miRTarBase - #MIRT542982 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ERC1   
Synonyms Cast2, ELKS, ERC-1, RAB6IP2
Description ELKS/RAB6-interacting/CAST family member 1
Transcript NM_178039   
Other Transcripts NM_178040   
Putative miRNA Targets on ERC1
3'UTR of ERC1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
miRNA  3' guuugugguaaCAGUGUGAGGu 5'
                     | |||||||| 
Target 5' gctatggggcaGCCACACTCCc 3'
4638 - 4659 147.00 -13.10
            ||| | | |||| |||||| 
2603 - 2623 139.00 -16.80
            :| |:|: ||||   :|||||| 
3254 - 3277 139.00 -18.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30109033 6 COSMIC
COSN30514761 14 COSMIC
COSN30137200 31 COSMIC
COSN30145715 51 COSMIC
COSN30150926 76 COSMIC
COSN31526994 131 COSMIC
COSN30103633 142 COSMIC
COSN30543405 148 COSMIC
COSN31586241 166 COSMIC
COSN22300407 310 COSMIC
COSN1564988 638 COSMIC
COSN31959580 686 COSMIC
COSN24769542 835 COSMIC
COSN28065189 1294 COSMIC
COSN20109051 1371 COSMIC
COSN17038035 1384 COSMIC
COSN22252936 1593 COSMIC
COSN8703124 2011 COSMIC
COSN5936831 2479 COSMIC
COSN7319595 2542 COSMIC
COSN23891701 3194 COSMIC
COSN20109055 3418 COSMIC
COSN25094794 3494 COSMIC
COSN1564995 3964 COSMIC
COSN10102188 4050 COSMIC
COSN7319599 4147 COSMIC
COSN16032760 4600 COSMIC
COSN8703134 5293 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs139259435 3 dbSNP
rs760419095 8 dbSNP
rs1467191819 11 dbSNP
rs1003651501 12 dbSNP
rs562582186 13 dbSNP
rs1403836551 14 dbSNP
rs761224968 20 dbSNP
rs1321576224 25 dbSNP
rs764662236 26 dbSNP
rs750374563 37 dbSNP
rs532918833 42 dbSNP
rs1173446165 43 dbSNP
rs754454663 44 dbSNP
rs1460476114 53 dbSNP
rs1285250748 57 dbSNP
rs1224095002 59 dbSNP
rs1339799574 60 dbSNP
rs932661629 63 dbSNP
rs892598764 69 dbSNP
rs866579163 73 dbSNP
rs1432649799 75 dbSNP
rs1050759026 80 dbSNP
rs1345493963 87 dbSNP
rs1333168580 91 dbSNP
rs890412024 95 dbSNP
rs544979308 96 dbSNP
rs1430852305 108 dbSNP
rs559937924 114 dbSNP
rs1477186012 119 dbSNP
rs1423570016 121 dbSNP
rs1036155864 132 dbSNP
rs1185221467 136 dbSNP
rs1487093673 144 dbSNP
rs138893117 147 dbSNP
rs537486726 148 dbSNP
rs1460127567 163 dbSNP
rs994515824 165 dbSNP
rs1265190852 179 dbSNP
rs975041590 198 dbSNP
rs1027386508 200 dbSNP
rs1029324438 201 dbSNP
rs894133818 223 dbSNP
rs547325168 232 dbSNP
rs955107912 236 dbSNP
rs1012572868 237 dbSNP
rs982968541 238 dbSNP
rs1283357137 241 dbSNP
rs1450060555 243 dbSNP
rs908301432 255 dbSNP
rs1337810734 257 dbSNP
rs1024977426 267 dbSNP
rs1352256626 277 dbSNP
rs1394847631 278 dbSNP
rs1430790849 283 dbSNP
rs941169501 284 dbSNP
rs971634303 287 dbSNP
rs1220566255 295 dbSNP
rs1443115527 301 dbSNP
rs11837825 303 dbSNP
rs1204470736 308 dbSNP
rs948654278 309 dbSNP
rs1045067338 312 dbSNP
rs1204053062 318 dbSNP
rs1206594835 323 dbSNP
rs1307971687 327 dbSNP
rs906560664 337 dbSNP
rs529531128 347 dbSNP
rs957545080 353 dbSNP
rs990213983 357 dbSNP
rs892553480 358 dbSNP
rs376803249 371 dbSNP
rs1482223425 372 dbSNP
rs369682789 376 dbSNP
rs7305100 378 dbSNP
rs1299356422 380 dbSNP
rs1262383512 387 dbSNP
rs986858584 388 dbSNP
rs900091756 393 dbSNP
rs1163447311 397 dbSNP
rs912554006 403 dbSNP
rs748087574 410 dbSNP
rs149392771 411 dbSNP
rs982488901 414 dbSNP
rs539590926 415 dbSNP
rs758478423 425 dbSNP
rs962501793 432 dbSNP
rs1048791004 440 dbSNP
rs558131089 443 dbSNP
rs1220152814 446 dbSNP
rs566531581 447 dbSNP
rs894271067 450 dbSNP
rs1464883354 456 dbSNP
rs1013085581 458 dbSNP
rs1292202997 464 dbSNP
rs1302725647 475 dbSNP
rs1045370154 481 dbSNP
rs906877764 486 dbSNP
rs999094260 490 dbSNP
rs1032362031 493 dbSNP
rs957512652 495 dbSNP
rs1391480738 500 dbSNP
rs981326709 500 dbSNP
rs928553727 501 dbSNP
rs1403619647 502 dbSNP
rs1367900396 503 dbSNP
rs144741184 504 dbSNP
rs1453445209 505 dbSNP
rs1028408112 506 dbSNP
rs954069382 508 dbSNP
rs1161481102 514 dbSNP
rs1268253310 521 dbSNP
rs549594505 522 dbSNP
rs912534539 523 dbSNP
rs1269465259 524 dbSNP
rs548787545 525 dbSNP
rs961692414 527 dbSNP
rs1484739418 536 dbSNP
rs971994321 539 dbSNP
rs138366367 543 dbSNP
rs11061780 545 dbSNP
rs1311160626 560 dbSNP
rs930477975 565 dbSNP
rs900040857 568 dbSNP
rs996984357 569 dbSNP
rs746850937 577 dbSNP
rs73601987 578 dbSNP
rs1490401596 580 dbSNP
rs1290914756 581 dbSNP
rs1454482366 584 dbSNP
rs948470124 585 dbSNP
rs1428730560 588 dbSNP
rs1004254511 593 dbSNP
rs116475124 594 dbSNP
rs577663884 601 dbSNP
rs1431743588 605 dbSNP
rs1192293281 614 dbSNP
rs1426583581 618 dbSNP
rs749323199 619 dbSNP
rs998955850 626 dbSNP
rs868847560 649 dbSNP
rs866044691 650 dbSNP
rs1460578613 652 dbSNP
rs1422125431 655 dbSNP
rs1053356494 660 dbSNP
rs117418530 662 dbSNP
rs78680208 663 dbSNP
rs1028458909 675 dbSNP
