401066040 4192 dbSNP
rs28432301 4194 dbSNP
rs188590505 4197 dbSNP
rs1299672500 4200 dbSNP
rs1417431994 4204 dbSNP
rs4952260 4205 dbSNP
rs141078383 4206 dbSNP
rs1387090860 4207 dbSNP
rs970455222 4212 dbSNP
rs1423048401 4213 dbSNP
rs1198515731 4217 dbSNP
rs1380397278 4220 dbSNP
rs978823409 4221 dbSNP
rs926157998 4224 dbSNP
rs749209390 4229 dbSNP
rs539804311 4236 dbSNP
rs1488107182 4248 dbSNP
rs1256783921 4249 dbSNP
rs866695664 4251 dbSNP
rs1045320577 4252 dbSNP
rs1301195353 4254 dbSNP
rs988947440 4259 dbSNP
rs1219726911 4267 dbSNP
rs1275910953 4274 dbSNP
rs1300776935 4282 dbSNP
rs1346574842 4288 dbSNP
rs922781509 4289 dbSNP
rs941951115 4290 dbSNP
rs934168364 4291 dbSNP
rs1383853780 4293 dbSNP
rs1239174857 4297 dbSNP
rs1261918988 4313 dbSNP
rs1487146056 4314 dbSNP
rs763009507 4318 dbSNP
rs1175643194 4321 dbSNP
rs1051504593 4322 dbSNP
rs1425640650 4323 dbSNP
rs1191291859 4324 dbSNP
rs910344577 4326 dbSNP
rs1203836497 4330 dbSNP
rs1036199674 4334 dbSNP
rs531364062 4338 dbSNP
rs543517193 4340 dbSNP
rs1482327350 4345 dbSNP
rs370023144 4347 dbSNP
rs1262537917 4353 dbSNP
rs1195789382 4354 dbSNP
rs899049677 4355 dbSNP
rs891184491 4360 dbSNP
rs372311486 4361 dbSNP
rs1313003470 4365 dbSNP
rs1365537616 4365 dbSNP
rs1018870823 4370 dbSNP
rs553134007 4373 dbSNP
rs1465666669 4374 dbSNP
rs895640216 4385 dbSNP
rs1031254044 4386 dbSNP
rs1168438323 4394 dbSNP
rs956393399 4397 dbSNP
rs1461300989 4401 dbSNP
rs772803995 4410 dbSNP
rs1023002439 4416 dbSNP
rs1368773806 4418 dbSNP
rs991811012 4422 dbSNP
rs1395003998 4436 dbSNP
rs917565546 4438 dbSNP
rs572303988 4444 dbSNP
rs1459135675 4457 dbSNP
rs969557407 4464 dbSNP
rs1236955956 4465 dbSNP
rs1195671914 4469 dbSNP
rs1323597337 4470 dbSNP
rs980513805 4472 dbSNP
rs909041975 4477 dbSNP
rs1369817168 4479 dbSNP
rs1310399369 4480 dbSNP
rs1391552008 4482 dbSNP
rs1446965757 4483 dbSNP
rs760306790 4485 dbSNP
rs1000569175 4487 dbSNP
rs971990565 4488 dbSNP
rs532386899 4490 dbSNP
rs1295110445 4497 dbSNP
rs1308526666 4513 dbSNP
rs1384914252 4514 dbSNP
rs1159473100 4518 dbSNP
rs540997250 4520 dbSNP
rs1378500123 4522 dbSNP
rs1181754167 4539 dbSNP
rs78717808 4540 dbSNP
rs192829148 4544 dbSNP
rs1268033868 4547 dbSNP
rs1208488462 4549 dbSNP
rs1490287083 4556 dbSNP
rs1290582142 4562 dbSNP
rs1240346667 4563 dbSNP
rs922875682 4571 dbSNP
rs1335974461 4573 dbSNP
rs930004933 4580 dbSNP
rs955525028 4588 dbSNP
rs985630910 4589 dbSNP
rs910261846 4596 dbSNP
rs1251474235 4600 dbSNP
rs1237666315 4606 dbSNP
rs753056255 4609 dbSNP
rs1384934253 4611 dbSNP
rs1488279644 4611 dbSNP
rs1364661030 4613 dbSNP
rs866076690 4614 dbSNP
