miRTarBase - #MIRT542810 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PHC3   
Synonyms EDR3, HPH3
Description polyhomeotic homolog 3
Transcript NM_024947   
Expression
Putative miRNA Targets on PHC3
3'UTR of PHC3
(miRNA target sites are highlighted)
>PHC3|NM_024947|3'UTR
   1 CAGGAACATGAAGCCTTGATAAAACAGCAGTTTTACTTTTCTCACAAAAACTTGTAAGGTAAAGGCCTAACTTGGTCTAG
  81 AATATGACACTTATTGTGGTGGATAGCCAAGCACATTGGGATCTCCACATCAAATACTGACATTTCTTCTACAGGTATAA
 161 TAATTCATCATGCATTTTCATAATTAATAAACATTGGTAAAATTAATTTTACAGGTTACATGAAACATTGAAAGACTTGT
 241 TACAGAGGGCCATGATATTTTTCAAAGAAATGTGTTATACTAGATAATTTTTTTAAAGGTGATGTTTATCATTAATATAA
 321 AGAATCCTTTTAAAAGTAATTTAATGATTTACATTTCTCCTCTTTTGATTCAATTTTCTTATACATTTTTTCTACCCTAT
 401 TAGTTTTCTAAAGGTTGTCATGAGAGGTATATTATGGAATAATTTAGTAGTCCAGTGACAGAATCGTATGAAATCAGTGT
 481 ACATTTTAAAAAACATGTCTTTTAGACATATGCTTTATCTATAAAAAAGGAATTGTGTTCTAGTATGAACAATACTGATC
 561 TGGAAGTGAGAAGAGTTAGTTTCTATTCCAAACTTGACCAAGAATTTGGTTTGACTGAGAACGTTTTCCTCTCAGTTTTT
 641 GTACATTTATTTAGAGCAGTGGTTCTCAGTGGAGGTCAGTTTTGATCGCCAGGGGACATCTGGCAATGTTGAGACATTTT
 721 GGTTGTCACAGCTTGGGGGTGGGTTCAGGGGAGGGTTGCTACTGGTGTCTAGTAGTTAGAAGCCAGAGATGTTTCTAAAC
 801 ATCTTATAATGCACAGGACAGCACCCCTCCACTGTAAAGAATTATTGGTTCAAAAATATCGGTACTGCCAAGGTTGAGAA
 881 ACTCTGATATAGAAGGAGTGATAAATATTGTTTTCACCCAAAGGAATACTTTTAAAGGATGAAGCTTACTAAACATATAT
 961 GATGGAAGTATTATTCAGATAACATTAATATTCTGCTGAATAATTTTTTCTAGTTTAATCATACTAGAAAAAGAAAAAAA
1041 ATCTACAAATTGTCCTATAAAATAAGGACAAACATGCAAATAATTTAACTCTCAGAAAGTACTAATTCATTCTGATTATC
1121 TTTCATACCTCTGTGCTCCTCTGCACTGACGAAGACATAATATGATTATACCTATGAACTAGTGCACAGCCTTTTCTGGC
1201 AAGAAAATAGTTTGTAGCAGATACGTGGTTGCTCTTTGGATTTTTTTCTATTGTTGAACATGCTGGGACTAGCTAGAATG
1281 CACATTCCTACTTCCTTTACCAAACGTTTGCATGCTTCCTGCAAAGCACTTACCAAGTGATTTCTCTTGAACCATCGGAT
1361 ATAATTTTGTATGTACATGTTTGAGGAAAAAAATGTAAAGCAAAACCTTTTACTGAACAGTGTTCTATAGAATTATGACA
1441 CTAAAACAAAATTGTTTGTGGAAGCCCTGAAAGCTTTATAGTCCTGGACATCAAAAATTTTATTTGAGATGATGAATGTT
1521 TTGTTTTCATCTTTTCTTATATTACCACAATTGAGATATTTTAGTAATTGAAGGAACATACACAGATATTTGGCAGAAGT
1601 CGAGTAAGGAGGGGAAAAAAAGAGTCCGTGAGTTTCAGTCATTTTCACTGCTCTTTTCAAAAAGATTGTGTTGAGCTGGT
1681 AGAAGACTAAAGATGTCACTGAAGACATCACAGATACTATATTTATCTTTTGGCTTTGTGTACATTAGAGAATGTTGATT
1761 ATTTTTATACAAAAATACAGCGGGTAATTTTTTTAATCTTTAGATGCCTCTTGTTTGAATGTATGCTTTGTGGAATTCTT
1841 TGTGTAGTAATGTTTTAAAAAAAGATGTTTACTGATAGTTACATGTAGGATTAGAATATGTAATATAATATAAGGCTCAT
1921 GTTCCAGACCTACGATAGCTTGTAGTCTATGTTACGTATTTCTTTATATCACATTTTTAATCATTGGATTAAAGTATCAA
2001 GGAAAGCTAGGTACTCTATAATGAGTTTTCATTTATTAGCAGTTAATCATCATGACAGAATTGTCATATGCTTGACTTTT
2081 CCCTCTTCTTGGAATTTCAGAACACAAATACAGGCTAAGCATTAGTAAGAGATGGCCCACAGTATGAGAGAGAGAGGTGC
2161 AACGGAAAATCTCGCCTGGAATTAAAACTTTTCATAGATTATCCACGGTTAATACAAAATTTATTATATGGGGATAGACT
2241 GCTCCAGCAATAATGATTACATCCTATAACTGTATTACCTATGGCCTTTAAGGTATCAATTTTGAACTGTGTTGTAGGCT
2321 CTCCTTTTATTTGTTCTCTTTCCTAATAGCAGCCATTCTGTACTTATTGAAAGCCCCTGTGCCTACTGCTGTCTTAAGTA
2401 TTCAGGAGGGGCTTACAAGAGGGTTTTCTATTGGAGAATACCGTATAATCTTAAATCTAGTCCAGATCTCTGTTGTCCCC
2481 ACTCAAAACATACACAAAATATGCACTTGCTTTTTTCAAGTGAGTTTTTATTTAAAAATGGCTTGTTTGCTATCACATTG
2561 GTGCAGCTGTTTCTTTCAAGATGAGTTAATCATCTTAATTTCAAAGCTTCAGCTATATATAATGGATATATAGACAACAC
2641 TGAGCATCCACCTCTCTCCTGAGCTTTAAAGCAGAGTTTCAGTATGATATAGGTGGGGAGAGTAAATTGTTTTCATATCC
2721 TTTCATACTACTACTAATAGTTTTAGGATTTTGACTGGGGAGAGATAATGACAAACAGAAAGGGAACATGGAGGTTCTTC
2801 CTACTTTTGCTACCTAAGTTTGCATTTTCTGACTTCCTTGCAGTGTTGCACTCTTTGTCCCATTGGGATAAAAAGCATAA
2881 GTTTGAAATTTTGCTTTAAGCCTTGTGTTCCTGGGGAAGTTAAACAACTAAGAGAGCTGATTTGTAAAAATTATTTTTTA
2961 TATGACATTAATATTCATCAAGCCTTGTGTAGGCATGTGTAAGACACAGCTATGCAGCTTTGAGTAGTCAATATAGTATG
3041 AGATAGAGTGTTGTCCCAAATCCTCCTGTCACTTTTTAAGTAGCATATTATTTCCCTGATGGTCCTGTTACTTTGCTGTT
3121 GAATGCTCTAAACAGAACTTTTTAAAAGGTGTGTTTTAAGAGCAGTCACCTAGGAGTAGACAAGGTGGAATGGGAGGAGA
3201 GAAATGGTAATGCAAAAGCTTGAGCATGGGAAGAGTCAGAGGAGGAGGCCATCATCCTTGTTAGCTTAGCCTACTTCAAC
3281 ACTGAGCACATTTCTGCACTTTTGAAGTGAAATTCATGTTTTACTTAGAAGAAATAATTTTCTTTCATTAGGGATCCCAG
3361 TTGATTTTTGTTTCCTGGTGTATCAAAATACTTAGAACTATGAAACAAGTATTATTGTGATCATGCCTTTGAATAATTTT
3441 TGACGTAGCTTATCTTCATGTATCAAGTATAAAATTATAATGAGACATCTATTCACAAATACAAGTCTTAGATTGAATTG
3521 AAATGTGTTATAGTGCCCTGTCTCCCACTGACTTGTTCAGTTAAATGTCTTAAAGTACATTATGTACATCTTCAGGCTTT
3601 TGGTACCACAATGGCACAAGTATGGTAGGGAGGCAATATAGTCTTAGGCTATATGCCTATATTAAGTGTGTATAAACAAT
3681 TTTTGAAAGAATACACTATTATAGATGTATGTGAGTGATGCTGACCTGACAGCCATATCCAGTGGATGAAACTGACTGGA
3761 CACACTGTTAAAATGTTTTAAAGATGTATTTTCAGCCAGAACAGCCTGGTTATAGTTTGTGGTTTTCACCTTGGTGGATT
3841 GCAGGAACACATGCAGCCTACTGGCATTGAGCATTAGCTAATGGCATGAAAGGGCCTCATCTCACTACCTCTCTAAGGCC
3921 TCTAGCTCCAAGAAAACCATGAAAACTTCTTTCTTGGAGAGATCTTTGTCTCAGAATCCTTAGAGAGGATTTCGTATGGG
4001 GGCTAACTTTAGGAAGGGAGGCAGCTGGGGCAGGACTTTCTGATACCTGACAGTCATGTTCCAGAGCAACCTTTGGGCAG
4081 TGGAAACTGGCGCATCTATGCAAAATGATTGCTCAATCTCTATCTTGTGTACTACATATGTAACTAGCTGGGCCCTAAGG
4161 AAGGTTTTCTAGGGGGAAGGATAGGGAAGTAGAGGAGGAGACAAGTAGGAGGAACAAAGCATTCTAGACCCAAGAGGATA
4241 GAAGATATTTAGGATAGATATGGCTTTCATCCATAGTTCAAAATAATGCGTTTTGTTAGATGCCAGTTATAGCAGTAAAT
4321 AGGTTATAGTTTTTATATGTCAAGATTTACCTGTAATCAGACTCATTCTTTCACTCTCTATACCCACTGTCTCCATGCTT
4401 GGGAGCATGGATATTAATAGTTCCAGTGATGTAGAAGTTAGTGATTTTTGATTTCTGAAAAAGGTGAGAACCTTTTATTA
4481 CAGTTGGAGAATATTTGTCAAAAATTCAAAGGTTGTTGTAATTGAGTTGCCAGAATTACAGAGTTTCCATTTTCAGATAT
4561 CACAGTTGAATCACCTCTGTAGATTGTTATAAAGAGAGGCATTTTAAGATAGTATTTTATTTGCTAGGTTGTGTCTCAGT
4641 CTAAGAATTGGGAAAAGAAGAGCTATAGGTTTCTCTTTCCTAGTCTGGATTTCAGTAAACACAAGCCTACCTCTGCTTCT
4721 TTGGTTCACAGCAGTGTGGATCATGAAATGAACTGTTTACCCACATTCATCAATATTGGTATTTTACAAATCTACTTGGA
4801 GCATTTAATTTCATCTCAAAGATTGTGATCCACTTTAGATAAGCACAAATACAGTATTAGGAAAAGTAAATATGCAATCT
4881 TACTAAAATTTCAACTTGTTAAGCTGTATATCTTAAAAGAAATTATTTGGGGCTGGGCATGGTGGCTCACACCTGTAATC