rs1227338152 676 dbSNP
rs1325098905 678 dbSNP
rs1295459178 682 dbSNP
rs1383086319 684 dbSNP
rs954365695 686 dbSNP
rs768567950 687 dbSNP
rs1307533120 690 dbSNP
rs1008287933 694 dbSNP
rs1470998244 705 dbSNP
rs73037322 706 dbSNP
rs956016005 709 dbSNP
rs961396096 716 dbSNP
rs1374627755 721 dbSNP
rs1193675746 722 dbSNP
rs1359470110 731 dbSNP
rs773538809 746 dbSNP
rs147240624 751 dbSNP
rs776768179 752 dbSNP
rs1487991526 755 dbSNP
rs79833769 765 dbSNP
rs1271654717 769 dbSNP
rs1195770842 773 dbSNP
rs921368230 779 dbSNP
rs1229615538 780 dbSNP
rs915722759 781 dbSNP
rs1382403743 783 dbSNP
rs753450219 788 dbSNP
rs1239222138 790 dbSNP
rs1313270409 798 dbSNP
rs1454766286 802 dbSNP
rs932784648 804 dbSNP
rs764845688 813 dbSNP
rs948584089 818 dbSNP
rs981201240 825 dbSNP
rs562343814 834 dbSNP
rs928406116 835 dbSNP
rs11610729 836 dbSNP
rs551146918 837 dbSNP
rs1167009144 841 dbSNP
rs1444832574 842 dbSNP
rs569399524 846 dbSNP
rs762466621 850 dbSNP
rs1037089565 852 dbSNP
rs1438983361 858 dbSNP
rs1457650136 862 dbSNP
rs947588291 864 dbSNP
rs1206489293 882 dbSNP
rs1359241792 886 dbSNP
rs1290010145 888 dbSNP
rs1248499662 889 dbSNP
rs533420866 898 dbSNP
rs1357365171 900 dbSNP
rs551595732 901 dbSNP
rs566495434 903 dbSNP
rs73601993 904 dbSNP
rs889940433 916 dbSNP
rs1444331690 917 dbSNP
rs559729414 918 dbSNP
rs1019695008 919 dbSNP
rs567213863 921 dbSNP
rs115867115 923 dbSNP
rs1026914697 934 dbSNP
rs952733316 935 dbSNP
rs1002698839 942 dbSNP
rs1156378823 946 dbSNP
rs1470914655 950 dbSNP
rs1363858104 951 dbSNP
rs1183593457 959 dbSNP
rs1035568313 964 dbSNP
rs1267337203 965 dbSNP
rs1225219971 969 dbSNP
rs1320719992 995 dbSNP
rs984655002 996 dbSNP
rs1259626467 1003 dbSNP
rs1459334087 1005 dbSNP
rs765952540 1008 dbSNP
rs1222939982 1009 dbSNP
rs1022866606 1012 dbSNP
rs969908048 1018 dbSNP
rs1304817423 1019 dbSNP
rs1436935180 1021 dbSNP
rs1197162141 1025 dbSNP
rs988777741 1040 dbSNP
rs1238035724 1041 dbSNP
rs1402059668 1042 dbSNP
rs1473452741 1049 dbSNP
rs1175131994 1056 dbSNP
rs1021968655 1062 dbSNP
rs981720562 1066 dbSNP
rs979419143 1070 dbSNP
rs1478600674 1072 dbSNP
rs1241879519 1073 dbSNP
rs1213979386 1083 dbSNP
rs111549453 1094 dbSNP
rs1268948953 1098 dbSNP
rs1203125918 1107 dbSNP
rs375796151 1110 dbSNP
rs1171586665 1123 dbSNP
rs1285184093 1123 dbSNP
rs1361068175 1132 dbSNP
rs934370911 1134 dbSNP
rs777876216 1141 dbSNP
rs986908975 1142 dbSNP
rs181324316 1143 dbSNP
rs940193617 1148 dbSNP
rs142217717 1152 dbSNP
rs1330502604 1153 dbSNP
rs1359657724 1154 dbSNP
rs553924013 1160 dbSNP
rs1049990531 1161 dbSNP
rs890074500 1165 dbSNP
rs1248884224 1169 dbSNP
rs1183218342 1170 dbSNP
rs1460080614 1173 dbSNP
rs944307595 1176 dbSNP
rs780264030 1177 dbSNP
rs185592647 1194 dbSNP
rs1218733605 1199 dbSNP
rs1216128466 1200 dbSNP
rs1279637428 1201 dbSNP
rs1002662915 1206 dbSNP
rs542632756 1213 dbSNP
rs1315689936 1222 dbSNP
rs1217181103 1236 dbSNP
rs1384423931 1240 dbSNP
rs1302886669 1241 dbSNP
rs1440768370 1245 dbSNP
rs560907975 1250 dbSNP
rs116289408 1252 dbSNP
rs1010486588 1253 dbSNP
rs1236250766 1272 dbSNP
rs1482932380 1273 dbSNP
rs1021518005 1282 dbSNP
rs888435323 1288 dbSNP
rs1012236130 1294 dbSNP
rs1194480582 1303 dbSNP
rs1245150576 1304 dbSNP
rs150787670 1307 dbSNP
rs1480319155 1308 dbSNP
rs979386525 1315 dbSNP
rs1476996826 1316 dbSNP
rs1028302033 1324 dbSNP
rs563059986 1329 dbSNP
rs1290734981 1330 dbSNP
rs533378262 1332 dbSNP
rs556742682 1335 dbSNP
rs551823956 1337 dbSNP
rs1425657007 1342 dbSNP
rs139156600 1347 dbSNP
rs1312914596 1349 dbSNP
rs1222710284 1359 dbSNP
rs1332057152 1360 dbSNP
rs113427953 1366 dbSNP
rs200780906 1366 dbSNP
rs398116015 1366 dbSNP
rs1412193749 1367 dbSNP
rs1371600232 1368 dbSNP
rs1400011291 1368 dbSNP
rs201455680 1371 dbSNP
rs398116016 1372 dbSNP
rs61912169 1372 dbSNP
rs1035900988 1377 dbSNP
rs866253359 1381 dbSNP
rs1370435632 1382 dbSNP
rs1165669633 1383 dbSNP
rs988539650 1384 dbSNP
rs973325953 1386 dbSNP
rs1184321317 1390 dbSNP
rs1399068019 1405 dbSNP
rs920177027 1416 dbSNP
rs1219991662 1436 dbSNP
rs1490760089 1442 dbSNP
rs768932218 1449 dbSNP
rs1237859389 1451 dbSNP
rs1269951442 1456 dbSNP
rs931576987 1463 dbSNP
rs149924325 1467 dbSNP
rs968372542 1469 dbSNP
rs1351665495 1471 dbSNP
rs1283143904 1472 dbSNP
rs1403500234 1474 dbSNP
rs905561891 1475 dbSNP
rs938334899 1484 dbSNP
rs1056843310 1487 dbSNP
rs1347868853 1489 dbSNP
rs1453297758 1491 dbSNP
rs1343554866 1492 dbSNP
rs1161504527 1495 dbSNP
rs1472931432 1496 dbSNP
rs377208190 1497 dbSNP
rs1217432398 1499 dbSNP
rs985086929 1500 dbSNP
rs910899751 1505 dbSNP
rs1197185128 1509 dbSNP
rs1434745479 1510 dbSNP
rs1267759228 1515 dbSNP
rs891555935 1521 dbSNP
rs1484705655 1532 dbSNP
rs1262068108 1535 dbSNP
rs944260942 1537 dbSNP