rs891097256 4616 dbSNP
rs1177991315 4631 dbSNP
rs1358819539 4633 dbSNP
rs759001480 4637 dbSNP
rs1478389442 4646 dbSNP
rs764734596 4653 dbSNP
rs1252819485 4655 dbSNP
rs1197289965 4658 dbSNP
rs1212089258 4666 dbSNP
rs928992477 4668 dbSNP
rs1259714016 4679 dbSNP
rs543213799 4691 dbSNP
rs1216928557 4697 dbSNP
rs1158387596 4704 dbSNP
rs1047629764 4713 dbSNP
rs1039751242 4714 dbSNP
rs1162542220 4718 dbSNP
rs904057096 4721 dbSNP
rs1344667690 4722 dbSNP
rs1278648460 4723 dbSNP
rs1401589430 4727 dbSNP
rs1338786653 4740 dbSNP
rs1317902902 4741 dbSNP
rs185361677 4742 dbSNP
rs1001026084 4743 dbSNP
rs1404371278 4755 dbSNP
rs868141555 4761 dbSNP
rs1393373664 4765 dbSNP
rs1171360612 4769 dbSNP
rs1014002648 4770 dbSNP
rs1469704479 4771 dbSNP
rs1424929298 4772 dbSNP
rs1196358478 4774 dbSNP
rs1477040992 4776 dbSNP
rs1240071831 4778 dbSNP
rs1031286610 4780 dbSNP
rs1462238714 4789 dbSNP
rs1044215875 4790 dbSNP
rs189141918 4794 dbSNP
rs1013816322 4795 dbSNP
rs149668512 4796 dbSNP
rs1359524020 4799 dbSNP
rs1269841731 4802 dbSNP
rs757467666 4803 dbSNP
rs545389471 4804 dbSNP
rs781356445 4816 dbSNP
rs980970775 4819 dbSNP
rs1016009511 4823 dbSNP
rs559111808 4826 dbSNP
rs1401736078 4828 dbSNP
rs963574970 4834 dbSNP
rs1464400840 4839 dbSNP
rs1419186769 4841 dbSNP
rs1321478589 4843 dbSNP
rs1205545106 4850 dbSNP
rs971856248 4853 dbSNP
rs1238819934 4854 dbSNP
rs1033532165 4857 dbSNP
rs1181276290 4858 dbSNP
rs956050330 4860 dbSNP
rs1010283851 4864 dbSNP
rs1029883280 4868 dbSNP
rs1200396006 4870 dbSNP
rs385760 4874 dbSNP
rs1271971652 4878 dbSNP
rs566044092 4880 dbSNP
rs985599713 4880 dbSNP
rs1245429286 4888 dbSNP
rs1476150231 4890 dbSNP
rs1261283488 4894 dbSNP
rs1440587883 4895 dbSNP
rs1185708747 4899 dbSNP
rs912555364 4901 dbSNP
rs1324672802 4903 dbSNP
rs1412872539 4912 dbSNP
rs1386774419 4940 dbSNP
rs1161212181 4942 dbSNP
rs942713782 4953 dbSNP
rs192535273 4954 dbSNP
rs1180465035 4958 dbSNP
rs1479641306 4959 dbSNP
rs1232213920 4960 dbSNP
rs1222106143 4962 dbSNP
rs1453111248 4970 dbSNP
rs1289874267 4971 dbSNP
rs1172142863 4973 dbSNP
rs1245452906 4974 dbSNP
rs1354532642 4976 dbSNP
rs1352437610 4984 dbSNP
rs963229722 4986 dbSNP
rs973164654 4989 dbSNP
rs1376735703 4991 dbSNP
rs1373318310 4992 dbSNP
rs1275953043 4993 dbSNP
rs920373573 4995 dbSNP
rs1364039719 4999 dbSNP
rs928970868 5000 dbSNP
rs1052617680 5001 dbSNP
rs1423560730 5005 dbSNP
rs1360731267 5007 dbSNP
rs146650793 5016 dbSNP
rs1416779516 5023 dbSNP
rs62134050 5024 dbSNP
rs1191638064 5025 dbSNP
rs1478896771 5027 dbSNP
rs114384426 5036 dbSNP
rs140234173 5049 dbSNP
rs1305996176 5051 dbSNP