4961 CCAGCACTTTGGGAGGCTGAGGTGGGTAGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGACCAATATGGTGAAACCC
5041 TATCTCTACTAAAAACACAAAAATTAGCTGGGTGTGGTGGCATGCACCTGTAATTCCAGCTACTTGGGAGGCTGAGACAG
5121 GAGAATTGCTTGAACCCAGGTGGTGGAGGTTGCAGTGAGCCAAGATCACACCCCTGCACTCCAGCCTGGGTGACAGAGCG
5201 AGACTCCATCTCAAAAAAACAAAACAAAAAATTATTTGGGAAGATACGTCCTCTTTTATTAGAAGTTCATAAAATGTATC
5281 ATATAGTTTTGTTCACAGTAGTTATATAAGCTTTCTTCAAATAAATTTAAAATTAGATTACCTTCTTTGGAAAAAGAATT
5361 TCCTAAATTTTTAAGAATTTTCAAAGTTTTACATATTAGTTTTTAGAACCTAATCCGTTTTAAAATTGTACTATGAGAAA
5441 GCTTTTTTTTGAAAGTTGTAAAGCATTAATACAAATAATACAAATATAATTATTACCATCACATTCCAGAGAATATGGCT
5521 TTTTCTAAACTTTCAATTTAGAAAACATACATTAAGGGAGAATCTCTGCCCTCCTTTTCAGCTCTGAAGATCAGCTTTTC
5601 TACTCAGACACATGCACACACCCCTTCCAAGTGTCATGTTTATGGGAACATTTGGGAAATGTTTTCCAGATGTTTTATTT
5681 TTTCCCTTTTATAGTTTGTTGACATTTAATTTTACTTAAAGATGACAATTTTAATCGGAAATGTTAGAGGTACAACATAG
5761 TGAGGTTCTAGCTAGCTTTATACTTTTGAAAAATATTTTTGTTTCTACTGCTTTTTACAAGTACTAGTCCTCTCAGTGAT
5841 ACTGGTGGTGTTCAGTATGAATCCATAGAAAGAAAACAAAATTTGTTGTTTAAAAAAAGCAGAGTAATGAATGAATTTCA
5921 GTTTTGAAAACAACATAATTTGAAAACACTGTTATACTAACATGGCAAGGTGTTAATTAAATATAAGAGTAAGGTAGTAA
6001 GTTCTTTTAGAGCACCTGTTTAAATTTACTCCAGTAATCATCTTAAGGATTGATAGTCACCATCACTTATTGGCTTAAAA
6081 GTTATATTTCATGGAATATTATCAGTGTTAAATCCAAGCTTTGTGGAGCTTTAAGTGATGGTGGTGAAAAAGTTGGTGTT
6161 TATGAGAGAGTGGTGGGGTGTCTAGTCATTAGTGAAGTTAAACATCAACCTGTTTTAGAAAGAATTTTTTAGTCTTGCCT
6241 AAAGTAAACCAGAAGTGTCTAGTGTTTAAATCTTTATTTAGAATGCTTCTCTTAAAAGTATTTTTTGTTTTGGGTAGTAT
6321 TAAATAATCAGTAAATAATCTATTTCAGTAGTAAATAATGAATTAAGATGATGATGAATGAGGATTAACACACTGGTCTG
6401 GAGACTGGGGTTTTATTTCAGTGGGTTAGCTGTGTGTGACATGTTGGGCAATTACTCAGCTGTTTTAACAGCTTCCAGAT
6481 ATGCAGTATGGTGCCTGTACTACTCAAAAGTTGATTTTGGTTTAATTCATCTTTAAGGTACCTCCCAGCTCTAAAACTAT
6561 GATTCTAGGCTGTGTAATGGGGTTATTCCTACTTTATTCTCTTTCCTTTTTTAAGGGTTCATTTTATACTTAATAAGCAT
6641 CCATTTCTTGGGTCACCTACAGTCTTTGTTCTCCTAAGGATTAAAATAGAAAATTCATACATAACAAGCAAATGATGACA
6721 TTTTCCTAAATGCTCCTTATTGGTTAACCACTGAATATATGAACACATATGAATATTGTCATTCATGTACTTAAATTCAT
6801 TTAGCAAACTATTTGAACACTTACATGTGCAGTGTTTGGTGAACATGACATGAGGAACTAGTAGTAAGTAAAATCTTCCC
6881 CCCAAAATTCATTGTGGCTTAAATAAATATGAACATAATCATTACTACTTAATATACTGAGAGGGAATCTTAATAAACTT
6961 GGAACTGGGAGGGAATATTTGTATACATTGGGTAAAGGGTTAGGCTAGATGACATCTAAGGGGTCTGAGTGAATCATATC
7041 ATAATTTTTATAACACATTTCACATACTAAACATCAGTTGGCCCCATACCTGATTAAGTTACAAAATTTAGGAGACTTAA
7121 CATTAAGGACTTACAGGTTGAGACAGCCCGTATTTCACAACATTATTTTGACACTTGACTCTATTCCAGAGTTGTTGCTA
7201 TACAAGGCATGTGGCAGAACAAAAAAAAAGCTGGTGTTGATATAAGAGCTTTTTACCCAGTATTGACAGTGAGCAACTTT
7281 CTTTCTTTTTTTTTTTTTTTCTTTTTTTTTTTTTTGAGATGGGTTCGCTCTGTTGCCCAGGCTGGTGTGCAGTGGTGCGA
7361 TCTCAGCTCACTGCAACCTCCACCTCCCGGGTTGAAGCGATTGTCTTGCCTCAGCCTTCCAAGTAGCTGGAATTACAGGT
7441 GCCCGCCGCCACACCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGCTTCACCATGTTGGCCAGGCTAGTCTCGAACT
7521 CTTGACCTCAAGTGATCCACCTGCCTTGGCCTCCCTAAGTGCTGGGATTACAGGCATGAGCCACCACACCTGTCCGACAG
7601 TGTAGCAACTTTCTAAAACTGAAAAATCTCAAAGGAGATCATTGGAACTGACTTGTTCATTTATTTTTTGTTTTTAAATT
7681 AAGAAAGATTACACAAAATAAGTGTTACTGTACTTTAAGCTATTACAAATATCCAACTTTTAAAGATATGTAAGAATCAG
7761 TAATATTCTAGAAAGCACATATATAGTAAAAGGGCATCCTTTAAATGTAGAACGGGTAAACATGAAACAGTTCCATGCTT
7841 GAATTGTTAAGTATCTAGGGGGTAAACATTGAATGGGAGAATCATTTATTGGGTTAAGGTCCCTTCCTTGTCATTCTGGG
7921 ATCTGTGAATCACATTGTAATTCCTGTTGACAAAGCTTTACTTGTTAACATCAGTTGATACTGACATTCTCCATAAAGAT
8001 ATAGAATGAAAATATCTATTAAAAATAGTTTATCATTGTTTTAGCTTTTTTGTTTTGTTTGTTTTGAGACAGAGTCTCAC
8081 TGTCACCCAGGCTTGAGTGCAGCGGTGTGATCTTGGCTCAATGCAACCTCCACCTCCCAGGTTCAATAGATTCTCCCACC
8161 TTGGCCTCCCAAGTAGCTGGGATTACTGGCATGCACCACTATGCCTGGCCAGTTTTTTGTATTTTTAGTAGAGATGGGGT
8241 TTCACCATGTTGGCCAGGCTGGACTCGAACTCCTGACCTCAAGTGATCCGCCCACCTCAGCCTCCCAAAGTGCCGGGATT
8321 ATAGGCATGAGCCACTGCGCCTAGCCTGTTGCAGCTTTTTAAAGCAGGAAAATATCCATATAAACTGTTGGGTTAGAATC
8401 TATATTAGAATCTTTCAAACTAATTGAAAACAGGAAGACTATCATCTAAGTAGCCAGATAATCTGGGTTTCAAAAAGTTA
8481 TTCCATGGTACTGGTTTAAAAAATACTTTTCAAGTGTTTTAATTTTTAAAGTGTAACTAATTCTTCAAATATGTTATGCT
8561 GTTAAAATATGTATTCCATAAGTACTTTTTGTATATGTATTCTTAAATTTTAAAAAGTCAACTGAATGCGCAAAGATGAT
8641 ATAATTTTGGATGTAGACATTTAAACTAGATTCCCAGTCCTCTCCTTCAAAAGCTTGGTCTTTGTTTTTCCTATAGGGAA
8721 AAAAGTCAAAATAAGTTCCAAAAACTATCCTCAAAGTAGTATTGTGCTTGTAGTAAATGAAGGTTGGATGGATGGATACT
8801 GACAATGGTGGCAGGCATTTCAAGCCTTTTAAATTAGTACTTTTTGTCGTCTTGCTTATTAAAATTTTGTTAATTTTAGC
8881 AAAGACCAATTGTTGTGATAAACTGGTGTTTTTTGGATGCTTCAAGCACACGTTAACCAATTTTTTAATTCCCCTTTTGG
8961 TTCCTCCCATTGTTCTAAAATAGGACTTTCATATTATTAAAACCTCAAAAGATGATCCACCCAGGATGAACAAAGATCAC
9041 CAAGGGGAAAGAAAACATTTTTTATCTTTACAGAAAACATGTTAAGATTATATATAGATGTATTCTTTACATTGGATATT
9121 GTATTAGAGTCCTCCTTACAAGAAATGAAATAGTTTTTAGCACTCTTAGCATTAGAGTTCCTAGATTGGTGTTGATAGCT
9201 ACAGTTTTAAAATGTATAACCTGAAAATGAAGGTTAATTTTGCATTGTAAGAGCACATTTGATCTATGTAAAAAGTGTCC
9281 ATTTGGTGTATTTTTTTAAAAAAGAGAAAGCACTTTCATATTAAGTAGCATGTGTATGAATTTAGATTTTCATATTTGTT
9361 GTGTCTGTATTCAGTGAAGTAAATTGAGCATTTAAATGTTTGTTGATGGCAACATTAACTATTAAATTAAAGCACCTTAT
9441 ACTCTGCTGCTTAACTTGCTTGTAATTGCACCTTTGTTACCTGCACATTTTCATATAGAATATTGTTGTAACATTGCTTC
9521 ATGTGGGTCTGGATGGAAGATTAGTGGGCCTACAGGATCATTTATTTATATTGTTTATATTACAATAATATATTGTAGAT
9601 CAGTTGTAAGTTCATTTCTTTACAAATAAAAGCCTCTTCCATTTGACTGGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU--AAU---ACACGACGAu 5'
            :||| ||  |||   | ||||||| 
Target 5' atTAAAGCACCTTATACTCTGCTGCTt 3'
9426 - 9452 158.00 -11.50
2
miRNA  3' guGUUUG-GUAAUACACGACGAu 5'
            ||||: ::|||  |||||:| 
Target 5' ttCAAATATGTTA--TGCTGTTa 3'
8544 - 8564 144.00 -10.42
3
miRNA  3' guguuuGGUAAU-ACACGACGAu 5'
                |::||| | |||||:| 
Target 5' atggtcCTGTTACTTTGCTGTTg 3'
3099 - 3121 140.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN32053768 34 COSMIC