rs1265479323 1553 dbSNP
rs567324770 1554 dbSNP
rs754380164 1559 dbSNP
rs1322133899 1564 dbSNP
rs1193156705 1573 dbSNP
rs1263137801 1574 dbSNP
rs1010041119 1580 dbSNP
rs1064125 1583 dbSNP
rs144963601 1584 dbSNP
rs549819846 1585 dbSNP
rs888568962 1589 dbSNP
rs571390794 1590 dbSNP
rs996085774 1594 dbSNP
rs1028877817 1598 dbSNP
rs1467491146 1602 dbSNP
rs1378090025 1603 dbSNP
rs1045436832 1605 dbSNP
rs1426455299 1606 dbSNP
rs906546994 1612 dbSNP
rs1008664921 1614 dbSNP
rs1460537220 1616 dbSNP
rs1019668829 1621 dbSNP
rs4766374 1629 dbSNP
rs1035633491 1630 dbSNP
rs955842507 1632 dbSNP
rs1439038769 1639 dbSNP
rs761046706 1649 dbSNP
rs972907989 1659 dbSNP
rs1021471970 1661 dbSNP
rs1241568729 1663 dbSNP
rs1288811120 1685 dbSNP
rs920130399 1696 dbSNP
rs554040654 1701 dbSNP
rs952933062 1702 dbSNP
rs1334823414 1704 dbSNP
rs968424902 1705 dbSNP
rs985241980 1706 dbSNP
rs980315065 1708 dbSNP
rs139857384 1709 dbSNP
rs938303595 1710 dbSNP
rs1057212719 1719 dbSNP
rs188391240 1721 dbSNP
rs777122936 1722 dbSNP
rs1290786942 1726 dbSNP
rs554559341 1733 dbSNP
rs1240840381 1735 dbSNP
rs977395599 1740 dbSNP
rs1257565512 1747 dbSNP
rs1453597709 1748 dbSNP
rs918874322 1750 dbSNP
rs1229542139 1752 dbSNP
rs930141018 1752 dbSNP
rs1196473382 1753 dbSNP
rs1282582481 1762 dbSNP
rs1048504696 1765 dbSNP
rs1252185840 1768 dbSNP
rs1341141766 1769 dbSNP
rs1328169258 1770 dbSNP
rs575960127 1771 dbSNP
rs1389586067 1772 dbSNP
rs1372227084 1778 dbSNP
rs11829753 1784 dbSNP
rs1423709887 1793 dbSNP
rs1383020619 1794 dbSNP
rs1180374985 1815 dbSNP
rs948110613 1841 dbSNP
rs1362685559 1846 dbSNP
rs1045170279 1862 dbSNP
rs73601998 1864 dbSNP
rs1254529063 1865 dbSNP
rs1206326867 1870 dbSNP
rs1490268996 1879 dbSNP
rs1163396047 1881 dbSNP
rs1392429687 1884 dbSNP
rs995971018 1887 dbSNP
rs1003573529 1890 dbSNP
rs1279007340 1891 dbSNP
rs372970441 1899 dbSNP
rs1050283273 1904 dbSNP
rs1057417477 1910 dbSNP
rs1352281748 1912 dbSNP
rs891679145 1913 dbSNP
rs1321964841 1922 dbSNP
rs1363467843 1923 dbSNP
rs540538913 1933 dbSNP
rs1325170512 1935 dbSNP
rs1405560013 1938 dbSNP
rs1394144279 1939 dbSNP
rs578218270 1942 dbSNP
rs180796373 1943 dbSNP
rs1375343846 1945 dbSNP
rs968561354 1946 dbSNP
rs1183524102 1953 dbSNP
rs1020057464 1958 dbSNP
rs1238402975 1959 dbSNP
rs1245325145 1970 dbSNP
rs1201335442 1992 dbSNP
rs752206677 1993 dbSNP
rs961481923 1995 dbSNP
rs1283769511 1997 dbSNP
rs1206919162 2008 dbSNP
rs994694533 2012 dbSNP
rs952817081 2015 dbSNP
rs1208333262 2017 dbSNP
rs980284201 2019 dbSNP
rs1272806775 2023 dbSNP
rs372871613 2024 dbSNP
rs960596184 2025 dbSNP
rs560361526 2028 dbSNP
rs754759929 2035 dbSNP
rs1160619741 2039 dbSNP
rs114190350 2063 dbSNP
rs945806310 2064 dbSNP
rs1187603555 2065 dbSNP
rs1478527785 2072 dbSNP
rs1369747781 2073 dbSNP
rs1471537035 2081 dbSNP
rs1186907192 2085 dbSNP
rs1466357724 2088 dbSNP
rs1162238522 2090 dbSNP
rs1248688467 2092 dbSNP
rs1203070455 2098 dbSNP
rs976485767 2099 dbSNP
rs1310389960 2100 dbSNP
rs1280571755 2105 dbSNP
rs1025266751 2108 dbSNP
rs1338497748 2109 dbSNP
rs1295019362 2113 dbSNP
rs187374016 2117 dbSNP
rs764055928 2118 dbSNP
rs1333856502 2123 dbSNP
rs984350496 2129 dbSNP
rs931789217 2130 dbSNP
rs1050251614 2133 dbSNP
rs780208064 2134 dbSNP
rs1415470106 2136 dbSNP
rs11061781 2145 dbSNP
rs531628149 2146 dbSNP
rs1041044746 2147 dbSNP
rs1183077905 2157 dbSNP
rs1482277346 2160 dbSNP
rs897113358 2165 dbSNP
rs3741977 2166 dbSNP
rs939345255 2171 dbSNP
rs780843791 2173 dbSNP
rs1027046964 2174 dbSNP
rs1230293543 2187 dbSNP
rs1342465446 2190 dbSNP
rs750269280 2193 dbSNP
rs1052414700 2194 dbSNP
rs1001689149 2195 dbSNP
rs1380703207 2197 dbSNP
rs1305172412 2198 dbSNP
rs192270444 2215 dbSNP
rs1255965457 2216 dbSNP
rs1431952122 2219 dbSNP
rs1480257023 2222 dbSNP
rs779126639 2224 dbSNP
rs772156324 2225 dbSNP
rs1051912422 2237 dbSNP
rs1416021806 2243 dbSNP
rs143209540 2248 dbSNP
rs59027092 2258 dbSNP
rs747469664 2263 dbSNP
rs1249472768 2266 dbSNP
rs181920205 2267 dbSNP
rs562299829 2274 dbSNP
rs1018438807 2275 dbSNP
rs1323051782 2284 dbSNP
rs1312846809 2286 dbSNP
rs900882646 2287 dbSNP
rs998350600 2297 dbSNP
rs536315199 2298 dbSNP
rs149525689 2299 dbSNP
rs951069452 2299 dbSNP
rs1371539456 2307 dbSNP
rs1461813429 2314 dbSNP
rs1456553118 2316 dbSNP
rs1173627245 2319 dbSNP
rs1165604825 2323 dbSNP
rs1351796432 2323 dbSNP
rs984316282 2325 dbSNP
rs10773946 2327 dbSNP
rs187015470 2332 dbSNP
rs1472829889 2334 dbSNP
rs981001185 2340 dbSNP
rs1394355568 2349 dbSNP
rs776839478 2351 dbSNP
rs146665201 2355 dbSNP
rs1312425296 2363 dbSNP
rs1341329598 2364 dbSNP
rs1036648785 2367 dbSNP
rs1276570668 2369 dbSNP
rs140209798 2373 dbSNP
rs759969466 2377 dbSNP
rs1257630049 2384 dbSNP
rs929936887 2385 dbSNP