rs1288407251 5057 dbSNP
rs905675509 5060 dbSNP
rs935859470 5066 dbSNP
rs1279968332 5067 dbSNP
rs369583079 5069 dbSNP
rs1283088259 5070 dbSNP
rs1400970102 5072 dbSNP
rs1340810100 5077 dbSNP
rs768418809 5078 dbSNP
rs1054535462 5083 dbSNP
rs1344038821 5088 dbSNP
rs1413284526 5089 dbSNP
rs539987369 5091 dbSNP
rs1236800807 5095 dbSNP
rs891880387 5102 dbSNP
rs1016453321 5114 dbSNP
rs1198492312 5117 dbSNP
rs1188078068 5124 dbSNP
rs774331314 5128 dbSNP
rs963118906 5131 dbSNP
rs866918768 5143 dbSNP
rs1238085205 5147 dbSNP
rs891361709 5152 dbSNP
rs1007130959 5154 dbSNP
rs1212289873 5163 dbSNP
rs1173858282 5165 dbSNP
rs1026109619 5168 dbSNP
rs1263050304 5173 dbSNP
rs1396410082 5176 dbSNP
rs1297294421 5179 dbSNP
rs1432286404 5181 dbSNP
rs748076294 5182 dbSNP
rs1018972463 5188 dbSNP
rs1454103002 5192 dbSNP
rs962901943 5199 dbSNP
rs553310995 5200 dbSNP
rs974685273 5201 dbSNP
rs954504988 5202 dbSNP
rs1027367557 5204 dbSNP
rs1465954824 5207 dbSNP
rs1374533433 5212 dbSNP
rs950477646 5215 dbSNP
rs910460423 5219 dbSNP
rs983049861 5224 dbSNP
rs566790192 5228 dbSNP
rs145391033 5229 dbSNP
rs916931269 5230 dbSNP
rs925246487 5232 dbSNP
rs936747066 5233 dbSNP
rs1249940739 5234 dbSNP
rs1227114586 5243 dbSNP
rs771571886 5248 dbSNP
rs1052481375 5257 dbSNP
rs1306613302 5257 dbSNP
rs1277948873 5260 dbSNP
rs1379862022 5265 dbSNP
rs949743228 5265 dbSNP
rs1336021588 5272 dbSNP
rs548852762 5274 dbSNP
rs570163167 5275 dbSNP
rs537595101 5278 dbSNP
rs914112277 5284 dbSNP
rs183589528 5290 dbSNP
rs935812444 5291 dbSNP
rs1054706352 5292 dbSNP
rs1461283037 5295 dbSNP
rs1165634146 5297 dbSNP
rs891858274 5306 dbSNP
rs1384636533 5307 dbSNP
rs946134301 5309 dbSNP
rs1179857220 5310 dbSNP
rs1421441524 5312 dbSNP
rs188334212 5315 dbSNP
rs891120543 5324 dbSNP
rs1292064047 5325 dbSNP
rs572764349 5346 dbSNP
rs571327792 5352 dbSNP
rs1254524601 5358 dbSNP
rs766011939 5360 dbSNP
rs543201583 5363 dbSNP
rs181221511 5365 dbSNP
rs753687542 5371 dbSNP
rs137929438 5373 dbSNP
rs776116436 5377 dbSNP
rs898745211 5378 dbSNP
rs1171498797 5383 dbSNP
rs371881010 5385 dbSNP
rs954578113 5386 dbSNP
rs779276816 5389 dbSNP
rs1401862987 5395 dbSNP
rs1008717849 5399 dbSNP
rs1471194647 5400 dbSNP
rs1362569714 5404 dbSNP
rs1161898926 5409 dbSNP
rs1386970461 5425 dbSNP
rs1017962620 5428 dbSNP
rs149093859 5430 dbSNP
rs995654582 5432 dbSNP
rs1271443073 5435 dbSNP
rs143116995 5440 dbSNP
rs979053451 5443 dbSNP
rs950446492 5444 dbSNP
rs925311252 5448 dbSNP
rs34643181 5455 dbSNP
rs1205274257 5456 dbSNP
rs1352134072 5460 dbSNP
rs983143289 5465 dbSNP
rs958023298 5467 dbSNP
rs1274345963 5468 dbSNP
rs988259644 5469 dbSNP
rs913976167 5474 dbSNP
rs1225439533 5479 dbSNP
rs1402534395 5484 dbSNP
rs369395078 5495 dbSNP
rs541812681 5505 dbSNP
rs1214116978 5508 dbSNP
rs1254583922 5519 dbSNP
rs562204225 5524 dbSNP
rs1432052797 5530 dbSNP
rs927200607 5531 dbSNP
rs1174795669 5537 dbSNP
rs1480311408 5540 dbSNP
rs1046580359 5541 dbSNP
rs1193383156 5541 dbSNP
rs1448248210 5547 dbSNP
rs957532530 5555 dbSNP
rs989977862 5557 dbSNP
rs1233012366 5558 dbSNP
rs531272567 5565 dbSNP
rs1204006913 5567 dbSNP
rs1179506345 5569 dbSNP
rs551193807 5570 dbSNP
rs1221533362 5571 dbSNP
rs1322490130 5578 dbSNP
rs926757993 5580 dbSNP
rs1433103563 5587 dbSNP
rs1457134165 5592 dbSNP
rs913054033 5595 dbSNP
rs186495979 5604 dbSNP
rs764538401 5614 dbSNP
rs1397061564 5616 dbSNP
rs1409029730 5618 dbSNP
rs530908052 5621 dbSNP
rs1403883751 5623 dbSNP
rs1323112865 5634 dbSNP
rs1051174894 5636 dbSNP
rs189910175 5639 dbSNP
rs938282176 5643 dbSNP
rs1038317412 5644 dbSNP
rs1444495454 5653 dbSNP
rs898873545 5662 dbSNP
rs1286477498 5676 dbSNP
rs1349810282 5680 dbSNP
rs1191924463 5682 dbSNP
rs1461378031 5689 dbSNP
rs546745145 5694 dbSNP
rs372163366 5704 dbSNP
rs912691242 5707 dbSNP
rs1233750545 5712 dbSNP
rs942678064 5713 dbSNP
rs1460728719 5715 dbSNP
rs1047497081 5717 dbSNP
rs1337759303 5718 dbSNP
rs890184621 5730 dbSNP
rs1246810105 5733 dbSNP
rs1385011932 5736 dbSNP
rs1452498405 5737 dbSNP
rs868400388 5739 dbSNP
rs1040117984 5746 dbSNP
rs141305174 5751 dbSNP
rs1408563371 5753 dbSNP
rs1208920945 5754 dbSNP
rs1393971793 5755 dbSNP
rs1296013618 5767 dbSNP
rs1273231099 5769 dbSNP
rs1341953893 5780 dbSNP
rs964862858 5785 dbSNP
rs996178441 5786 dbSNP
rs1181179469 5787 dbSNP
rs1000157981 5789 dbSNP
rs1032922140 5791 dbSNP
rs553514584 5796 dbSNP
rs887262887 5808 dbSNP
rs958055845 5817 dbSNP
rs1013738226 5827 dbSNP
rs535450685 5842 dbSNP
rs181621411 5852 dbSNP
rs1313064474 5854 dbSNP
rs758918187 5856 dbSNP
rs1245312316 5858 dbSNP
rs971130173 5862 dbSNP
rs1374774462 5864 dbSNP
rs1201852871 5867 dbSNP
rs1001182161 5872 dbSNP
rs1034449955 5885 dbSNP
rs957085168 5888 dbSNP
rs1354257205 5896 dbSNP
rs1307055971 5903 dbSNP
rs1020946151 5904 dbSNP
rs549395071 5905 dbSNP
rs1161192230 5911 dbSNP
rs1472555359 5914 dbSNP
rs1189269068 5916 dbSNP
rs567994792 5927 dbSNP
rs536998364 5928 dbSNP
rs1408633153 5930 dbSNP
rs913188138 5936 dbSNP
rs967201300 5937 dbSNP
rs982568220 5939 dbSNP
rs1199843968 5944 dbSNP
rs1490916808 5944 dbSNP
rs926811835 5952 dbSNP
rs986635246 5954 dbSNP
rs1317528437 5956 dbSNP
rs1397507469 5960 dbSNP
rs34180518 5962 dbSNP
rs147246618 5966 dbSNP
rs1373198183 5967 dbSNP