COSN31512378 45 COSMIC
COSN1930298 61 COSMIC
COSN30521618 62 COSMIC
COSN26988799 64 COSMIC
COSN26988798 68 COSMIC
COSN30526186 84 COSMIC
COSN31489642 84 COSMIC
COSN30168185 86 COSMIC
COSN30488473 89 COSMIC
COSN30517341 146 COSMIC
COSN31501507 207 COSMIC
COSN31515084 209 COSMIC
COSN19663438 347 COSMIC
COSN26837445 455 COSMIC
COSN21020524 566 COSMIC
COSN27122332 625 COSMIC
COSN32062439 633 COSMIC
COSN20099369 1034 COSMIC
COSN25140392 1387 COSMIC
COSN29443311 1566 COSMIC
COSN29669802 1627 COSMIC
COSN7834844 1865 COSMIC
COSN7834843 1869 COSMIC
COSN7834842 1880 COSMIC
COSN7834841 1994 COSMIC
COSN21737760 2169 COSMIC
COSN19118215 2545 COSMIC
COSN26830031 2600 COSMIC
COSN25268620 2724 COSMIC
COSN16716252 2920 COSMIC
COSN19415584 3239 COSMIC
COSN32222915 3343 COSMIC
COSN19415583 4012 COSMIC
COSN22216962 4172 COSMIC
COSN19415582 4244 COSMIC
COSN15726750 4507 COSMIC
COSN6753055 4823 COSMIC
COSN29559601 4848 COSMIC
COSN27897234 4852 COSMIC
COSN28129214 4853 COSMIC
COSN20616413 5393 COSMIC
COSN20099361 5441 COSMIC
COSN20090937 5907 COSMIC
COSN1271760 6066 COSMIC
COSN20090936 7285 COSMIC
COSN17123615 7300 COSMIC
COSN23959746 7301 COSMIC
COSN16720098 7408 COSMIC
COSN29614705 7476 COSMIC
COSN5146877 7851 COSMIC
COSN29830485 7882 COSMIC
COSN26666769 8343 COSMIC
COSN20925030 8481 COSMIC
COSN6426090 8540 COSMIC
COSM3767294 8788 COSMIC
COSN20891172 9038 COSMIC
COSN6753053 9158 COSMIC
COSN1930295 9336 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758598023 1 dbSNP
rs1233464641 3 dbSNP
rs745927956 8 dbSNP
rs1470181056 9 dbSNP
rs779342767 10 dbSNP
rs757501584 14 dbSNP
rs1356774172 25 dbSNP
rs1330205396 26 dbSNP
rs1403872650 27 dbSNP
rs753945118 37 dbSNP
rs1398508448 40 dbSNP
rs764555137 43 dbSNP
rs1448855270 45 dbSNP
rs1018105127 47 dbSNP
rs1401413562 48 dbSNP
rs901530770 49 dbSNP
rs568803236 51 dbSNP
rs562213452 54 dbSNP
rs1262258622 63 dbSNP
rs1278069546 76 dbSNP
rs1325908939 93 dbSNP
rs543878375 94 dbSNP
rs1262874696 95 dbSNP
rs908827889 101 dbSNP
rs1322068554 107 dbSNP
rs983404399 114 dbSNP
rs931500284 116 dbSNP
rs1321019479 120 dbSNP
rs920066376 122 dbSNP
rs532207070 123 dbSNP
rs1250624679 145 dbSNP
rs1289453327 152 dbSNP
rs1179033773 157 dbSNP
rs1247560877 165 dbSNP
rs1480543436 175 dbSNP
rs780011475 184 dbSNP
rs1296423758 191 dbSNP
rs969488222 195 dbSNP
rs1467133900 212 dbSNP
rs1380161861 217 dbSNP
rs1025047367 220 dbSNP
rs539192451 243 dbSNP
rs1409515152 255 dbSNP
rs992213374 257 dbSNP
rs904778279 264 dbSNP
rs956915186 272 dbSNP
rs948856926 275 dbSNP
rs1283064549 284 dbSNP
rs1289792011 286 dbSNP
rs9828429 287 dbSNP
rs1001152026 295 dbSNP
rs1230262716 310 dbSNP
rs1057262766 321 dbSNP
rs1364278334 326 dbSNP
rs1339282990 329 dbSNP
rs938472518 332 dbSNP
rs908172857 346 dbSNP
rs982430278 354 dbSNP
rs1198170365 355 dbSNP
rs1165961241 364 dbSNP
rs1425391711 367 dbSNP
rs1478718942 367 dbSNP
rs1372481276 369 dbSNP
rs903715860 370 dbSNP
rs1028755201 371 dbSNP
rs377303193 373 dbSNP
rs768388547 376 dbSNP
rs1302707617 379 dbSNP
rs1430500232 382 dbSNP
rs919837385 382 dbSNP
rs756330031 383 dbSNP
rs745930114 385 dbSNP
rs1296703420 399 dbSNP
rs1326393278 426 dbSNP
rs940375937 432 dbSNP
rs781366700 441 dbSNP
rs1316554539 451 dbSNP
rs886064781 452 dbSNP
rs1221087970 453 dbSNP
rs185400566 459 dbSNP
rs1486630361 465 dbSNP
rs964204387 466 dbSNP
rs1260725151 468 dbSNP
rs1445231287 478 dbSNP
rs931522952 481 dbSNP
rs1266697967 482 dbSNP
rs1224543704 489 dbSNP
rs573008447 493 dbSNP
rs1387163438 495 dbSNP
rs1445381118 509 dbSNP
rs1162988244 512 dbSNP
rs1383663395 521 dbSNP
rs554149711 535 dbSNP
rs1019472405 540 dbSNP
rs35912209 540 dbSNP
rs1384630663 543 dbSNP
rs1381029434 545 dbSNP
rs1339351115 556 dbSNP
rs1384167227 581 dbSNP
rs920159736 585 dbSNP
rs980958163 587 dbSNP
rs1031636777 591 dbSNP
rs948202617 599 dbSNP
rs541826157 602 dbSNP
rs1484731003 615 dbSNP
rs992620090 617 dbSNP
rs147132009 622 dbSNP
rs1460795594 625 dbSNP
rs1295789426 630 dbSNP
rs556722413 634 dbSNP
rs1254116395 643 dbSNP
rs1043326000 654 dbSNP
rs1013188887 656 dbSNP
rs567083237 660 dbSNP
rs751794501 662 dbSNP
rs979387401 663 dbSNP
rs967967506 670 dbSNP
rs938405910 673 dbSNP
rs547072767 683 dbSNP
rs577555122 687 dbSNP
rs1334146128 688 dbSNP
rs193256384 694 dbSNP
rs1374799962 701 dbSNP
rs764390347 704 dbSNP
rs1391615449 711 dbSNP
rs995999007 713 dbSNP
rs1305564932 735 dbSNP
rs1314748269 739 dbSNP
rs930979515 742 dbSNP
rs1263489080 750 dbSNP
rs1322763035 753 dbSNP
rs1201632469 755 dbSNP
rs919620132 762 dbSNP
rs1481698419 771 dbSNP
rs143432344 776 dbSNP
rs1018697725 777 dbSNP
rs912362392 788 dbSNP
rs1463557053 791 dbSNP
rs1202082072 795 dbSNP
rs753208719 807 dbSNP
rs1174487922 814 dbSNP
rs1031752743 815 dbSNP
rs1175554168 819 dbSNP
rs998978603 820 dbSNP
rs1426936798 821 dbSNP
rs1201574769 822 dbSNP
rs1370772701 826 dbSNP
rs1406347536 827 dbSNP
rs1283704674 833 dbSNP
rs1344567199 834 dbSNP
rs1275104097 839 dbSNP
rs1490485735 839 dbSNP
rs139540807 846 dbSNP
rs1249253383 847 dbSNP
rs1307983475 848 dbSNP
rs886117145 851 dbSNP
rs1250790533 858 dbSNP
rs1049231319 860 dbSNP
rs1193602297 861 dbSNP
rs1481296369 864 dbSNP
rs1480351291 866 dbSNP
rs994484080 873 dbSNP
rs567018882 884 dbSNP
rs1222522655 887 dbSNP
rs1045336380 892 dbSNP
rs114330366 900 dbSNP
rs1368101310 901 dbSNP
rs1013555159 907 dbSNP
rs1303453459 908 dbSNP
rs918041728 914 dbSNP
rs1057473447 916 dbSNP
rs1003037354 917 dbSNP
rs1362610345 921 dbSNP
rs1213869057 924 dbSNP
rs1224708627 925 dbSNP
rs1340056773 926 dbSNP
rs1248254624 932 dbSNP
rs1292849084 942 dbSNP
rs1490240257 946 dbSNP
rs1056571410 956 dbSNP
rs1350447710 959 dbSNP
rs887317153 961 dbSNP
rs1186380447 962 dbSNP
rs935385581 970 dbSNP