rs1209520240 2392 dbSNP
rs988244972 2409 dbSNP
rs1301055260 2412 dbSNP
rs190370835 2419 dbSNP
rs913888115 2425 dbSNP
rs578184818 2426 dbSNP
rs1042987639 2428 dbSNP
rs1161347553 2431 dbSNP
rs1173709635 2432 dbSNP
rs904479767 2432 dbSNP
rs1434620260 2434 dbSNP
rs1267694306 2436 dbSNP
rs752925400 2438 dbSNP
rs942616230 2441 dbSNP
rs545299590 2442 dbSNP
rs1014445146 2443 dbSNP
rs1039504541 2449 dbSNP
rs1428215834 2451 dbSNP
rs1020928813 2455 dbSNP
rs1255863440 2457 dbSNP
rs1231536140 2458 dbSNP
rs1200099408 2477 dbSNP
rs967686902 2478 dbSNP
rs901012110 2479 dbSNP
rs997919648 2489 dbSNP
rs1046819582 2491 dbSNP
rs1363170277 2499 dbSNP
rs3741976 2501 dbSNP
rs1435828293 2502 dbSNP
rs1401412720 2509 dbSNP
rs1032678996 2515 dbSNP
rs1005209426 2520 dbSNP
rs143397888 2521 dbSNP
rs985810140 2528 dbSNP
rs762494616 2529 dbSNP
rs542682340 2530 dbSNP
rs1188658143 2538 dbSNP
rs1002883558 2539 dbSNP
rs1296507363 2547 dbSNP
rs561202086 2556 dbSNP
rs1387122307 2558 dbSNP
rs1035171817 2561 dbSNP
rs1303224264 2564 dbSNP
rs961184772 2565 dbSNP
rs1484473649 2568 dbSNP
rs1281458389 2569 dbSNP
rs988210815 2574 dbSNP
rs773134761 2576 dbSNP
rs914025377 2577 dbSNP
rs751146798 2583 dbSNP
rs1286675755 2597 dbSNP
rs979390049 2603 dbSNP
rs77173162 2609 dbSNP
rs1048422468 2616 dbSNP
rs942602606 2619 dbSNP
rs543440015 2625 dbSNP
rs1259774333 2626 dbSNP
rs937330699 2642 dbSNP
rs762433027 2652 dbSNP
rs1427520777 2653 dbSNP
rs1488643951 2654 dbSNP
rs1192110516 2655 dbSNP
rs1269980982 2658 dbSNP
rs565329936 2665 dbSNP
rs770460932 2678 dbSNP
rs1472211885 2697 dbSNP
rs1193519013 2701 dbSNP
rs532403815 2705 dbSNP
rs1040043225 2710 dbSNP
rs922440874 2726 dbSNP
rs1041915229 2728 dbSNP
rs933855151 2729 dbSNP
rs1277103536 2740 dbSNP
rs1196576897 2742 dbSNP
rs547725463 2744 dbSNP
rs1282530265 2747 dbSNP
rs140562065 2749 dbSNP
rs1341010931 2754 dbSNP
rs529937232 2757 dbSNP
rs1407839634 2759 dbSNP
rs1352082527 2760 dbSNP
rs576134346 2761 dbSNP
rs1404365932 2765 dbSNP
rs1033232303 2775 dbSNP
rs1439932325 2778 dbSNP
rs904876523 2781 dbSNP
rs1002442248 2786 dbSNP
rs182620132 2793 dbSNP
rs1419288368 2794 dbSNP
rs960899528 2800 dbSNP
rs1009780202 2802 dbSNP
rs1237323865 2809 dbSNP
rs1021139127 2815 dbSNP
rs1451274452 2820 dbSNP
rs1287918562 2823 dbSNP
rs1019080547 2829 dbSNP
rs968091988 2829 dbSNP
rs979524269 2830 dbSNP
rs1331004547 2837 dbSNP
rs186935253 2842 dbSNP
rs371550828 2844 dbSNP
rs919135010 2847 dbSNP
rs951933607 2853 dbSNP
rs965094112 2854 dbSNP
rs975341041 2855 dbSNP
rs922545192 2858 dbSNP
rs1456142905 2863 dbSNP
rs1414768504 2878 dbSNP
rs933823407 2880 dbSNP
rs1046841067 2881 dbSNP
rs1213474350 2886 dbSNP
rs1239306195 2887 dbSNP
rs1469002605 2888 dbSNP
rs908389947 2889 dbSNP
rs73602002 2892 dbSNP
rs1218494720 2896 dbSNP
rs561588612 2904 dbSNP
rs1342592599 2909 dbSNP
rs1276296627 2911 dbSNP
rs528988605 2917 dbSNP
rs1038552421 2918 dbSNP
rs917304817 2925 dbSNP
rs1436571102 2927 dbSNP
rs904844381 2931 dbSNP
rs1319554064 2940 dbSNP
rs950203521 2941 dbSNP
rs937707932 2944 dbSNP
rs189851189 2948 dbSNP
rs750134581 2950 dbSNP
rs540642378 2951 dbSNP
rs903328396 2953 dbSNP
rs896702694 2960 dbSNP
rs1009833271 2961 dbSNP
rs1402337226 2973 dbSNP
rs1054613513 2975 dbSNP
rs1297564642 2985 dbSNP
rs570435717 3000 dbSNP
rs904038654 3001 dbSNP
rs1211272489 3002 dbSNP
rs889378723 3004 dbSNP
rs1000931022 3012 dbSNP
rs1007165939 3021 dbSNP
rs1018132638 3025 dbSNP
rs1018635347 3029 dbSNP
rs1362027447 3032 dbSNP
rs964733431 3033 dbSNP
rs559407423 3035 dbSNP
rs1447905654 3036 dbSNP
rs1357894093 3042 dbSNP
rs1315218394 3043 dbSNP
rs1030333681 3047 dbSNP
rs955257010 3049 dbSNP
rs1333777446 3059 dbSNP
rs982682455 3061 dbSNP
rs1233051570 3065 dbSNP
rs993294071 3072 dbSNP
rs150449411 3085 dbSNP
rs1471782313 3087 dbSNP
rs951818254 3088 dbSNP
rs1459463869 3089 dbSNP
rs1482602395 3090 dbSNP
rs1272111122 3092 dbSNP
rs1206828588 3097 dbSNP
rs941227509 3111 dbSNP
rs926516960 3112 dbSNP
rs1226073216 3114 dbSNP
rs1377644364 3122 dbSNP
rs1295582316 3130 dbSNP
rs1037941036 3139 dbSNP
rs973842410 3141 dbSNP
rs926407833 3142 dbSNP
rs1183679997 3143 dbSNP
rs937780829 3144 dbSNP
rs1184792709 3146 dbSNP
rs1355280957 3150 dbSNP
rs1164189565 3153 dbSNP
rs533546883 3157 dbSNP
rs1171102393 3158 dbSNP
rs1420017347 3163 dbSNP
rs896168158 3174 dbSNP
rs945586174 3175 dbSNP
rs1042682981 3178 dbSNP
rs1249308963 3182 dbSNP
rs950103338 3183 dbSNP
rs904007378 3186 dbSNP
rs1245713432 3187 dbSNP
rs1218750850 3191 dbSNP
rs1001472908 3193 dbSNP
rs1169576673 3195 dbSNP
rs1322998209 3198 dbSNP
rs1275650676 3201 dbSNP
rs1359688774 3204 dbSNP
rs1449567767 3206 dbSNP
rs1134345 3207 dbSNP
rs752907335 3217 dbSNP
rs1400278930 3222 dbSNP
rs1293153050 3223 dbSNP