rs1306263396 5968 dbSNP
rs942792723 5970 dbSNP
rs1039683994 5976 dbSNP
rs973713192 5977 dbSNP
rs1435145706 5983 dbSNP
rs1161243163 5985 dbSNP
rs928996970 5985 dbSNP
rs576589483 5986 dbSNP
rs931357952 5989 dbSNP
rs1047294038 6000 dbSNP
rs117950989 6005 dbSNP
rs552765868 6006 dbSNP
rs887396823 6007 dbSNP
rs1267047068 6009 dbSNP
rs1198903719 6014 dbSNP
rs1486250364 6019 dbSNP
rs1243953199 6022 dbSNP
rs1213700717 6027 dbSNP
rs373581595 6029 dbSNP
rs1046563936 6030 dbSNP
rs1039192525 6042 dbSNP
rs900368800 6043 dbSNP
rs1362187701 6050 dbSNP
rs1225646842 6053 dbSNP
rs1290170270 6066 dbSNP
rs1273375560 6070 dbSNP
rs1387906976 6071 dbSNP
rs1337240672 6074 dbSNP
rs1470843833 6091 dbSNP
rs1426887305 6096 dbSNP
rs11884907 6102 dbSNP
rs1000425083 6104 dbSNP
rs1032954302 6109 dbSNP
rs1212272589 6111 dbSNP
rs1421895673 6113 dbSNP
rs1184922458 6119 dbSNP
rs139078035 6122 dbSNP
rs1001675786 6129 dbSNP
rs750476585 6130 dbSNP
rs142982479 6133 dbSNP
rs1044786 6135 dbSNP
rs561693368 6152 dbSNP
rs1262956189 6157 dbSNP
rs1228588001 6167 dbSNP
rs11884921 6168 dbSNP
rs186117879 6180 dbSNP
rs971095095 6188 dbSNP
rs982255321 6205 dbSNP
rs1315675982 6206 dbSNP
rs1220872977 6220 dbSNP
rs1454477234 6222 dbSNP
rs1373927675 6233 dbSNP
rs1476549959 6239 dbSNP
rs544960033 6242 dbSNP
rs879085201 6255 dbSNP
rs1389682677 6259 dbSNP
rs1356495596 6260 dbSNP
rs1435384709 6266 dbSNP
rs1011287407 6269 dbSNP
rs190879955 6270 dbSNP
rs973523029 6272 dbSNP
rs920739103 6282 dbSNP
rs768830753 6291 dbSNP
rs986602689 6295 dbSNP
rs1318735411 6306 dbSNP
rs1019476217 6308 dbSNP
rs1481786411 6313 dbSNP
rs983629116 6317 dbSNP
rs963934100 6318 dbSNP
rs533516073 6320 dbSNP
rs77286899 6321 dbSNP
rs116570903 6330 dbSNP
rs944364568 6334 dbSNP
rs1247511625 6338 dbSNP
rs1380573011 6345 dbSNP
rs529419908 6356 dbSNP
rs1038812301 6364 dbSNP
rs1296393966 6366 dbSNP
rs1375192020 6386 dbSNP
rs1296698454 6387 dbSNP
rs1429394353 6404 dbSNP
rs1366402984 6405 dbSNP
rs1348100768 6415 dbSNP
rs780376287 6421 dbSNP
rs116060320 6425 dbSNP
rs1183096289 6433 dbSNP
rs376841183 6438 dbSNP
rs72865581 6439 dbSNP
rs369434972 6444 dbSNP
rs1181877960 6450 dbSNP
rs1200381586 6451 dbSNP
rs796859748 6457 dbSNP
rs754836595 6462 dbSNP
rs537860469 6463 dbSNP
rs1224163718 6472 dbSNP
rs1353631790 6474 dbSNP
rs1264845944 6476 dbSNP
rs1239641413 6478 dbSNP
rs905348800 6480 dbSNP
rs1304628108 6482 dbSNP
rs183546711 6484 dbSNP
rs1305181077 6494 dbSNP
rs778609824 6495 dbSNP
rs748088613 6499 dbSNP
rs1390076569 6503 dbSNP
rs147490610 6510 dbSNP
rs1454837857 6518 dbSNP
rs1055948944 6520 dbSNP
rs1175615886 6524 dbSNP