rs1397218627 972 dbSNP
rs1163643367 973 dbSNP
rs1302553869 984 dbSNP
rs924036303 985 dbSNP
rs1403204055 988 dbSNP
rs931095620 1000 dbSNP
rs1345507045 1010 dbSNP
rs1429941778 1024 dbSNP
rs1468415488 1026 dbSNP
rs1403692965 1027 dbSNP
rs1384887791 1028 dbSNP
rs535869554 1030 dbSNP
rs567657979 1035 dbSNP
rs968013108 1036 dbSNP
rs200844615 1037 dbSNP
rs942573743 1038 dbSNP
rs1179490948 1039 dbSNP
rs1463023261 1042 dbSNP
rs772631604 1042 dbSNP
rs775910254 1042 dbSNP
rs79070639 1042 dbSNP
rs912487277 1042 dbSNP
rs879460688 1052 dbSNP
rs568494216 1055 dbSNP
rs923793491 1056 dbSNP
rs1202693953 1057 dbSNP
rs977487891 1077 dbSNP
rs1159870551 1078 dbSNP
rs1459675787 1079 dbSNP
rs1264575888 1080 dbSNP
rs974590694 1091 dbSNP
rs965868529 1092 dbSNP
rs1272887121 1095 dbSNP
rs1453233318 1097 dbSNP
rs1337490286 1098 dbSNP
rs1204738719 1100 dbSNP
rs1445912866 1102 dbSNP
rs1281553606 1111 dbSNP
rs765756781 1116 dbSNP
rs1228207260 1117 dbSNP
rs1019162679 1118 dbSNP
rs1326311580 1121 dbSNP
rs1204800681 1131 dbSNP
rs1261969714 1135 dbSNP
rs1259489399 1136 dbSNP
rs1440263882 1140 dbSNP
rs1004704038 1145 dbSNP
rs759978976 1150 dbSNP
rs1233145759 1151 dbSNP
rs991507004 1154 dbSNP
rs1179784199 1157 dbSNP
rs550300759 1159 dbSNP
rs1314439854 1160 dbSNP
rs1450776747 1162 dbSNP
rs1175710343 1166 dbSNP
rs1035946135 1171 dbSNP
rs772713170 1177 dbSNP
rs1470130409 1184 dbSNP
rs1330941132 1186 dbSNP
rs994541151 1188 dbSNP
rs1156803640 1189 dbSNP
rs186669081 1196 dbSNP
rs1363921403 1203 dbSNP
rs1347700092 1210 dbSNP
rs905494887 1213 dbSNP
rs1274835615 1216 dbSNP
rs766973178 1217 dbSNP
rs117315268 1224 dbSNP
rs367813157 1225 dbSNP
rs147386464 1233 dbSNP
rs1202508902 1234 dbSNP
rs1025781692 1237 dbSNP
rs995194627 1242 dbSNP
rs528405308 1250 dbSNP
rs898253996 1260 dbSNP
rs1244611494 1272 dbSNP
rs1183746556 1274 dbSNP
rs1476328929 1275 dbSNP
rs1039743678 1277 dbSNP
rs774035019 1282 dbSNP
rs924061139 1284 dbSNP
rs1043755866 1292 dbSNP
rs1306474855 1294 dbSNP
rs890825164 1295 dbSNP
rs1405986839 1305 dbSNP
rs1051003719 1306 dbSNP
rs935264103 1307 dbSNP
rs923738156 1311 dbSNP
rs1230193793 1318 dbSNP
rs979275795 1328 dbSNP
rs946720900 1333 dbSNP
rs921913057 1337 dbSNP
rs1291638665 1349 dbSNP
rs116114899 1353 dbSNP
rs1361599603 1354 dbSNP
rs1316079469 1356 dbSNP
rs1430263984 1357 dbSNP
rs1325692365 1361 dbSNP
rs966383504 1363 dbSNP
rs780496375 1367 dbSNP
rs911793816 1377 dbSNP
rs74898939 1385 dbSNP
rs950573783 1387 dbSNP
rs1036132275 1390 dbSNP
rs1449000957 1391 dbSNP
rs1027826088 1393 dbSNP
rs1387356345 1394 dbSNP
rs951650201 1397 dbSNP
rs574922348 1400 dbSNP
rs1163062709 1405 dbSNP
rs994552567 1406 dbSNP
rs562862091 1409 dbSNP
rs1319626389 1412 dbSNP
rs995641183 1422 dbSNP
rs372547867 1435 dbSNP
rs1432316198 1436 dbSNP
rs1163889786 1441 dbSNP
rs544720256 1448 dbSNP
rs1359740082 1451 dbSNP
rs1018019505 1455 dbSNP
rs556681972 1460 dbSNP
rs1007073419 1464 dbSNP
rs1195819695 1466 dbSNP
rs1205489096 1473 dbSNP
rs1447890804 1478 dbSNP
rs1247397231 1483 dbSNP
rs1022609882 1490 dbSNP
rs1013915866 1499 dbSNP
rs1268812488 1508 dbSNP
rs1186785453 1509 dbSNP
rs554941174 1517 dbSNP
rs1424625857 1524 dbSNP
rs1164431980 1527 dbSNP
rs115132762 1529 dbSNP
rs1366924012 1529 dbSNP
rs534104821 1531 dbSNP
rs999419726 1539 dbSNP
rs1214247881 1540 dbSNP
rs80313535 1541 dbSNP
rs1272100679 1551 dbSNP
rs902640569 1557 dbSNP
rs1382802543 1564 dbSNP
rs1394940932 1578 dbSNP
rs1310208251 1581 dbSNP
rs1229361504 1586 dbSNP
rs1337137627 1589 dbSNP
rs554995894 1601 dbSNP
rs536537471 1602 dbSNP
rs946773357 1607 dbSNP
rs1327020757 1608 dbSNP
rs1403009675 1613 dbSNP
rs1205418539 1615 dbSNP
rs900579372 1615 dbSNP
rs1265082569 1622 dbSNP
rs1483654829 1622 dbSNP
rs1181333515 1624 dbSNP
rs1366945931 1625 dbSNP
rs769869713 1627 dbSNP
rs937436172 1628 dbSNP
rs1416974321 1638 dbSNP
rs745737906 1641 dbSNP
rs555666131 1642 dbSNP
rs928631470 1646 dbSNP
rs944720364 1648 dbSNP
rs1475985374 1650 dbSNP
rs1300534229 1653 dbSNP
rs1052228 1664 dbSNP
rs182340257 1666 dbSNP
rs911829728 1667 dbSNP
rs1317022472 1669 dbSNP
rs983355234 1670 dbSNP
rs981413089 1671 dbSNP
rs7643249 1678 dbSNP
rs920405138 1683 dbSNP
rs1283906183 1702 dbSNP
rs538357609 1703 dbSNP
rs757365582 1707 dbSNP
rs1209550782 1719 dbSNP
rs1436096710 1733 dbSNP
rs969824524 1735 dbSNP
rs1206056697 1738 dbSNP
rs1251357038 1740 dbSNP
rs1471847478 1748 dbSNP
rs78109980 1748 dbSNP
rs1196595953 1758 dbSNP
rs115648614 1772 dbSNP
rs1433072614 1779 dbSNP
rs992944051 1781 dbSNP
rs778048804 1782 dbSNP
rs1430003983 1785 dbSNP
rs746180532 1795 dbSNP
rs1368296642 1796 dbSNP
rs959726417 1801 dbSNP
rs753922650 1816 dbSNP
rs1303494972 1819 dbSNP
rs1221649892 1822 dbSNP
rs1217348838 1823 dbSNP
rs1299289986 1834 dbSNP
rs1309408722 1842 dbSNP
rs1347355989 1843 dbSNP
rs546797708 1853 dbSNP
rs779642171 1857 dbSNP
rs1440856234 1864 dbSNP
rs1482178400 1864 dbSNP
rs1352192822 1872 dbSNP
rs999757965 1872 dbSNP
rs902693422 1879 dbSNP
rs753115337 1882 dbSNP
rs1006610028 1885 dbSNP
rs1488445739 1887 dbSNP
rs955318809 1891 dbSNP
rs1264468101 1901 dbSNP
rs1449602100 1908 dbSNP
rs1167384174 1910 dbSNP
rs1029290827 1914 dbSNP
rs1011009559 1918 dbSNP
rs1052229 1922 dbSNP
rs528303468 1933 dbSNP
rs765518433 1942 dbSNP
rs1434026174 1944 dbSNP
rs1174765817 1946 dbSNP
rs1365808613 1949 dbSNP
rs944714296 1955 dbSNP
rs559125781 1956 dbSNP
rs1426506288 1968 dbSNP
rs754292367 1971 dbSNP
rs1291037791 1977 dbSNP
rs542310187 1984 dbSNP
rs1055386673 1988 dbSNP
rs937404885 1996 dbSNP
rs1234658469 1997 dbSNP
rs1244375554 2000 dbSNP
rs929212185 2018 dbSNP
rs767061060 2026 dbSNP
rs928720932 2040 dbSNP
rs1446086812 2041 dbSNP
rs1182858820 2049 dbSNP
rs1461011589 2057 dbSNP
rs973256599 2058 dbSNP
rs1160977531 2061 dbSNP
rs1261449108 2063 dbSNP
rs561121516 2065 dbSNP
rs1319986772 2066 dbSNP
rs75854816 2068 dbSNP
rs530823904 2070 dbSNP
rs761283285 2073 dbSNP
rs992550214 2082 dbSNP
rs918608841 2083 dbSNP
rs974281630 2089 dbSNP
rs1279247164 2091 dbSNP
rs1286727674 2111 dbSNP
rs1330446927 2127 dbSNP
rs1208577147 2130 dbSNP
rs1266776866 2131 dbSNP
rs1046588006 2133 dbSNP
rs562878295 2134 dbSNP
rs911370640 2136 dbSNP
rs1236574606 2138 dbSNP
rs1471581147 2147 dbSNP
rs1178747991 2157 dbSNP
rs986034722 2158 dbSNP
rs1031306597 2163 dbSNP
rs1280755896 2164 dbSNP
rs977478848 2173 dbSNP
rs1472226945 2174 dbSNP
rs1156937305 2176 dbSNP
rs1029409352 2183 dbSNP
rs999300466 2191 dbSNP
rs1416289122 2193 dbSNP
rs752674151 2206 dbSNP
rs1021983698 2207 dbSNP
rs1446018828 2209 dbSNP
rs1010804847 2215 dbSNP
rs1351564770 2216 dbSNP
rs1446830405 2218 dbSNP
rs895060870 2220 dbSNP
rs1022498670 2228 dbSNP
rs1287063837 2230 dbSNP
rs1347721436 2232 dbSNP
rs1200564463 2237 dbSNP
rs1277230031 2262 dbSNP
rs141521101 2268 dbSNP
rs564187801 2270 dbSNP
rs368855313 2272 dbSNP
rs1252083397 2274 dbSNP
rs577436438 2274 dbSNP
rs1179720766 2276 dbSNP
rs1431405334 2281 dbSNP
rs1045773255 2285 dbSNP
rs1360107681 2286 dbSNP
rs1173250197 2293 dbSNP
rs1424465533 2295 dbSNP
rs1412834723 2299 dbSNP
rs1310153696 2301 dbSNP
rs1371377360 2318 dbSNP
rs1409645617 2321 dbSNP
rs1306514096 2329 dbSNP
rs1333352393 2333 dbSNP
rs1159087333 2336 dbSNP
rs1234528692 2336 dbSNP
rs1342345123 2337 dbSNP
rs1008961667 2338 dbSNP
rs1229957263 2343 dbSNP
rs1399439875 2354 dbSNP
rs565263513 2355 dbSNP
rs897131687 2366 dbSNP
rs1047754498 2367 dbSNP
rs941582942 2381 dbSNP
rs1198159222 2385 dbSNP
rs879092285 2417 dbSNP
rs1179368353 2419 dbSNP
rs993888706 2422 dbSNP
rs911471199 2430 dbSNP
rs1391056205 2433 dbSNP
rs189975903 2436 dbSNP
rs187076541 2437 dbSNP
rs183433480 2442 dbSNP
rs372938959 2443 dbSNP
rs1323546980 2466 dbSNP
rs1329832903 2468 dbSNP
rs1297640011 2472 dbSNP
rs1436695856 2472 dbSNP
rs1057297202 2486 dbSNP
rs545390718 2490 dbSNP
rs989561373 2491 dbSNP
rs924337459 2493 dbSNP
rs1209000978 2494 dbSNP
rs1315089401 2494 dbSNP
rs1286200995 2495 dbSNP
rs1034013622 2496 dbSNP
rs1466169719 2501 dbSNP
rs1190617540 2503 dbSNP
rs1003487323 2515 dbSNP
rs977152046 2519 dbSNP
rs1449092448 2523 dbSNP
rs1186977540 2528 dbSNP
rs1370403472 2530 dbSNP
rs1458779267 2539 dbSNP
rs906361614 2540 dbSNP
rs1389243228 2541 dbSNP
rs1009766643 2545 dbSNP
rs1026116017 2546 dbSNP
rs1363914919 2551 dbSNP
rs994186486 2552 dbSNP
rs1314496496 2554 dbSNP
rs1340672607 2559 dbSNP
rs968345149 2560 dbSNP
rs114797201 2561 dbSNP
rs556556682 2562 dbSNP
rs1282165565 2577 dbSNP
rs1380407761 2583 dbSNP
rs1331150792 2584 dbSNP
rs1209203744 2598 dbSNP
rs1267418224 2600 dbSNP
rs1464543383 2607 dbSNP
rs1038298672 2613 dbSNP
rs1288620587 2615 dbSNP
rs1429005999 2616 dbSNP
rs556522021 2617 dbSNP
rs879010324 2633 dbSNP
rs1416061780 2634 dbSNP
rs745826003 2635 dbSNP
rs1159719817 2638 dbSNP
rs1424104059 2641 dbSNP
rs1388519825 2642 dbSNP
rs1455227265 2652 dbSNP
rs1304042015 2656 dbSNP
rs572875461 2675 dbSNP
rs1402502939 2684 dbSNP
rs964868589 2685 dbSNP
rs538222424 2689 dbSNP
rs1331952509 2699 dbSNP
rs1352171239 2699 dbSNP
rs115067420 2700 dbSNP
rs934274186 2706 dbSNP
rs1424585222 2714 dbSNP
rs1237011185 2716 dbSNP
rs771199263 2717 dbSNP
rs1419025610 2723 dbSNP
rs1185740178 2725 dbSNP
rs1009469210 2732 dbSNP
rs954841348 2735 dbSNP
rs1484269798 2737 dbSNP
rs1026813879 2743 dbSNP
rs978259176 2760 dbSNP
rs1417803820 2771 dbSNP
rs1177624600 2783 dbSNP
rs993532224 2788 dbSNP
rs1300772225 2794 dbSNP
rs543431288 2797 dbSNP
rs1410250246 2802 dbSNP
rs781624697 2803 dbSNP
rs1348578955 2807 dbSNP
rs914987643 2808 dbSNP
rs1490061187 2823 dbSNP
rs759315792 2824 dbSNP
rs989285996 2830 dbSNP
rs959281635 2834 dbSNP
rs899131976 2836 dbSNP
rs1037639649 2848 dbSNP
rs1206345623 2849 dbSNP
rs1251477688 2850 dbSNP
rs982406335 2857 dbSNP
rs1193491317 2860 dbSNP
rs1012809668 2862 dbSNP
rs143348350 2867 dbSNP
rs865793956 2875 dbSNP
rs112305365 2877 dbSNP
rs1429937770 2882 dbSNP
rs149628539 2889 dbSNP
rs549158171 2901 dbSNP
rs1352615781 2902 dbSNP
rs879161 2903 dbSNP
rs1294093530 2918 dbSNP
rs1299412735 2937 dbSNP
rs569937625 2943 dbSNP
rs1404861604 2951 dbSNP
rs1005657160 2953 dbSNP
rs1363835710 2954 dbSNP
rs1367641142 2955 dbSNP
rs1305067331 2960 dbSNP
rs138339914 2961 dbSNP
rs889757157 2964 dbSNP
rs1049771118 2976 dbSNP
rs1224203671 2981 dbSNP
rs1266584274 2990 dbSNP
rs777652731 2994 dbSNP
rs1191230380 2995 dbSNP
rs532432756 2998 dbSNP
rs1449701964 3007 dbSNP
rs989705701 3012 dbSNP
rs1416922911 3019 dbSNP
rs1168524771 3024 dbSNP
rs1406917699 3026 dbSNP
rs1165168988 3027 dbSNP
rs542696998 3031 dbSNP
rs1425493649 3034 dbSNP
rs1391003713 3035 dbSNP
rs910779478 3038 dbSNP
rs945527757 3039 dbSNP
rs866573166 3046 dbSNP
rs1194367737 3050 dbSNP
rs915437659 3056 dbSNP
rs1230417970 3057 dbSNP
rs1313819285 3064 dbSNP
rs1321656802 3065 dbSNP
rs772339228 3067 dbSNP
rs1266632812 3072 dbSNP
rs1270562138 3077 dbSNP
rs955037508 3087 dbSNP
rs1211131709 3097 dbSNP
rs1026407644 3098 dbSNP
rs1053934677 3101 dbSNP
rs1473549103 3102 dbSNP
rs972104739 3105 dbSNP
rs937787383 3112 dbSNP
rs1488486543 3118 dbSNP
rs1474102406 3122 dbSNP
rs1161352201 3126 dbSNP
rs779270467 3127 dbSNP
rs963384198 3130 dbSNP
rs1412589062 3142 dbSNP
rs1457869347 3143 dbSNP
rs926257258 3146 dbSNP
rs538969723 3151 dbSNP
rs1450396420 3169 dbSNP
rs1012903931 3177 dbSNP
rs565271088 3179 dbSNP
rs894431780 3185 dbSNP
rs1036006728 3196 dbSNP
rs1290798203 3204 dbSNP
rs919168503 3210 dbSNP
rs971993759 3219 dbSNP
rs540415715 3223 dbSNP
rs1210474303 3227 dbSNP
rs9867966 3239 dbSNP
rs1236518024 3241 dbSNP
rs1484594119 3242 dbSNP
rs765972728 3248 dbSNP
rs747297133 3249 dbSNP
rs867446167 3250 dbSNP
rs1184041037 3251 dbSNP
rs145621340 3252 dbSNP
rs561157561 3273 dbSNP
rs1041464650 3293 dbSNP
rs1158080810 3297 dbSNP
rs947110494 3302 dbSNP
rs892876541 3316 dbSNP
rs1006027238 3318 dbSNP
rs1039370600 3321 dbSNP
rs777799084 3334 dbSNP
rs1285679708 3337 dbSNP
rs1387434818 3342 dbSNP
rs954158578 3344 dbSNP
rs1395864076 3353 dbSNP
rs1296727463 3355 dbSNP
rs186990670 3361 dbSNP
rs1442033925 3363 dbSNP
rs1278295275 3373 dbSNP
rs1463704611 3378 dbSNP
rs1346584315 3391 dbSNP
rs942367958 3395 dbSNP
rs910839400 3405 dbSNP
rs998181621 3415 dbSNP
rs1402238025 3417 dbSNP
rs1207059222 3420 dbSNP
rs1252199543 3432 dbSNP
rs575556356 3438 dbSNP
rs1171160396 3444 dbSNP
rs1179658101 3445 dbSNP
rs1469051374 3452 dbSNP
rs988095708 3454 dbSNP
rs933507113 3457 dbSNP
rs919390605 3458 dbSNP
rs972212570 3460 dbSNP
rs1291173956 3469 dbSNP
rs1170885958 3471 dbSNP
rs1371634226 3477 dbSNP
rs1042646408 3482 dbSNP
rs1327496284 3482 dbSNP
rs963479995 3486 dbSNP
rs797007074 3487 dbSNP
rs1436608254 3488 dbSNP
rs1009854021 3491 dbSNP
rs1016354559 3493 dbSNP
rs754384404 3496 dbSNP
rs893935429 3502 dbSNP
rs1175167760 3503 dbSNP
rs1274905200 3505 dbSNP
rs1458839584 3505 dbSNP
rs1338570159 3520 dbSNP
rs762613134 3524 dbSNP
rs1258252294 3526 dbSNP
rs991519203 3526 dbSNP
rs780536153 3527 dbSNP
rs1035613632 3531 dbSNP
rs36120483 3539 dbSNP
rs1199693399 3545 dbSNP
rs937716096 3550 dbSNP
rs1234591474 3558 dbSNP
rs557262817 3569 dbSNP
rs181995760 3572 dbSNP
rs1304926879 3575 dbSNP
rs577608161 3578 dbSNP
rs1391000122 3595 dbSNP
rs190956208 3611 dbSNP
rs140548986 3618 dbSNP
rs1166472243 3627 dbSNP
rs146814410 3640 dbSNP
rs1324638630 3643 dbSNP
rs903031202 3651 dbSNP
rs1391730936 3655 dbSNP
rs1020104853 3659 dbSNP
rs1011348005 3666 dbSNP
rs892929656 3679 dbSNP
rs747674240 3689 dbSNP
rs555622313 3692 dbSNP
rs537270961 3694 dbSNP
rs963283576 3698 dbSNP
rs1356970867 3699 dbSNP
rs909000955 3701 dbSNP
rs569850169 3702 dbSNP
rs567790390 3705 dbSNP
rs1052042732 3706 dbSNP
rs1156347014 3712 dbSNP
rs776009877 3721 dbSNP
rs965359555 3731 dbSNP
rs919490099 3734 dbSNP
rs1020982169 3748 dbSNP
rs1370495839 3753 dbSNP
rs1473326744 3758 dbSNP
rs1164901796 3763 dbSNP
rs1036571661 3764 dbSNP
rs1460309027 3775 dbSNP
rs1320583063 3784 dbSNP
rs1383810267 3786 dbSNP
rs762701676 3787 dbSNP
rs1335779461 3794 dbSNP
rs1340906102 3800 dbSNP
rs550818217 3814 dbSNP
rs1291411604 3817 dbSNP
rs533250006 3818 dbSNP
rs1230325245 3821 dbSNP
rs1032887158 3831 dbSNP
rs1350231291 3833 dbSNP
rs1350624183 3845 dbSNP
rs958750168 3848 dbSNP
rs928596588 3854 dbSNP
rs905398133 3860 dbSNP
rs1256052994 3867 dbSNP
rs1473825131 3873 dbSNP
rs1159204864 3874 dbSNP
rs1362783416 3879 dbSNP
rs981453823 3892 dbSNP
rs1174021102 3899 dbSNP
rs1402436117 3909 dbSNP
rs1046112358 3921 dbSNP
rs1242421115 3937 dbSNP
rs1354414487 3940 dbSNP
rs1310793195 3951 dbSNP
rs1352266755 3952 dbSNP
rs1410287067 3957 dbSNP
rs571552364 3962 dbSNP
rs145077151 3963 dbSNP
rs967725182 3964 dbSNP
rs1306196003 3968 dbSNP
rs1316471864 3970 dbSNP
rs573925028 3972 dbSNP
rs888507 3979 dbSNP
rs1348810049 3984 dbSNP
rs1450703420 3993 dbSNP
rs186411187 3994 dbSNP
rs542692786 3996 dbSNP
rs1335903001 4000 dbSNP
rs1250409929 4003 dbSNP
rs1416836133 4010 dbSNP
rs1200327933 4013 dbSNP
rs1395327581 4021 dbSNP
rs571560625 4036 dbSNP
rs535480212 4039 dbSNP
rs1171526142 4046 dbSNP
rs957168452 4051 dbSNP
rs1286980943 4055 dbSNP
rs1430149706 4057 dbSNP
rs1297588580 4058 dbSNP
rs909125073 4068 dbSNP
rs551604689 4073 dbSNP
rs931817881 4078 dbSNP
rs1303428045 4084 dbSNP
rs531043654 4091 dbSNP
rs1442364755 4092 dbSNP
rs890865759 4095 dbSNP
rs976805532 4098 dbSNP
rs1051224681 4107 dbSNP
rs1344821721 4115 dbSNP
rs867183556 4116 dbSNP
rs1020926559 4120 dbSNP
rs1479919366 4122 dbSNP
rs528416266 4131 dbSNP
rs1211121381 4135 dbSNP
rs1253003989 4144 dbSNP
rs1453260216 4145 dbSNP
rs114663026 4147 dbSNP
rs898113677 4152 dbSNP
rs1036579856 4154 dbSNP
rs942176799 4156 dbSNP
rs958310921 4164 dbSNP
rs1428940993 4176 dbSNP
rs1169433925 4194 dbSNP
rs1032592165 4198 dbSNP
rs1459319564 4206 dbSNP
rs1446720581 4210 dbSNP
rs1395389511 4212 dbSNP
rs1440238199 4214 dbSNP
rs1301580128 4215 dbSNP
rs545426288 4219 dbSNP
rs1367574422 4226 dbSNP
rs909354971 4239 dbSNP
rs776764028 4246 dbSNP
rs1219423417 4248 dbSNP
rs771001180 4255 dbSNP
rs1055895651 4260 dbSNP
rs1025110729 4261 dbSNP
rs1291102095 4261 dbSNP
rs566884157 4276 dbSNP
rs937452644 4288 dbSNP
rs1358777576 4289 dbSNP
rs1485962534 4290 dbSNP
rs897588541 4306 dbSNP
rs1245253614 4313 dbSNP
rs1425323424 4314 dbSNP
rs1325638092 4322 dbSNP
rs180767721 4334 dbSNP
rs752792789 4335 dbSNP
rs941703039 4337 dbSNP
rs981890950 4338 dbSNP
rs1401746021 4340 dbSNP
rs868174351 4351 dbSNP
rs1050355226 4353 dbSNP
rs1360656962 4359 dbSNP
rs760458915 4362 dbSNP
rs1422157640 4365 dbSNP
rs923078619 4366 dbSNP
rs1230946062 4373 dbSNP
rs975913853 4376 dbSNP
rs1316983210 4381 dbSNP
rs1163409094 4393 dbSNP
rs944068849 4398 dbSNP
rs913159876 4414 dbSNP
rs1475328924 4415 dbSNP
rs1371686213 4417 dbSNP
rs1239983590 4423 dbSNP
rs1484136728 4428 dbSNP
rs559100067 4431 dbSNP
rs1256749358 4432 dbSNP
rs989986656 4441 dbSNP
rs1162878985 4442 dbSNP
rs140995204 4464 dbSNP
rs1268748967 4466 dbSNP
rs1401342267 4468 dbSNP
rs1158713227 4470 dbSNP
rs958045098 4471 dbSNP
rs1220370459 4472 dbSNP
rs117453460 4477 dbSNP
rs372776894 4477 dbSNP
rs925303680 4477 dbSNP
rs1281769867 4483 dbSNP
rs555534765 4484 dbSNP
rs1373488846 4488 dbSNP
rs188332397 4491 dbSNP
rs1222674050 4500 dbSNP
rs1025065990 4501 dbSNP
rs1013698908 4508 dbSNP
rs1006705003 4510 dbSNP
rs771995466 4514 dbSNP
rs955338566 4515 dbSNP
rs1484567469 4516 dbSNP
rs1195431668 4519 dbSNP
rs1029406293 4532 dbSNP
rs1233366839 4534 dbSNP
rs1449514207 4541 dbSNP
rs1470577912 4541 dbSNP
rs1014610600 4544 dbSNP
rs994246764 4546 dbSNP
rs1436756644 4553 dbSNP
rs896782900 4555 dbSNP
rs1036631903 4556 dbSNP
rs1174492788 4558 dbSNP
rs887423680 4560 dbSNP
rs748450071 4561 dbSNP
rs1006448646 4576 dbSNP
rs369962249 4582 dbSNP
rs1331506583 4586 dbSNP
rs1355581046 4587 dbSNP
rs1440864140 4589 dbSNP
rs1341082215 4598 dbSNP
rs1282490553 4604 dbSNP
rs1372726495 4609 dbSNP
rs1234661632 4614 dbSNP
rs1302226707 4627 dbSNP
rs576348788 4633 dbSNP
rs754945135 4635 dbSNP
rs1197303729 4662 dbSNP
rs1332313188 4666 dbSNP
rs1323867961 4668 dbSNP
rs1408987492 4671 dbSNP
rs183950394 4675 dbSNP
rs1437114166 4681 dbSNP
rs867178291 4682 dbSNP
rs996066917 4692 dbSNP
rs1398607980 4706 dbSNP
rs901767073 4708 dbSNP
rs1466423227 4709 dbSNP
rs1394670150 4712 dbSNP
rs539359908 4715 dbSNP
rs1169956962 4716 dbSNP
rs1429206551 4718 dbSNP
rs181401799 4719 dbSNP
rs1040347050 4729 dbSNP
rs1440981658 4741 dbSNP
rs1324853857 4755 dbSNP
rs1368288925 4758 dbSNP
rs779073842 4760 dbSNP
rs945858000 4765 dbSNP
rs1479081977 4773 dbSNP
rs868366449 4775 dbSNP
rs1338673306 4776 dbSNP
rs769077624 4777 dbSNP
rs1247345181 4780 dbSNP
rs1181413054 4787 dbSNP
rs1274948546 4807 dbSNP
rs1469908091 4823 dbSNP
rs1052516881 4832 dbSNP
rs1436326394 4840 dbSNP
rs1056392879 4842 dbSNP
rs1467262996 4842 dbSNP
rs1475286344 4848 dbSNP
rs151182606 4864 dbSNP
rs925283597 4873 dbSNP
rs189804287 4877 dbSNP
rs185359872 4884 dbSNP
rs549107549 4895 dbSNP
rs201079482 4901 dbSNP
rs745441797 4901 dbSNP
rs1383491088 4903 dbSNP
rs1318562866 4910 dbSNP
rs918166898 4914 dbSNP
rs992394994 4917 dbSNP
rs1295085426 4919 dbSNP
rs1335339150 4919 dbSNP
rs1346567559 4923 dbSNP
rs1274890142 4926 dbSNP
rs73030634 4927 dbSNP
rs1374225619 4930 dbSNP
rs193028405 4932 dbSNP
rs1005948394 4934 dbSNP
rs1446830739 4945 dbSNP
rs1448069078 4952 dbSNP
rs1260259930 4958 dbSNP
rs1475788728 4967 dbSNP
rs1163589921 4979 dbSNP
rs1405794590 4984 dbSNP
rs990040483 4988 dbSNP
rs551912175 4999 dbSNP
rs935942228 5000 dbSNP
rs911136876 5004 dbSNP
rs571917340 5010 dbSNP
rs1416628691 5011 dbSNP
rs566333245 5016 dbSNP
rs1426442261 5019 dbSNP
rs750859006 5024 dbSNP
rs1437847284 5030 dbSNP
rs777369392 5038 dbSNP
rs1398758989 5039 dbSNP
rs1028621519 5040 dbSNP
rs187825703 5042 dbSNP
rs1291341792 5049 dbSNP
rs142176704 5065 dbSNP
rs1261566552 5066 dbSNP
rs752440055 5068 dbSNP
rs972485885 5077 dbSNP
rs149102294 5082 dbSNP
rs185017758 5087 dbSNP
rs1486201171 5088 dbSNP
rs1016637467 5092 dbSNP
rs7644857 5095 dbSNP
rs1222718405 5101 dbSNP
rs936736071 5104 dbSNP
rs888069486 5105 dbSNP
rs1375895762 5113 dbSNP
rs1311074465 5117 dbSNP
rs1034599281 5121 dbSNP
rs1311038866 5126 dbSNP
rs1398499558 5135 dbSNP
rs534622829 5141 dbSNP
rs1307723476 5142 dbSNP
rs1335403862 5143 dbSNP
rs753687198 5155 dbSNP
rs191398358 5172 dbSNP
rs1450578920 5178 dbSNP
rs1305882196 5193 dbSNP
rs1046255089 5199 dbSNP
rs576164736 5200 dbSNP
rs992342906 5207 dbSNP
rs1418010885 5208 dbSNP
rs1195875730 5209 dbSNP
rs1249284396 5215 dbSNP
rs1456056231 5218 dbSNP
rs1382231248 5220 dbSNP
rs1159526985 5225 dbSNP
rs760403086 5230 dbSNP
rs767421655 5232 dbSNP
rs1411845951 5234 dbSNP
rs1173640524 5237 dbSNP
rs1179921291 5238 dbSNP
rs891870238 5243 dbSNP
rs1462375870 5247 dbSNP
rs1054424468 5248 dbSNP
rs145007180 5249 dbSNP
rs186831958 5251 dbSNP
rs935994359 5257 dbSNP
rs772999438 5265 dbSNP
rs1214968896 5275 dbSNP
rs1328209363 5278 dbSNP
rs1487051550 5280 dbSNP
rs139507123 5281 dbSNP
rs1299560379 5282 dbSNP
rs985369823 5285 dbSNP
rs1216655741 5291 dbSNP
rs1228862074 5291 dbSNP
rs985352995 5294 dbSNP
rs933836936 5295 dbSNP
rs1029155476 5296 dbSNP
rs974512753 5302 dbSNP
rs1230397764 5305 dbSNP
rs922431340 5312 dbSNP
rs1189257806 5314 dbSNP
rs7426575 5315 dbSNP
rs1018634535 5316 dbSNP
rs1380339408 5318 dbSNP
rs1169713053 5319 dbSNP
rs1421353892 5320 dbSNP
rs750143983 5324 dbSNP
rs1270183839 5326 dbSNP
rs972547648 5327 dbSNP
rs961139332 5328 dbSNP
rs1016691525 5334 dbSNP
rs1395497217 5335 dbSNP
rs983823288 5341 dbSNP
rs958993031 5371 dbSNP
rs550689628 5373 dbSNP
rs1364580147 5376 dbSNP
rs891719450 5396 dbSNP
rs1298913180 5404 dbSNP
rs1316547091 5405 dbSNP
rs772231044 5406 dbSNP
rs1035020208 5409 dbSNP
rs1273197212 5410 dbSNP
rs1348370960 5411 dbSNP
rs1167098205 5413 dbSNP
rs1333519067 5413 dbSNP
rs1219006691 5415 dbSNP
rs182796351 5416 dbSNP
rs1000434745 5417 dbSNP
rs1414224739 5417 dbSNP
rs1192907724 5419 dbSNP
rs1476819313 5420 dbSNP
rs907379973 5426 dbSNP
rs1476107628 5430 dbSNP
rs1045543847 5431 dbSNP
rs948154846 5433 dbSNP
rs1216726347 5435 dbSNP
rs535376691 5439 dbSNP
rs372582601 5443 dbSNP
rs72442510 5444 dbSNP
rs771498889 5444 dbSNP
rs1263375443 5451 dbSNP
rs1347140507 5451 dbSNP
rs1297915496 5452 dbSNP
rs62293458 5458 dbSNP
rs62293457 5459 dbSNP
rs201817756 5460 dbSNP
rs537159593 5460 dbSNP
rs538588478 5460 dbSNP
rs1217138438 5475 dbSNP
rs1226088021 5477 dbSNP
rs1285949628 5487 dbSNP
rs891913026 5496 dbSNP
rs1342960205 5498 dbSNP
rs147376823 5501 dbSNP
rs7434028 5525 dbSNP
rs908110065 5526 dbSNP
rs1486520407 5528 dbSNP
rs1365562857 5535 dbSNP
rs766136125 5536 dbSNP
rs930787422 5539 dbSNP
rs889770482 5540 dbSNP
rs369074755 5541 dbSNP
rs149682755 5546 dbSNP
rs1180144175 5550 dbSNP
rs1410459795 5551 dbSNP
rs183602546 5560 dbSNP
rs933952307 5568 dbSNP
rs922491487 5570 dbSNP
rs1158273386 5579 dbSNP
rs1359093994 5580 dbSNP
rs1436948266 5586 dbSNP
rs1314065829 5603 dbSNP
rs965803087 5608 dbSNP
rs1445191688 5612 dbSNP
rs1463816147 5613 dbSNP
rs1036906822 5617 dbSNP
rs1018582371 5619 dbSNP
rs1425700638 5620 dbSNP
rs566129386 5621 dbSNP
rs1349832705 5624 dbSNP
rs548115476 5637 dbSNP
rs1194301118 5644 dbSNP
rs988469041 5648 dbSNP
rs939829110 5665 dbSNP
rs190611964 5669 dbSNP
rs1234745528 5671 dbSNP
rs983833179 5677 dbSNP
rs573615493 5683 dbSNP
rs1033325751 5696 dbSNP
rs1192604766 5698 dbSNP
rs1178312563 5699 dbSNP
rs1378665930 5705 dbSNP
rs73030630 5709 dbSNP
rs1237136474 5710 dbSNP
rs1174604373 5713 dbSNP
rs1425086231 5717 dbSNP
rs1197158708 5721 dbSNP
rs116444422 5728 dbSNP
rs186249012 5736 dbSNP
rs1012249469 5737 dbSNP
rs1328908089 5750 dbSNP
rs200597800 5750 dbSNP
rs971698157 5755 dbSNP
rs564236410 5758 dbSNP
rs199817097 5765 dbSNP
rs201142441 5766 dbSNP
rs1342611983 5771 dbSNP
rs1303541557 5786 dbSNP
rs749446290 5792 dbSNP
rs1318745408 5810 dbSNP
rs1010366725 5812 dbSNP
rs1198048407 5834 dbSNP
rs1236607766 5845 dbSNP
rs940690906 5851 dbSNP
rs886463795 5857 dbSNP
rs376070175 5860 dbSNP
rs536814748 5873 dbSNP
rs1170185049 5892 dbSNP
rs1420792596 5899 dbSNP
rs1464666217 5900 dbSNP
rs1167841753 5904 dbSNP
rs1000208309 5910 dbSNP
rs922069340 5917 dbSNP
rs1402176276 5921 dbSNP
rs1322462700 5938 dbSNP
rs889854185 5947 dbSNP
rs1171353931 5949 dbSNP
rs1465454025 5954 dbSNP
rs1039222107 5955 dbSNP
rs1339702804 5958 dbSNP
rs1218108898 5962 dbSNP
rs1049775264 5963 dbSNP
rs1256311042 5964 dbSNP
rs1375818233 5977 dbSNP
rs1210714584 5979 dbSNP
rs1289389221 5980 dbSNP
rs577120742 5981 dbSNP
rs1195714584 5984 dbSNP
rs1243210123 5987 dbSNP
rs1192125246 5995 dbSNP
rs1477744174 5995 dbSNP
rs1419468480 6003 dbSNP
rs998589635 6010 dbSNP
rs1162326337 6024 dbSNP
rs1388082418 6025 dbSNP
rs770009928 6029 dbSNP
rs911642513 6030 dbSNP
rs201243637 6037 dbSNP
rs546534965 6039 dbSNP
rs1176391258 6041 dbSNP
rs925655733 6057 dbSNP
rs1357491539 6070 dbSNP
rs1245557621 6077 dbSNP
rs1283839945 6091 dbSNP
rs1354435794 6092 dbSNP
rs939838960 6095 dbSNP
rs574352286 6109 dbSNP
rs909693665 6116 dbSNP
rs979065044 6130 dbSNP
rs781523410 6140 dbSNP
rs1048188373 6141 dbSNP
rs1215152030 6148 dbSNP
rs1260196092 6152 dbSNP
rs1423922363 6157 dbSNP
rs1022722401 6158 dbSNP
rs1366368725 6160 dbSNP
rs757982059 6168 dbSNP
rs1158772213 6169 dbSNP
rs1014037044 6171 dbSNP
rs370159752 6171 dbSNP
rs959901909 6186 dbSNP
rs1314685753 6187 dbSNP
rs555358393 6188 dbSNP
rs1375934491 6190 dbSNP
rs1035046934 6196 dbSNP
rs937805745 6198 dbSNP
rs1200198807 6203 dbSNP
rs1482576484 6204 dbSNP
rs1338774037 6216 dbSNP
rs1258228593 6228 dbSNP
rs1241521312 6238 dbSNP
rs1310241812 6247 dbSNP
rs747672736 6262 dbSNP
rs926348995 6271 dbSNP
rs1234066836 6281 dbSNP
rs1283114690 6287 dbSNP
rs1483832586 6288 dbSNP
rs1199395506 6289 dbSNP
rs1253534307 6295 dbSNP
rs981833156 6306 dbSNP
rs1004995692 6307 dbSNP
rs1178908260 6308 dbSNP
rs1307426128 6314 dbSNP
rs747209409 6318 dbSNP
rs970763559 6326 dbSNP
rs1378883316 6339 dbSNP
rs183421517 6341 dbSNP
rs900761551 6350 dbSNP
rs565644522 6355 dbSNP
rs557386925 6367 dbSNP
rs944838000 6369 dbSNP
rs1393185691 6372 dbSNP
rs1399995804 6378 dbSNP
rs1235727252 6379 dbSNP
rs778494912 6383 dbSNP
rs956220459 6387 dbSNP
rs139517192 6391 dbSNP
rs1466163135 6405 dbSNP
rs754704861 6410 dbSNP
rs1313147275 6429 dbSNP
rs549131786 6441 dbSNP
rs1052827137 6443 dbSNP
rs1441196262 6445 dbSNP
rs1237195303 6448 dbSNP
rs1380477556 6451 dbSNP
rs1195105128 6460 dbSNP
rs1187297874 6465 dbSNP
rs1422360776 6467 dbSNP
rs934447256 6467 dbSNP
rs1258958495 6470 dbSNP
rs1374688690 6482 dbSNP
rs528972947 6482 dbSNP
rs1488034720 6486 dbSNP
rs753491919 6487 dbSNP
rs150659998 6488 dbSNP
rs1464325861 6492 dbSNP
rs1328143502 6496 dbSNP
rs1368795643 6499 dbSNP
rs1386522819 6506 dbSNP
rs114104650 6511 dbSNP
rs189552873 6512 dbSNP
rs547633713 6513 dbSNP
rs970164094 6519 dbSNP
rs1218709631 6526 dbSNP
rs915824193 6531 dbSNP
rs1315513775 6537 dbSNP
rs901135402 6538 dbSNP
rs1215232095 6549 dbSNP
rs1015538679 6559 dbSNP
rs571611856 6560 dbSNP
rs1314838603 6569 dbSNP
rs1263781609 6572 dbSNP
rs888354436 6574 dbSNP
rs1015392197 6576 dbSNP
rs1415289868 6579 dbSNP
rs772841922 6581 dbSNP
rs937841780 6582 dbSNP
rs1476863480 6585 dbSNP
rs371752044 6586 dbSNP
rs904947456 6593 dbSNP
rs1360770348 6596 dbSNP
rs1046530025 6599 dbSNP
rs1292076926 6603 dbSNP
rs1162276528 6605 dbSNP
rs949097506 6606 dbSNP
rs1401204032 6609 dbSNP
rs1278101741 6615 dbSNP
rs1472045941 6616 dbSNP
rs1337831918 6626 dbSNP
rs1234550544 6637 dbSNP
rs116341106 6643 dbSNP
rs568740088 6650 dbSNP
rs12492606 6664 dbSNP
rs1219117058 6665 dbSNP
rs531369971 6668 dbSNP
rs1488487785 6671 dbSNP
rs115425044 6686 dbSNP
rs186094772 6697 dbSNP
rs1476894734 6699 dbSNP
rs1183614936 6707 dbSNP
rs1195954171 6711 dbSNP
rs1488621269 6718 dbSNP
rs1289516917 6728 dbSNP
rs1423523126 6729 dbSNP
rs1009167451 6732 dbSNP
rs954321763 6733 dbSNP
rs1354055260 6734 dbSNP
rs527352079 6735 dbSNP
rs761682034 6736 dbSNP
rs977218892 6740 dbSNP
rs1053295218 6744 dbSNP
rs1293458414 6755 dbSNP
rs1298157185 6767 dbSNP
rs774419094 6770 dbSNP
rs1233622946 6771 dbSNP
rs1449608671 6783 dbSNP
rs1302851039 6794 dbSNP
rs1377803227 6807 dbSNP
rs1339774214 6812 dbSNP
rs575914983 6813 dbSNP
rs764120584 6820 dbSNP
rs1401378330 6824 dbSNP
rs560306520 6826 dbSNP
rs541592368 6827 dbSNP
rs1239097449 6832 dbSNP
rs1283814822 6837 dbSNP
rs1015633867 6843 dbSNP
rs1229601651 6852 dbSNP
rs1486573514 6863 dbSNP
rs114753300 6866 dbSNP
rs759417360 6872 dbSNP
rs1238179240 6874 dbSNP
rs1322529313 6875 dbSNP
rs888405314 6878 dbSNP
rs915604879 6882 dbSNP
rs1164225020 6885 dbSNP
rs1027281972 6890 dbSNP
rs1465380211 6892 dbSNP
rs10936611 6904 dbSNP
rs904999177 6910 dbSNP
rs1177412596 6914 dbSNP
rs1358123261 6916 dbSNP