rs1279720409 3225 dbSNP
rs1165616818 3238 dbSNP
rs1341859434 3244 dbSNP
rs1213182476 3245 dbSNP
rs1272849336 3246 dbSNP
rs555183034 3248 dbSNP
rs1212327691 3249 dbSNP
rs1419387028 3252 dbSNP
rs1424116506 3256 dbSNP
rs1134346 3257 dbSNP
rs112699734 3263 dbSNP
rs1194610400 3266 dbSNP
rs565094055 3274 dbSNP
rs1474272079 3276 dbSNP
rs1185774419 3280 dbSNP
rs767114365 3288 dbSNP
rs1416141979 3297 dbSNP
rs1317881534 3298 dbSNP
rs1171175366 3299 dbSNP
rs1217659968 3299 dbSNP
rs1326690056 3301 dbSNP
rs1373419487 3301 dbSNP
rs1208400384 3302 dbSNP
rs1255804045 3302 dbSNP
rs1300876684 3302 dbSNP
rs1304362034 3302 dbSNP
rs1350342401 3302 dbSNP
rs1363105705 3302 dbSNP
rs1382736200 3302 dbSNP
rs1386370561 3302 dbSNP
rs1401343553 3302 dbSNP
rs1434395929 3302 dbSNP
rs1436277784 3302 dbSNP
rs1436788617 3302 dbSNP
rs771102189 3302 dbSNP
rs1374269601 3303 dbSNP
rs1167555618 3304 dbSNP
rs1419809846 3305 dbSNP
rs1299578581 3307 dbSNP
rs1374261807 3310 dbSNP
rs1427317830 3310 dbSNP
rs59367488 3310 dbSNP
rs1174572761 3311 dbSNP
rs1204678647 3311 dbSNP
rs1228168969 3311 dbSNP
rs1253167676 3311 dbSNP
rs1339806843 3311 dbSNP
rs59708005 3311 dbSNP
rs1307068641 3312 dbSNP
rs1310478518 3312 dbSNP
rs1355830031 3312 dbSNP
rs1401569093 3312 dbSNP
rs1427458909 3312 dbSNP
rs61429784 3312 dbSNP
rs1235027831 3313 dbSNP
rs1271247823 3313 dbSNP
rs1287515315 3313 dbSNP
rs1329120465 3313 dbSNP
rs1335350134 3313 dbSNP
rs1337169487 3313 dbSNP
rs1355712871 3313 dbSNP
rs1385792871 3313 dbSNP
rs1407705210 3313 dbSNP
rs58408082 3313 dbSNP
rs1158896741 3314 dbSNP
rs1182770908 3314 dbSNP
rs1324522151 3314 dbSNP
rs1365822011 3314 dbSNP
rs1387929960 3314 dbSNP
rs1419133529 3314 dbSNP
rs1463491294 3314 dbSNP
rs1468916673 3314 dbSNP
rs60755849 3314 dbSNP
rs1159468804 3315 dbSNP
rs1195585502 3315 dbSNP
rs1213533845 3315 dbSNP
rs1247409223 3315 dbSNP
rs1284736630 3315 dbSNP
rs1393442224 3315 dbSNP
rs1448565709 3315 dbSNP
rs1454763192 3315 dbSNP
rs1477835322 3315 dbSNP
rs201272886 3315 dbSNP
rs57315267 3315 dbSNP
rs1199603009 3316 dbSNP
rs1234455338 3316 dbSNP
rs1270168338 3316 dbSNP
rs1305166159 3316 dbSNP
rs1319406583 3316 dbSNP
rs1328659040 3316 dbSNP
rs1345293032 3316 dbSNP
rs1363797674 3316 dbSNP
rs1429278125 3316 dbSNP
rs60655754 3316 dbSNP
rs1168426225 3317 dbSNP
rs1315060561 3317 dbSNP
rs1353931732 3317 dbSNP
rs1354113218 3317 dbSNP
rs1411722323 3317 dbSNP
rs1414615993 3317 dbSNP
rs1415663263 3317 dbSNP
rs1420206974 3317 dbSNP
rs202225801 3317 dbSNP
rs58984591 3317 dbSNP
rs1162560777 3318 dbSNP
rs1188331354 3318 dbSNP
rs1206090694 3318 dbSNP
rs1230753254 3318 dbSNP
rs1233180318 3318 dbSNP
rs1259391489 3318 dbSNP
rs1274385509 3318 dbSNP
rs1307554743 3318 dbSNP
rs1474125275 3318 dbSNP
rs1482531900 3318 dbSNP
rs59678473 3318 dbSNP
rs1171331496 3319 dbSNP
rs1188719455 3319 dbSNP
rs1191797007 3319 dbSNP
rs1260186328 3319 dbSNP
rs1290429883 3319 dbSNP
rs1374530681 3319 dbSNP
rs1395185597 3319 dbSNP
rs1428447931 3319 dbSNP
rs1436099822 3319 dbSNP
rs1454064711 3319 dbSNP
rs1491382302 3319 dbSNP
rs4765820 3319 dbSNP
rs56939346 3319 dbSNP
rs1208970907 3320 dbSNP
rs1226691958 3320 dbSNP
rs1257126578 3320 dbSNP
rs1281165711 3320 dbSNP
rs1297614928 3320 dbSNP
rs1305704115 3320 dbSNP
rs1350261702 3320 dbSNP
rs1382616164 3320 dbSNP
rs1491581014 3320 dbSNP
rs1002673422 3321 dbSNP
rs1324333219 3323 dbSNP
rs1416280328 3325 dbSNP
rs1166824871 3326 dbSNP
rs867408617 3327 dbSNP
rs1270046425 3328 dbSNP
rs1368892702 3329 dbSNP
rs1257284782 3330 dbSNP
rs1237084956 3331 dbSNP
rs1278858114 3333 dbSNP
rs1347163424 3334 dbSNP
rs1217455277 3335 dbSNP
rs1253061726 3336 dbSNP
rs1286593724 3337 dbSNP
rs1334024843 3339 dbSNP
rs532568275 3344 dbSNP
rs1234845706 3346 dbSNP
rs1214770904 3347 dbSNP
rs1355761699 3347 dbSNP
rs1389218199 3348 dbSNP
rs1397983817 3349 dbSNP
rs1247116718 3350 dbSNP
rs1478898349 3351 dbSNP
rs1191626361 3358 dbSNP
rs1394406899 3360 dbSNP
rs1439708543 3390 dbSNP
rs1466629202 3403 dbSNP
rs1159989152 3409 dbSNP
rs143016639 3415 dbSNP
rs541305783 3420 dbSNP
rs1476381681 3425 dbSNP
rs1369333509 3428 dbSNP
rs1323835694 3438 dbSNP
rs1417510313 3444 dbSNP
rs1252796618 3446 dbSNP
rs1199282262 3455 dbSNP
rs1350797093 3468 dbSNP
rs900546279 3469 dbSNP
rs1271181783 3470 dbSNP
rs1215406119 3477 dbSNP
rs1356749594 3478 dbSNP
rs1278640242 3484 dbSNP
rs1443576810 3488 dbSNP
rs559665898 3494 dbSNP
rs139047555 3495 dbSNP
rs182805884 3500 dbSNP
rs1394466146 3509 dbSNP
rs950744079 3512 dbSNP
rs1463377715 3518 dbSNP
rs1391936808 3523 dbSNP
rs982651221 3526 dbSNP
rs1281390029 3529 dbSNP
rs59814821 3534 dbSNP
rs1468804416 3545 dbSNP
rs1365699269 3552 dbSNP
rs1179404061 3553 dbSNP
rs1453868195 3554 dbSNP
rs1251106011 3570 dbSNP
rs1348779652 3573 dbSNP
rs777687233 3574 dbSNP
rs754224987 3575 dbSNP
rs1203086117 3578 dbSNP
rs1469594667 3581 dbSNP
rs1286264451 3585 dbSNP
rs993570622 3585 dbSNP
rs962515757 3586 dbSNP
rs974276619 3588 dbSNP
rs1304934477 3600 dbSNP
rs926487337 3604 dbSNP
rs200531259 3606 dbSNP
rs556806141 3606 dbSNP
rs937730814 3610 dbSNP
rs114925632 3611 dbSNP
rs1387503508 3612 dbSNP
rs76083441 3614 dbSNP
rs1434238011 3621 dbSNP
rs945051437 3622 dbSNP
rs531804838 3624 dbSNP
rs1042653085 3628 dbSNP
rs925564707 3629 dbSNP
rs1241389602 3638 dbSNP
rs1448512171 3642 dbSNP
rs1263501822 3648 dbSNP
rs1209673127 3655 dbSNP
rs936940650 3659 dbSNP
rs1025315243 3661 dbSNP
rs1469212381 3663 dbSNP
rs552264151 3675 dbSNP
rs1270126891 3678 dbSNP
rs977838911 3679 dbSNP
rs1342747819 3687 dbSNP
rs1299132715 3693 dbSNP
rs924686266 3701 dbSNP
rs1373788118 3703 dbSNP
rs545424379 3708 dbSNP
rs1415094025 3709 dbSNP
rs534296256 3711 dbSNP
rs1463332607 3713 dbSNP
rs1418794370 3714 dbSNP
rs997992206 3716 dbSNP
rs936110515 3717 dbSNP
rs990274837 3718 dbSNP
rs1261229700 3720 dbSNP
rs550357529 3726 dbSNP
rs546222538 3727 dbSNP
rs1484494781 3728 dbSNP
rs1394352473 3731 dbSNP
rs188967422 3735 dbSNP
rs1210294093 3738 dbSNP
rs1436693759 3740 dbSNP
rs1272985655 3751 dbSNP
rs1448232376 3756 dbSNP
rs1213348965 3762 dbSNP
rs886434122 3765 dbSNP
rs1279238626 3773 dbSNP
rs902109575 3783 dbSNP
rs1334014260 3784 dbSNP
rs1441569416 3785 dbSNP
rs1448897467 3788 dbSNP
rs193261812 3788 dbSNP
rs1353984184 3799 dbSNP
rs1337293523 3801 dbSNP
rs928976057 3805 dbSNP
rs1272359923 3811 dbSNP
rs554820825 3815 dbSNP
rs75579146 3820 dbSNP
rs1006011436 3821 dbSNP
rs1016223584 3822 dbSNP
rs894940514 3827 dbSNP
rs535965235 3836 dbSNP
rs962915602 3845 dbSNP
rs1187709752 3847 dbSNP
rs1230707903 3848 dbSNP
rs1013856718 3850 dbSNP
rs995451541 3851 dbSNP
rs1024865184 3852 dbSNP
rs1033908316 3870 dbSNP
rs959257819 3871 dbSNP
rs553714292 3875 dbSNP
rs185417786 3876 dbSNP
rs1474045307 3877 dbSNP
rs1163197513 3883 dbSNP
rs917704446 3910 dbSNP
rs1377647934 3913 dbSNP
rs1417528479 3914 dbSNP
rs1466496950 3927 dbSNP
rs990157281 3928 dbSNP
rs910636839 3929 dbSNP
rs1405271485 3932 dbSNP
rs943525084 3937 dbSNP
rs1439766652 3941 dbSNP
rs966362355 3943 dbSNP
rs1239359766 3946 dbSNP
rs977713344 3951 dbSNP
rs558750027 3954 dbSNP
rs976668231 3958 dbSNP
rs1267635397 3960 dbSNP
rs1282421851 3961 dbSNP
rs376601288 3961 dbSNP
rs929588663 3962 dbSNP
rs776055552 3965 dbSNP
rs1302703650 3966 dbSNP
rs577444039 3969 dbSNP
rs1369557236 3973 dbSNP
rs1293909040 3977 dbSNP
rs1429749481 3979 dbSNP
rs187592116 3982 dbSNP
rs936888697 3983 dbSNP
rs1039305796 4008 dbSNP
rs559825728 4021 dbSNP
rs574782384 4022 dbSNP
rs542117064 4026 dbSNP
rs894902396 4028 dbSNP
rs1270084043 4030 dbSNP
rs192070000 4031 dbSNP
rs748942145 4032 dbSNP
rs76374659 4033 dbSNP
rs1281906907 4034 dbSNP
rs1240631464 4035 dbSNP
rs1219103186 4036 dbSNP
rs1484418124 4041 dbSNP
rs1186729572 4046 dbSNP
rs1004932746 4047 dbSNP
rs1279711766 4049 dbSNP
rs1232102730 4050 dbSNP
rs552113813 4051 dbSNP
rs899184189 4052 dbSNP
rs1213813772 4058 dbSNP
rs563821388 4082 dbSNP
rs1032226098 4086 dbSNP
rs528209023 4088 dbSNP
rs1011549266 4089 dbSNP
rs1310609210 4092 dbSNP
rs546182764 4093 dbSNP
rs1379926148 4094 dbSNP
rs1033628300 4100 dbSNP
rs959458092 4101 dbSNP
rs1371839573 4108 dbSNP
rs1017658280 4110 dbSNP
rs1428391762 4112 dbSNP
rs1421974241 4113 dbSNP
rs965182866 4120 dbSNP
rs567723571 4122 dbSNP
rs773709095 4123 dbSNP
rs184287578 4126 dbSNP
rs1024813890 4128 dbSNP
rs923470597 4131 dbSNP
rs1198869141 4145 dbSNP
rs1484258844 4147 dbSNP
rs1256564311 4151 dbSNP
rs1226627417 4153 dbSNP
rs188629609 4157 dbSNP
rs977847666 4158 dbSNP
rs1279858828 4161 dbSNP
rs1219002882 4167 dbSNP
rs1312443007 4169 dbSNP
rs1291028129 4170 dbSNP
rs548881249 4173 dbSNP
rs983664753 4174 dbSNP
rs181051658 4185 dbSNP
rs957757613 4193 dbSNP
rs537630728 4201 dbSNP
rs761406293 4206 dbSNP
rs541060745 4207 dbSNP
rs1398668984 4211 dbSNP
rs184480218 4213 dbSNP
rs933571851 4214 dbSNP
rs1054825821 4216 dbSNP
rs1305574547 4217 dbSNP
rs1057107 4222 dbSNP
rs1185662093 4223 dbSNP
rs916313733 4226 dbSNP
rs1345029514 4237 dbSNP
rs1209546124 4240 dbSNP
rs767313883 4245 dbSNP
rs908066621 4254 dbSNP
rs1333863477 4255 dbSNP
rs1263409787 4269 dbSNP
rs940756651 4273 dbSNP
rs902309440 4285 dbSNP
rs1305692504 4290 dbSNP
rs765667254 4298 dbSNP
rs773202272 4299 dbSNP
rs899147184 4300 dbSNP
rs1428313089 4308 dbSNP
rs937391519 4313 dbSNP
rs1194738717 4320 dbSNP
rs1466512682 4320 dbSNP
rs1397447550 4321 dbSNP
rs760667828 4322 dbSNP
rs1394229042 4327 dbSNP
rs1055446759 4328 dbSNP
rs1452648782 4332 dbSNP
rs577409315 4334 dbSNP
rs535172856 4336 dbSNP
rs1013516385 4342 dbSNP
rs1024784308 4355 dbSNP
rs893735514 4384 dbSNP
rs902365187 4388 dbSNP
rs1467946363 4391 dbSNP
rs561145913 4393 dbSNP
rs1287359981 4398 dbSNP
rs1211356064 4400 dbSNP
rs1011517894 4406 dbSNP
rs1387138995 4407 dbSNP
rs553361014 4409 dbSNP
rs1355200894 4410 dbSNP
rs758599674 4418 dbSNP
rs79310628 4428 dbSNP
rs957940980 4435 dbSNP
rs1448202326 4436 dbSNP
rs974395696 4442 dbSNP
rs1029084797 4443 dbSNP
rs1391777841 4458 dbSNP
rs1232923140 4462 dbSNP
rs565206045 4468 dbSNP
rs1418047808 4474 dbSNP
rs1382285188 4479 dbSNP
rs954932647 4485 dbSNP
rs1236366856 4488 dbSNP
rs866656330 4489 dbSNP
rs764400092 4492 dbSNP
rs1259813273 4496 dbSNP
rs1200817002 4505 dbSNP
rs987703591 4508 dbSNP
rs1260665192 4512 dbSNP
rs1214028518 4533 dbSNP
rs559434841 4533 dbSNP
rs574900117 4533 dbSNP
rs908033592 4538 dbSNP
rs750937000 4541 dbSNP
rs1286110033 4543 dbSNP
rs1232847148 4554 dbSNP
rs201394561 4558 dbSNP
rs539474827 4560 dbSNP
rs1214774468 4562 dbSNP
rs1235953489 4562 dbSNP
rs983633132 4563 dbSNP
rs11061782 4572 dbSNP
rs189019271 4573 dbSNP
rs963648670 4579 dbSNP
rs1193064288 4582 dbSNP
rs920728524 4591 dbSNP
rs1434179845 4594 dbSNP
rs916264888 4595 dbSNP
rs937423066 4600 dbSNP
rs1157105501 4615 dbSNP
rs949088007 4616 dbSNP
rs982228124 4617 dbSNP
rs1055762484 4618 dbSNP
rs1166914562 4642 dbSNP
rs923729560 4646 dbSNP
rs935135347 4649 dbSNP
rs1202741898 4657 dbSNP
rs773751607 4658 dbSNP
rs1053578116 4659 dbSNP
rs758468856 4660 dbSNP
rs1217170119 4670 dbSNP
rs111939912 4672 dbSNP
rs1279040125 4688 dbSNP
rs1046369570 4696 dbSNP
rs575481462 4697 dbSNP
rs1305840828 4711 dbSNP
rs545966960 4713 dbSNP
rs1030804191 4718 dbSNP
rs1322023760 4721 dbSNP
rs1395610016 4723 dbSNP
rs1168342966 4724 dbSNP
rs1032592937 4726 dbSNP
rs1275496520 4734 dbSNP
rs893523332 4743 dbSNP
rs563984122 4748 dbSNP
rs886552717 4755 dbSNP
rs996344042 4756 dbSNP
rs746362798 4768 dbSNP
rs528126575 4769 dbSNP
rs1016480213 4770 dbSNP
rs954402494 4778 dbSNP
rs115433417 4779 dbSNP
rs1320419699 4783 dbSNP
rs1259053479 4784 dbSNP
rs1015162790 4787 dbSNP
rs962181418 4791 dbSNP
rs539950856 4792 dbSNP
rs920765990 4795 dbSNP
rs1448827020 4812 dbSNP
rs543206659 4814 dbSNP
rs992001654 4818 dbSNP
rs1400810426 4832 dbSNP
rs1166793608 4847 dbSNP
rs1476998576 4848 dbSNP
rs561315061 4851 dbSNP
rs1163731294 4860 dbSNP
rs1415327834 4862 dbSNP
rs1415492964 4869 dbSNP
rs555560687 4876 dbSNP
rs1238155012 4879 dbSNP
rs528907918 4879 dbSNP
rs1046345083 4880 dbSNP
rs923816360 4891 dbSNP
rs1459451397 4895 dbSNP
rs935244603 4896 dbSNP
rs989266936 4902 dbSNP
rs1292283560 4918 dbSNP
rs915043842 4924 dbSNP
rs1053596918 4947 dbSNP
rs1353106616 4950 dbSNP
rs1307130556 4952 dbSNP
rs550336523 4969 dbSNP
rs1448914750 4972 dbSNP
rs1297146815 4973 dbSNP
rs1355677356 4986 dbSNP
rs1351300509 4988 dbSNP
rs893650804 4995 dbSNP
rs1012822979 4998 dbSNP
rs182455890 5006 dbSNP
rs1159862195 5007 dbSNP
rs1353885806 5007 dbSNP
rs1050630621 5009 dbSNP
rs1409331825 5014 dbSNP
rs1228121653 5017 dbSNP
rs1195931244 5019 dbSNP
rs1487690502 5023 dbSNP
rs749718690 5026 dbSNP
rs1274305590 5027 dbSNP
rs1222631864 5030 dbSNP
rs1488049460 5031 dbSNP
rs1283995520 5035 dbSNP
rs890114164 5037 dbSNP
rs1008554904 5046 dbSNP
rs573622320 5055 dbSNP
rs962232818 5059 dbSNP
rs1250873729 5062 dbSNP
rs1293855684 5076 dbSNP
rs774082591 5084 dbSNP
rs1399015734 5085 dbSNP
rs1486050559 5086 dbSNP
rs541114626 5092 dbSNP
rs1046473 5095 dbSNP
rs1419767434 5095 dbSNP
rs1346344272 5097 dbSNP
rs1175945754 5098 dbSNP
rs1431906849 5098 dbSNP
rs552803119 5099 dbSNP
rs1005004148 5107 dbSNP
rs1477653808 5108 dbSNP
rs1261300061 5112 dbSNP
rs1218941130 5117 dbSNP
rs1488646099 5118 dbSNP
rs1046475 5121 dbSNP
rs1186961689 5122 dbSNP
rs1421537748 5123 dbSNP
rs550566826 5125 dbSNP
rs1301731018 5138 dbSNP
rs1217769264 5140 dbSNP
rs1012434562 5142 dbSNP
rs991575540 5143 dbSNP
rs769623603 5144 dbSNP
rs771498246 5144 dbSNP
rs535086217 5147 dbSNP
rs971474949 5148 dbSNP
rs977385075 5149 dbSNP
rs924620833 5153 dbSNP
rs1300501137 5157 dbSNP
rs1464996915 5166 dbSNP
rs1374533862 5176 dbSNP
rs935240897 5179 dbSNP
rs1177686921 5184 dbSNP
rs1447754730 5185 dbSNP
rs1054139333 5186 dbSNP
rs1364671436 5189 dbSNP
rs1213270713 5191 dbSNP
rs144635612 5192 dbSNP
rs760577827 5199 dbSNP
rs931844345 5201 dbSNP
rs766355502 5211 dbSNP
rs1348593326 5212 dbSNP
rs890161657 5223 dbSNP
rs1263676087 5229 dbSNP
rs1197820798 5231 dbSNP
rs1315810479 5233 dbSNP
rs1213127367 5237 dbSNP
rs1278454724 5239 dbSNP
rs1008608597 5241 dbSNP
rs1339455662 5243 dbSNP
rs776362394 5244 dbSNP
rs1216216567 5245 dbSNP
rs1243587386 5246 dbSNP
rs956382739 5249 dbSNP
rs989153804 5255 dbSNP
rs739971 5256 dbSNP
rs1395628594 5258 dbSNP
rs1455182214 5260 dbSNP
rs995081306 5271 dbSNP
rs1171273370 5276 dbSNP
rs1394067831 5282 dbSNP
rs1425598596 5285 dbSNP
rs1028350466 5293 dbSNP
rs958893664 5297 dbSNP
rs922494435 5299 dbSNP
rs1013463432 5303 dbSNP
rs770386715 5305 dbSNP
rs148476833 5313 dbSNP
rs1239793695 5325 dbSNP
rs1196147426 5329 dbSNP
rs1319904888 5330 dbSNP
rs187089097 5344 dbSNP
rs557114542 5353 dbSNP
rs971443804 5354 dbSNP
rs1375252281 5356 dbSNP
rs1320399237 5370 dbSNP
rs773880088 5376 dbSNP
rs575490467 5377 dbSNP
rs1236550395 5379 dbSNP
rs1392325801 5379 dbSNP
rs1031661159 5391 dbSNP
rs115310621 5392 dbSNP
rs1385972997 5393 dbSNP
rs989407530 5398 dbSNP
rs764155266 5399 dbSNP
rs1344427484 5400 dbSNP
rs1224507123 5402 dbSNP
rs1182308298 5404 dbSNP
rs915183936 5412 dbSNP
rs1450802462 5418 dbSNP
rs11548697 5423 dbSNP
rs1445013136 5428 dbSNP
rs1211301926 5442 dbSNP
rs931917750 5448 dbSNP
rs1045257768 5449 dbSNP
rs1237304736 5450 dbSNP
rs1284699961 5450 dbSNP
rs372168908 5454 dbSNP
rs1352233400 5455 dbSNP
rs985889695 5464 dbSNP
rs1469796140 5467 dbSNP
rs1191176951 5474 dbSNP
rs1240270820 5478 dbSNP
rs1330907426 5479 dbSNP
rs372369240 5482 dbSNP
rs564581809 5487 dbSNP
rs557492111 5507 dbSNP
rs1366415070 5508 dbSNP
rs944434846 5512 dbSNP
rs572717719 5513 dbSNP
rs532033029 5518 dbSNP
rs113121031 5519 dbSNP
rs897475371 5520 dbSNP
rs930339270 5521 dbSNP
rs1399306455 5523 dbSNP
rs1480591398 5530 dbSNP
rs1262012203 5534 dbSNP
rs1213872402 5536 dbSNP
rs1488969843 5537 dbSNP
rs1158945851 5540 dbSNP
rs956352127 5542 dbSNP
rs1443690272 5544 dbSNP
rs539916702 5546 dbSNP
rs1010543466 5548 dbSNP
rs561427089 5561 dbSNP
rs1021987186 5562 dbSNP
rs1225732210 5563 dbSNP
rs1346432828 5568 dbSNP
rs1048724434 5570 dbSNP
rs1277782609 5571 dbSNP
rs1398335516 5573 dbSNP
rs963852413 5577 dbSNP
rs1330531530 5586 dbSNP
rs1413855851 5595 dbSNP
rs1443042776 5596 dbSNP
rs529015057 5596 dbSNP
rs1470092758 5597 dbSNP
rs746247192 5597 dbSNP
rs1191091428 5607 dbSNP
rs894685768 5608 dbSNP
rs1242195990 5625 dbSNP
rs1013182237 5627 dbSNP
rs1024456328 5632 dbSNP
rs1348889569 5632 dbSNP
rs1277086200 5634 dbSNP
rs544187197 5634 dbSNP
rs1227519090 5637 dbSNP
rs975650601 5638 dbSNP
rs1324744762 5642 dbSNP
rs562392419 5643 dbSNP
rs1336699152 5649 dbSNP
rs1211699566 5650 dbSNP
rs1341668075 5662 dbSNP
rs955390287 5665 dbSNP
rs1447380404 5670 dbSNP
rs761997704 5677 dbSNP
rs1266593182 5685 dbSNP
rs1453219501 5687 dbSNP
rs141752637 5689 dbSNP
rs1168187573 5696 dbSNP
rs1466872997 5700 dbSNP
rs998929222 5702 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
miRNA  3' guuugUGGUAACAG---UGUGAGGu 5'
               |:|: ||||   :|||||| 
Target 5' -----AUCG-UGUCACUGCACUCCa 3'
1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000355446.5 | 3UTR | AUCGUGUCACUGCACUCCAGCCUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.751 1.2e-5 -0.712 4.8e-5 24 Click to see details
GSE17306 Multiple myeloma -0.351 6.7e-3 -0.063 3.3e-1 49 Click to see details
GSE27834 Pluripotent stem cells 0.561 1.2e-2 0.471 3.3e-2 16 Click to see details
GSE28260 Renal cortex and medulla 0.514 3.6e-2 0.319 1.4e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.202 5.5e-2 -0.127 1.6e-1 64 Click to see details
GSE21849 B cell lymphoma 0.294 6.1e-2 0.298 5.8e-2 29 Click to see details
GSE17498 Multiple myeloma -0.221 8.5e-2 -0.152 1.7e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.279 9.9e-2 0.226 1.5e-1 23 Click to see details
GSE14794 Lymphoblastoid cells -0.136 1.0e-1 -0.128 1.1e-1 90 Click to see details
GSE32688 Pancreatic cancer -0.146 2.1e-1 -0.083 3.3e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.187 2.1e-1 0.259 1.4e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.151 2.4e-1 -0.124 2.8e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.127 3.5e-1 0.073 4.1e-1 12 Click to see details
GSE38226 Liver fibrosis 0.09 3.5e-1 0.017 4.7e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.109 4.2e-1 0.029 4.8e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells 0.015 4.7e-1 -0.047 4.1e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.014 4.7e-1 -0.176 2.0e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.3 0.02 -0.270 0.03 49 Click to see details
STAD -0.432 0.14 -0.429 0.14 8 Click to see details
KIRP -0.28 0.23 -0.333 0.19 9 Click to see details
ESCA -0.408 0.25 -0.600 0.14 5 Click to see details
THCA 0.318 0.3 -0.100 0.44 5 Click to see details
KICH 0.211 0.31 0.357 0.19 8 Click to see details
KIRC -0.077 0.35 -0.019 0.46 29 Click to see details
HNSC -0.31 0.4 0.500 0.33 3 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
CHOL -0.002 0.5 -0.133 0.37 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis: