miRTarBase - #MIRT543062 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BAZ2A   
Synonyms TIP5, WALp3
Description bromodomain adjacent to zinc finger domain 2A
Transcript NM_013449   
Expression
Putative miRNA Targets on BAZ2A
3'UTR of BAZ2A
(miRNA target sites are highlighted)
>BAZ2A|NM_013449|3'UTR
   1 GGCAAGGGAGGTGGGGAGTCACCTTGTGGCATCTCCCCCCACCTTCCAAACAAAAACCTGCCATTTTCACCTGCTGATGC
  81 TGCCCTGGGTCCAGACTCAAGTCAGATACAACCCTGATTTTTGACCTTGCCCTTGGCAGTGCCCCACATCCTCTTATTCC
 161 TACATCCCTTTCTCCCTTCCCTCCTCTTGCTCCTCAAGTAAGAGGTGCAGAGATGAGGTCCTTCTGGACTAAAAGCCAAA
 241 AAAAGAAAGAAAAAAATAATTTTTCTTTTCTGTTTTATTTGCTAATTAAAAATGGGGAGGGGGAAAGTCGTCCCTACTTC
 321 CTCCTCCCTGCTTCCTCTCCTCCCCTGTACGTGCCCCAGCATTCTGGGGTTATTTAACAATAGCAATAGTTCTAGTGAAT
 401 GTGTGAAACCAAGAAACACTCTGTACTGTGTGCGGACCCGCAGTGACGGCCAGTAAAGTGGACTTAACTCCCAAGTGTGT
 481 CGCGCCGGACACCGGGCCCTGGACATGCTGCTTCCATGTTCAGTCCCTTCCCTGCTTCTCGCTGTCTTTCTTTTCCCACC
 561 TCCCACCCCCCAGTTTTCAGATTTTCTCTCATCCAATAATGTAAAACTATCGTGTACGGGTTCCTCCCTCCTTTTCTCTT
 641 CTCCCAAATCTTTTCCCTTCAAAGGAAAAAAAAATGTTCAGAGGTCCCTGTCTTCTGTCCCCATCTTCCTGCCGATAGCT
 721 ATCCCCTGTATGATGTTGGATGCTCCTCACATGCTGAGTTTCCAGCCTTTTCTGAAACTCAGTAGCTGGGGAGAGGGCAG
 801 GGAGGCTTCCTGGGCCTTCCAGCCTCCTTCCCCACCTCCTTCCCAAACCCTCTTGGGAACTCCTCAGGGACAACTACTGC
 881 TGAGTTTGGGTGCACCCTAAGATGGAGGCCAGGTAGCAATGGGGCCGGCCTCAGAGAGAGCGCTGTGTGTGTGTGTGTGT
 961 GTGTGTGTGTGTGTGTGTGTCGGCCTCAGAGCGCGCTGTGTGTGTGTGTGTGTGTGTCAGCCTCAGAGCGCGCGCTGTGT
1041 GTGTGTGTGTGTGTGCGTGCTTGTGACCCTGTATTGTTTGATAGGATCCATTCAGTTTCCCCAAGTACCTGTTTTCATTC
1121 CCATTTTTCCCATTGTTTAAAACCATCACTTTTTTGTCTTTGGGAAACCACAGGAACAATTTCTCTGGAGACAAGGCTGT
1201 GTCTCTCTCCTGGTCATTTTTGTTCCAGCCTCTTCAGACTGTGCAATCTTTCAGCAGGAACTCCCTCTCTTCTCGGTAGC
1281 TTTGAATCTTAAGCTTCTACGGGAGAGTGGTAGAACTGGATCATTTCCTAATCCCATTTAGTTGTGCTTTTCTTCATTTA
1361 CTTCATACCCCAGGACCCCTTCCCCAGCAGCAGAGACCCTGGAGCACAGGAGAGTAGGGAGGAGGGGTTCTGGGTCCATC
1441 ACTGCCCTACATGTGACTATGTCCAAGTTAAGCCCCCAACACGAGAGGAAAGCTGCTGACTCCCAGCTATAGCCATGGGC
1521 ACTTGGCCCCCTGCTTTTCCTGCTCAGCAGAGCCCCTCCCTTCAGAGATTACGGGTACTTGCACTGGGGAGGTGGCTGCT
1601 GGCTGGCCCAAGCAGAGAGCTGAGGCATCCAAGAAATGTTCCATTGGGGGGTGGGGGTGCCAGGTGAGGTGGAGCATTCC
1681 TTGTATTCTGGCAGCACTGAAGAGCCACTGAAGGGGGTAGGGGCAGTGTAGGTCCTGGGGCAGCCCCTTTATTCCTTTAT
1761 GCCCCTTCTCCCTCATAGCCTATTTCTAAAGTCGCCTTTTCTGTCAGATAAACCTCAAAACTTTTAATTTTATTTGAGAT
1841 TTTTTTTTGCTTTTAAGAGGTGGATTGAAGAATATTTGAATTGACTTTATATTATGCATAAATATTTATATTTTATCTAA
1921 ATAACTGCGCTGTAACAAACTTTGTGTTAGACAGTTGAAACTGTTAGAGTTGGGGGCTCTGCTTTTTCCCCCTGGCAATT
2001 TTCCCCTGGTATAAGATGTGCTAGATTAATTTCATTGTGAGGTGGATGGGGGAGTGAAATTGTGAGGTGGATGGGGGAGT
2081 GAAATCTCCATGGTTCCTGCTTTGTGTTCCTCTCCCAGCTCCATCTCTTTCCCTAGGGACCAGGCACTCATATGGCGGGG
2161 TGGGGTCCTAGCCTCAGTTTGAAGAAGTGGGGGCTGGAGCGGGGTTGGGGGTGGTAGGGATAGGGCATGATCAAAGGGGC
2241 CATTTCTTGCTTTTCTTTCCTCATCTTCACTGCCCCCTTGAGCTAGGTGGATTTTCTCTTCATGACAAGAGTATTTGGTA
2321 GGGAAAGCAGGTTTAAAATAAAAAGACAACCCACCCCCTGCCCTTTTGCTTCCCTCCCATCAGTCTGGTTGACAGGAAGA
2401 AACCACACCATCAACACCAACAAGTTTCTGTGTTCCTTTTACAGCAAAAGGGACTTTTTATATAACCAAATGTGGTGTTT
2481 TAGTGACTTTTTGATAATGTACAGTTTTTTGTGAATTTAAATTTATTTCTTTCTATATTTTTAGGACCAATCTCATTTTT
2561 AATAAGGTTAAAAAGAAAAAAAAAGTCTAGCGAAAAAACTCCTGTTTTTGCCATGTGATGTTCCACAAGTGCAGCTGTAG
2641 AAAAGTGCTTGTCAGTTGTTGAATAAAAAAAACCACATTTGATAGAGATTCAAAAGACTCTGTGTATTCATCTTCCCTTC
2721 TACACACCTGAGGGGGAGACGGCGTTGGGATAGGTATGACTGGCTTAAGAGACCACAGGCAAGGGAACAACAGGGGCTCC
2801 TGTTCCATACCCTCTGTGTGGATGGAAAGGGTCATTAGTGCTCCTGCCTAAATGTCTGGCTGAGTTGCTGGAGCAAAGGG
2881 GGATTCAGTGCATCCAGGTCCTGCCTTGTGAGATGTGGCCCCAGCTTCCTAAGCTGCCACCTCTGTGTTCCTGTCATAGC
2961 AAATATGGGACCATCACCAGCTTACCACTTCCCACTCACGGATAAGACACCAAGACGTAGAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            |:::|| |  |  ||||||| 
Target 5' acCGGGCCCTGGACATGCTGCTt 3'
491 - 513 148.00 -14.12
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ::::||||| ||||| || 
Target 5' aaaGGGTCATTA-GTGCTCCTg 3'
2826 - 2846 134.00 -14.80
3
miRNA  3' guguuUGGUAAUAC-ACGACGau 5'
               ||| |  || ||||||  
Target 5' ttttcACC-TGCTGATGCTGCcc 3'
64 - 85 128.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30179995 22 COSMIC
COSN30649886 35 COSMIC
COSN8864039 56 COSMIC
COSN26582766 112 COSMIC
COSN31551486 249 COSMIC
COSN25840489 565 COSMIC
COSN26643206 641 COSMIC
COSN31529094 650 COSMIC
COSN5324395 663 COSMIC
COSN31524433 665 COSMIC
COSN31557045 800 COSMIC
COSN30541042 813 COSMIC
COSN31583982 853 COSMIC
COSN31545688 854 COSMIC
COSN30541031 934 COSMIC
COSN26464964 956 COSMIC
COSN28734508 1050 COSMIC
COSN8586435 1056 COSMIC
COSN8586434 1060 COSMIC
COSN8586433 1061 COSMIC
COSN30541032 1085 COSMIC
COSN24726462 1215 COSMIC
COSN8586432 1360 COSMIC
COSN22064676 1459 COSMIC
COSN8586431 1509 COSMIC
COSN26579310 1529 COSMIC
COSN7374861 1641 COSMIC
COSN1149924 1659 COSMIC
COSN31584121 1716 COSMIC
COSN22900764 1839 COSMIC
COSN22866379 1840 COSMIC
COSN26642151 1887 COSMIC
COSN27890350 1903 COSMIC
COSN31531631 1988 COSMIC
COSN29127840 2161 COSMIC
COSN31590611 2188 COSMIC
COSN31550090 2454 COSMIC
COSN31571405 2529 COSMIC
COSN26584660 2583 COSMIC
COSN31534708 2592 COSMIC
COSN31537932 2744 COSMIC
COSN28766921 2794 COSMIC
COSN31591499 2829 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757501515 1 dbSNP
rs755887089 3 dbSNP
rs751808465 5 dbSNP
rs1488685658 10 dbSNP
rs1267212191 11 dbSNP
rs377757099 12 dbSNP
rs758827911 13 dbSNP
rs753169300 15 dbSNP
rs765780056 16 dbSNP
rs7970523 25 dbSNP
rs1472153945 29 dbSNP
rs1160991111 30 dbSNP
rs1304069274 30 dbSNP
rs541291566 35 dbSNP
rs1388408364 36 dbSNP
rs1318898495 38 dbSNP
rs1459123939 39 dbSNP
rs773938024 40 dbSNP
rs577151039 41 dbSNP
rs752709754 41 dbSNP
rs775548821 42 dbSNP
rs769881660 43 dbSNP
rs199677708 46 dbSNP
rs1339847640 47 dbSNP
rs1445889322 53 dbSNP
rs867907763 56 dbSNP
rs922618559 57 dbSNP
rs537291849 58 dbSNP
rs570124480 68 dbSNP
rs1366191624 70 dbSNP
rs554722613 76 dbSNP
rs1391490164 79 dbSNP
rs977135231 83 dbSNP
rs952113130 84 dbSNP
rs1028119568 87 dbSNP
rs1259965157 88 dbSNP
rs1278497399 91 dbSNP
rs749370799 109 dbSNP
rs766760944 112 dbSNP
rs986059034 113 dbSNP
rs1449558985 123 dbSNP
rs1255868066 141 dbSNP
rs967915212 142 dbSNP
rs1484453344 146 dbSNP
rs11541997 148 dbSNP
rs970177563 157 dbSNP
rs1256747035 160 dbSNP
rs1401399238 166 dbSNP
rs1024441331 168 dbSNP
rs1204704657 177 dbSNP
rs1022096335 186 dbSNP
rs1389391172 189 dbSNP
rs987895051 195 dbSNP
rs1295625226 197 dbSNP
rs761216218 198 dbSNP
rs1234393860 205 dbSNP
rs773643919 206 dbSNP
rs1274691417 209 dbSNP
rs1034707240 211 dbSNP
rs536751550 213 dbSNP
rs1207352551 227 dbSNP
rs1269348119 228 dbSNP
rs1464925859 235 dbSNP
rs1229029854 236 dbSNP
rs1245797017 244 dbSNP
rs1000264572 245 dbSNP
rs1376785453 253 dbSNP
rs904189721 253 dbSNP
rs1339848702 256 dbSNP
rs1310530456 257 dbSNP
rs1476924376 257 dbSNP
rs1003643257 259 dbSNP
rs904844261 260 dbSNP
rs1397510961 261 dbSNP
rs1024340853 265 dbSNP
rs1412657865 269 dbSNP
rs1306956467 270 dbSNP
rs1005797901 272 dbSNP
rs1049918055 277 dbSNP
rs1393128051 296 dbSNP
rs888623979 302 dbSNP
rs1427501105 303 dbSNP
rs566054542 309 dbSNP
rs547830398 310 dbSNP
rs1329663336 316 dbSNP
rs1168720642 320 dbSNP
rs1289491924 322 dbSNP
rs1329133173 324 dbSNP
rs1227234280 326 dbSNP
rs1265773884 327 dbSNP
rs932430066 335 dbSNP
rs900949505 340 dbSNP
rs1040881195 342 dbSNP
rs1184125659 345 dbSNP
rs1472196210 346 dbSNP
rs1472256691 348 dbSNP
rs930080436 350 dbSNP
rs901291935 351 dbSNP
rs1041125324 355 dbSNP
rs1162850835 366 dbSNP
rs1186061245 371 dbSNP
rs942730816 372 dbSNP
rs1257378466 373 dbSNP
rs1388897003 374 dbSNP
rs1181710273 377 dbSNP
rs1309084072 395 dbSNP
rs939873463 396 dbSNP
rs1276830272 403 dbSNP
rs908451617 411 dbSNP
rs1205914276 425 dbSNP
rs1048314188 433 dbSNP
rs930600945 434 dbSNP
rs920625021 438 dbSNP
rs1353878290 439 dbSNP
rs1207017650 440 dbSNP
rs772409344 447 dbSNP
rs1263545933 458 dbSNP
rs986453968 468 dbSNP
rs1246906788 481 dbSNP
rs528382424 482 dbSNP
rs1186995858 483 dbSNP
rs748575086 484 dbSNP
rs775053942 486 dbSNP
rs769449419 487 dbSNP
rs187968206 490 dbSNP
rs552346754 493 dbSNP
rs1305065575 494 dbSNP
rs1380576591 496 dbSNP
rs1396083071 498 dbSNP
rs981875617 500 dbSNP
rs969498585 516 dbSNP
rs1380116783 518 dbSNP
rs777768517 534 dbSNP
rs780783137 539 dbSNP
rs1005772468 540 dbSNP
rs753742422 541 dbSNP
rs952942218 547 dbSNP
rs1257670007 548 dbSNP
rs530659554 548 dbSNP
rs1387952232 555 dbSNP
rs1284455792 558 dbSNP
rs994327148 564 dbSNP
rs1459948399 565 dbSNP
rs1389814125 566 dbSNP
rs563508205 567 dbSNP
rs1178749394 568 dbSNP
rs1360237169 569 dbSNP
rs1466036368 570 dbSNP
rs1158947472 572 dbSNP
rs1301611763 572 dbSNP
rs1403193184 572 dbSNP
rs1471835225 573 dbSNP
rs1254191558 579 dbSNP
rs1364070391 582 dbSNP
rs1212571886 588 dbSNP
rs1000468734 591 dbSNP
rs901335593 592 dbSNP
rs547930774 593 dbSNP
rs529755111 596 dbSNP
rs1006938783 600 dbSNP
rs1265445328 608 dbSNP
rs1209488493 609 dbSNP
rs1466281780 609 dbSNP
rs1247620190 610 dbSNP
rs1463760089 611 dbSNP
rs569194528 612 dbSNP
rs1043032525 617 dbSNP
rs946631519 620 dbSNP
rs1414888218 623 dbSNP
rs915183101 627 dbSNP
rs1052339016 633 dbSNP
rs1320709470 635 dbSNP
rs1387445351 638 dbSNP
rs1294934515 644 dbSNP
rs765363133 644 dbSNP
rs1226289471 664 dbSNP
rs1330962067 665 dbSNP
rs935185885 666 dbSNP
rs927815711 668 dbSNP
rs1279570201 671 dbSNP
rs1281270714 674 dbSNP
rs36027347 675 dbSNP
rs1435397069 679 dbSNP
rs1229071906 681 dbSNP
rs982270916 684 dbSNP
rs969137334 689 dbSNP
rs1315204858 690 dbSNP
rs540653585 693 dbSNP
rs1325007135 701 dbSNP
rs1488341570 703 dbSNP
rs1449828117 707 dbSNP
rs1389002371 713 dbSNP
rs1473242383 714 dbSNP
rs1159077582 721 dbSNP
rs931259864 723 dbSNP
rs983774807 724 dbSNP
rs1044385411 725 dbSNP
rs948764108 728 dbSNP
rs952370914 734 dbSNP
rs917327144 743 dbSNP
rs1352252671 745 dbSNP
rs1410289712 752 dbSNP
rs1287664952 763 dbSNP
rs1348569279 785 dbSNP
rs1230140826 792 dbSNP
rs1290831612 795 dbSNP
rs992883776 809 dbSNP
rs1455923471 810 dbSNP
rs1414665666 816 dbSNP
rs956182604 821 dbSNP
rs1159365372 824 dbSNP
rs1231699452 826 dbSNP
rs924814617 831 dbSNP
rs1183150683 833 dbSNP
rs577116743 835 dbSNP
rs1375964691 845 dbSNP
rs1161290923 850 dbSNP
rs994377990 856 dbSNP
rs1372117202 862 dbSNP
rs1430191960 867 dbSNP
rs1307295639 873 dbSNP
rs1333958198 875 dbSNP
rs746954240 876 dbSNP
rs755871074 879 dbSNP
rs1019744585 882 dbSNP
rs373035110 883 dbSNP
rs1247273936 889 dbSNP
rs1300120555 895 dbSNP
rs1343265037 905 dbSNP
rs565479170 919 dbSNP
rs1007397419 920 dbSNP
rs1271481800 922 dbSNP
rs1444696701 923 dbSNP
rs78884607 926 dbSNP
rs1466083986 927 dbSNP
rs1443497090 930 dbSNP
rs61939877 939 dbSNP
rs1391665163 941 dbSNP
rs182401345 941 dbSNP
rs1011612551 942 dbSNP
rs1342491809 943 dbSNP
rs1319369969 944 dbSNP
rs1435178669 945 dbSNP
rs867748944 945 dbSNP
rs1300051778 954 dbSNP
rs140158716 954 dbSNP
rs1233279953 957 dbSNP
rs1019335211 961 dbSNP
rs1363848706 965 dbSNP
rs1320396007 970 dbSNP
rs1433616657 971 dbSNP
rs61939876 976 dbSNP
rs1391276174 979 dbSNP
rs763796453 980 dbSNP
rs1192028328 981 dbSNP
rs1201274496 981 dbSNP
rs1220261769 981 dbSNP
rs1249491827 981 dbSNP
rs1268860367 981 dbSNP
rs1278566638 981 dbSNP
rs1347588801 981 dbSNP
rs1371069676 981 dbSNP
rs1460452879 981 dbSNP
rs1478897615 981 dbSNP
rs1491400381 981 dbSNP
rs35960815 981 dbSNP
rs71081383 981 dbSNP
rs749192307 981 dbSNP
rs750995317 981 dbSNP
rs866517157 981 dbSNP
rs79769173 982 dbSNP
rs1259268078 983 dbSNP
rs536357599 983 dbSNP
rs1319452874 984 dbSNP
rs1414287850 985 dbSNP
rs1400272048 986 dbSNP
rs1174545300 987 dbSNP
rs1454711859 988 dbSNP
rs1389703154 990 dbSNP
rs1186578579 991 dbSNP
rs1394948735 991 dbSNP
rs1453174755 991 dbSNP
rs1451306519 992 dbSNP
rs191031586 993 dbSNP
rs1242452895 994 dbSNP
rs935195709 995 dbSNP
rs1209117357 996 dbSNP
rs1210212644 997 dbSNP
rs1237751534 997 dbSNP
rs1258555503 997 dbSNP
rs1289546673 997 dbSNP
rs1335789845 997 dbSNP
rs1412156853 997 dbSNP
rs1459829781 997 dbSNP
rs1184197570 998 dbSNP
rs1252494404 998 dbSNP
rs1440509323 998 dbSNP
rs1280230091 999 dbSNP
rs1211163897 1000 dbSNP
rs1340843835 1001 dbSNP
rs1294844973 1002 dbSNP
rs1163189475 1004 dbSNP
rs1226813227 1004 dbSNP
rs1367920306 1006 dbSNP
rs1271305305 1008 dbSNP
rs1402502567 1010 dbSNP
rs927801683 1011 dbSNP
rs1357785135 1013 dbSNP
rs1003983746 1015 dbSNP
rs1336395719 1017 dbSNP
rs1171439081 1018 dbSNP
rs1258281191 1018 dbSNP
rs1304324012 1018 dbSNP
rs1313957074 1018 dbSNP
rs1341751445 1018 dbSNP
rs781134279 1018 dbSNP
rs796428343 1018 dbSNP
rs12296335 1019 dbSNP
rs1370000275 1020 dbSNP
rs1383656677 1021 dbSNP
rs1166834783 1022 dbSNP
rs1431740411 1025 dbSNP
rs1420082857 1027 dbSNP
rs1169684899 1028 dbSNP
rs1181223231 1028 dbSNP
rs1046206222 1029 dbSNP
rs1354456316 1029 dbSNP
rs1305129605 1030 dbSNP
rs947863233 1031 dbSNP
rs572609088 1032 dbSNP
rs916362782 1033 dbSNP
rs1434061612 1034 dbSNP
rs186129188 1034 dbSNP
rs952422299 1035 dbSNP
rs1225085534 1036 dbSNP
rs1271824426 1036 dbSNP
rs1295942673 1036 dbSNP
rs1306719986 1036 dbSNP
rs1491265976 1036 dbSNP
rs1491512276 1036 dbSNP
rs1241510404 1037 dbSNP
rs1466468684 1037 dbSNP
rs374170790 1037 dbSNP
rs1189465062 1038 dbSNP
rs1419187014 1039 dbSNP
rs1427133192 1039 dbSNP
rs1206615371 1041 dbSNP
rs1307580258 1043 dbSNP
rs1259321868 1045 dbSNP
rs1274237809 1045 dbSNP
rs1228316266 1046 dbSNP
rs201469429 1047 dbSNP
rs1295552185 1048 dbSNP
rs1415592883 1049 dbSNP
rs1048212961 1050 dbSNP
rs1350058824 1051 dbSNP
rs995770845 1052 dbSNP
rs74095013 1054 dbSNP
rs1303283781 1055 dbSNP
rs1222974997 1056 dbSNP
rs1261261257 1056 dbSNP
rs1324260452 1056 dbSNP
rs138865943 1056 dbSNP
rs202206071 1056 dbSNP
rs56185332 1056 dbSNP
rs761396302 1056 dbSNP
rs1365914549 1057 dbSNP
rs1355192339 1058 dbSNP
rs1230189434 1060 dbSNP
rs867769098 1060 dbSNP
rs1020217200 1061 dbSNP
rs1163986826 1063 dbSNP
rs1403596999 1068 dbSNP
rs1220782956 1071 dbSNP
rs75648492 1079 dbSNP
rs1165434598 1083 dbSNP
rs954340554 1084 dbSNP
rs1249088574 1086 dbSNP
rs948691034 1097 dbSNP
rs1183899509 1098 dbSNP
rs895825913 1109 dbSNP
rs539083138 1114 dbSNP
rs1385526549 1119 dbSNP
rs1021751871 1129 dbSNP
rs373359351 1136 dbSNP
rs1011663381 1137 dbSNP
rs891803439 1148 dbSNP
rs868197404 1151 dbSNP
rs1221442730 1158 dbSNP
rs1410399254 1159 dbSNP
rs934730631 1160 dbSNP
rs1352795998 1163 dbSNP
rs1450342560 1169 dbSNP
rs924711767 1182 dbSNP
rs190233546 1186 dbSNP
rs552146933 1187 dbSNP
rs1244226271 1194 dbSNP
rs565196470 1195 dbSNP
rs1300186261 1196 dbSNP
rs906474766 1201 dbSNP
rs947575672 1203 dbSNP
rs1046732337 1207 dbSNP
rs765892607 1208 dbSNP
rs975664863 1228 dbSNP
rs537355252 1236 dbSNP
rs1475632489 1237 dbSNP
rs569717313 1246 dbSNP
rs1417355113 1252 dbSNP
rs1470988801 1252 dbSNP
rs1048137039 1255 dbSNP
rs1286613557 1263 dbSNP
rs142527594 1271 dbSNP
rs918263580 1275 dbSNP
rs1430516961 1276 dbSNP
rs1347822709 1284 dbSNP
rs1224813836 1290 dbSNP
rs1019304066 1293 dbSNP
rs972346651 1300 dbSNP
rs529718434 1301 dbSNP
rs758200073 1302 dbSNP
rs559068014 1309 dbSNP
rs1447341943 1312 dbSNP
rs1192275855 1316 dbSNP
rs1240280153 1332 dbSNP
rs1481336636 1334 dbSNP
rs1064244 1340 dbSNP
rs986108327 1341 dbSNP
rs1027190599 1346 dbSNP
rs1468325082 1352 dbSNP
rs185778274 1361 dbSNP
rs1400481575 1368 dbSNP
rs1316768920 1376 dbSNP
rs181604169 1380 dbSNP
rs905035182 1382 dbSNP
rs189193634 1392 dbSNP
rs1409562222 1395 dbSNP
rs1013466555 1398 dbSNP
rs956085427 1402 dbSNP
rs1262108883 1408 dbSNP
rs1351029678 1409 dbSNP
rs1031743010 1410 dbSNP
rs148399689 1421 dbSNP
rs1281807290 1427 dbSNP
rs1490785077 1437 dbSNP
rs576692851 1439 dbSNP
rs907190416 1440 dbSNP
rs1223079624 1442 dbSNP
rs1268147068 1444 dbSNP
rs934695814 1455 dbSNP
rs1184152477 1459 dbSNP
rs1435598901 1465 dbSNP
rs1024932476 1477 dbSNP
rs1012540863 1483 dbSNP
rs894992782 1485 dbSNP
rs1419353316 1491 dbSNP
rs1469759197 1492 dbSNP
rs1423817375 1493 dbSNP
rs1188906778 1496 dbSNP
rs1367796013 1504 dbSNP
rs1489187223 1509 dbSNP
rs1255379980 1516 dbSNP
rs1364314980 1521 dbSNP
rs903258493 1528 dbSNP
rs1308431550 1530 dbSNP
rs1048189216 1537 dbSNP
rs931080771 1539 dbSNP
rs947539441 1540 dbSNP
rs921450811 1541 dbSNP
rs896930560 1548 dbSNP
rs1266691013 1549 dbSNP
rs1037174110 1554 dbSNP
rs943751069 1558 dbSNP
rs373031616 1565 dbSNP
rs1489859376 1566 dbSNP
rs1197494531 1573 dbSNP
rs1251264147 1584 dbSNP
rs912210389 1585 dbSNP
rs1317792208 1608 dbSNP
rs1437341066 1609 dbSNP
rs944258810 1611 dbSNP
rs755264013 1622 dbSNP
rs535527183 1631 dbSNP
rs1217486470 1636 dbSNP
rs1163419423 1641 dbSNP
rs575974422 1644 dbSNP
rs951156334 1646 dbSNP
rs561311758 1647 dbSNP
rs990341429 1648 dbSNP
rs969228829 1650 dbSNP
rs1434353111 1651 dbSNP
rs1013394443 1652 dbSNP
rs1023409943 1652 dbSNP
rs1319718577 1653 dbSNP
rs78470960 1656 dbSNP
rs1251850341 1657 dbSNP
rs924725342 1660 dbSNP
rs1338793649 1673 dbSNP
rs1290455059 1697 dbSNP
rs1194208077 1709 dbSNP
rs1245194511 1714 dbSNP
rs572571722 1714 dbSNP
rs1358166134 1717 dbSNP
rs1173537547 1718 dbSNP
rs971426704 1721 dbSNP
rs1171693997 1723 dbSNP
rs1373055551 1728 dbSNP
rs1461035138 1731 dbSNP
rs1023356303 1751 dbSNP
rs1012180942 1754 dbSNP
rs1012088501 1762 dbSNP
rs1434333673 1768 dbSNP
rs1335699326 1775 dbSNP
rs899946659 1780 dbSNP
rs959256067 1783 dbSNP
rs1296184147 1785 dbSNP
rs1325851484 1786 dbSNP
rs1026837690 1794 dbSNP
rs1449447836 1808 dbSNP
rs1246545549 1812 dbSNP
rs1207224657 1814 dbSNP
rs912811940 1819 dbSNP
rs1486412708 1824 dbSNP
rs1255559814 1826 dbSNP
rs1187531336 1829 dbSNP
rs1487039702 1829 dbSNP
rs1047771835 1833 dbSNP
rs1427192302 1836 dbSNP
rs919606266 1836 dbSNP
rs929621041 1836 dbSNP
rs973791768 1837 dbSNP
rs545641895 1840 dbSNP
rs995327196 1840 dbSNP
rs187426997 1842 dbSNP
rs1455146447 1844 dbSNP
rs1289160624 1849 dbSNP
rs1398012678 1849 dbSNP
rs916368984 1849 dbSNP
rs991943381 1854 dbSNP
rs1227532590 1863 dbSNP
rs896984298 1864 dbSNP
rs1297663380 1868 dbSNP
rs1299446175 1886 dbSNP
rs1382516467 1889 dbSNP
rs554348689 1895 dbSNP
rs1216779620 1896 dbSNP
rs1260448571 1901 dbSNP
rs1487525438 1908 dbSNP
rs1225323241 1917 dbSNP
rs1270288826 1925 dbSNP
rs1378179366 1927 dbSNP
rs1036821796 1928 dbSNP
rs556515027 1929 dbSNP
rs116345318 1939 dbSNP
rs967376170 1949 dbSNP
rs1344341810 1950 dbSNP
rs756912824 1964 dbSNP
rs1427303757 1967 dbSNP
rs1291793216 1970 dbSNP
rs1371798642 1992 dbSNP
rs1375638486 1993 dbSNP
rs1022032044 2003 dbSNP
rs1224494938 2012 dbSNP
rs1351927615 2015 dbSNP
rs932287102 2015 dbSNP
rs914855329 2026 dbSNP
rs777033145 2030 dbSNP
rs771257168 2033 dbSNP
rs768012212 2041 dbSNP
rs934855840 2042 dbSNP
rs536176788 2048 dbSNP
rs924736365 2049 dbSNP
rs1008359280 2054 dbSNP
rs556543785 2056 dbSNP
rs536931012 2057 dbSNP
rs1204459243 2062 dbSNP
rs1340153370 2071 dbSNP
rs144517803 2073 dbSNP
rs377256673 2076 dbSNP
rs971861969 2078 dbSNP
rs762103637 2085 dbSNP
rs537225626 2086 dbSNP
rs1239310802 2089 dbSNP
rs548078248 2090 dbSNP
rs1310375725 2097 dbSNP
rs1356315345 2100 dbSNP
rs774719150 2110 dbSNP
rs1297804184 2114 dbSNP
rs1375035606 2126 dbSNP
rs1454915673 2134 dbSNP
rs1316094522 2142 dbSNP
rs1359200308 2147 dbSNP
rs1227060482 2150 dbSNP
rs1416213943 2154 dbSNP
rs930236354 2155 dbSNP
rs1307054541 2156 dbSNP
rs920220936 2156 dbSNP
rs1456126301 2160 dbSNP
rs928159900 2161 dbSNP
rs991920088 2162 dbSNP
rs1243476680 2164 dbSNP
rs1398089271 2165 dbSNP
rs982152674 2166 dbSNP
rs952032437 2170 dbSNP
rs1161364998 2176 dbSNP
rs1421631950 2180 dbSNP
rs182328814 2184 dbSNP
rs1170149619 2188 dbSNP
rs1026891389 2189 dbSNP
rs995379513 2191 dbSNP
rs961197054 2200 dbSNP
rs916293801 2203 dbSNP
rs969484120 2205 dbSNP
rs991879340 2212 dbSNP
rs1368221503 2226 dbSNP
rs1163174683 2230 dbSNP
rs1363352059 2234 dbSNP
rs1015808333 2247 dbSNP
rs1214500907 2249 dbSNP
rs1256808505 2253 dbSNP
rs1007990131 2254 dbSNP
rs1476403862 2260 dbSNP
rs377263227 2266 dbSNP
rs550393813 2266 dbSNP
rs1181734578 2275 dbSNP
rs1482113449 2278 dbSNP
rs769291076 2281 dbSNP
rs1196282839 2287 dbSNP
rs1488140484 2298 dbSNP
rs1263649359 2300 dbSNP
rs1234856372 2301 dbSNP
rs1201775719 2303 dbSNP
rs1348119545 2304 dbSNP
rs565545615 2311 dbSNP
rs1185222225 2312 dbSNP
rs1335253977 2316 dbSNP
rs1192882186 2318 dbSNP
rs1475664187 2318 dbSNP
rs1421519008 2326 dbSNP
rs996548660 2327 dbSNP
rs1177386063 2328 dbSNP
rs892805967 2335 dbSNP
rs1413117154 2339 dbSNP
rs1226249170 2342 dbSNP
rs1320613210 2345 dbSNP
rs1346173995 2345 dbSNP
rs1430583298 2349 dbSNP
rs1276895826 2350 dbSNP
rs74095012 2352 dbSNP
rs1224875809 2354 dbSNP
rs934867311 2355 dbSNP
rs1385762688 2357 dbSNP
rs1198378983 2359 dbSNP
rs1286022797 2361 dbSNP
rs1447393865 2362 dbSNP
rs1260998402 2364 dbSNP
rs1390585309 2364 dbSNP
rs1324483016 2367 dbSNP
rs1200312890 2369 dbSNP
rs1377142308 2372 dbSNP
rs1477129159 2378 dbSNP
rs1160538363 2379 dbSNP
rs1409127391 2381 dbSNP
rs1419524204 2381 dbSNP
rs1368074757 2383 dbSNP
rs1463280619 2383 dbSNP
rs1419118927 2404 dbSNP
rs924819193 2407 dbSNP
rs1323571326 2410 dbSNP
rs1330018538 2410 dbSNP
rs1230558744 2414 dbSNP
rs1158692261 2415 dbSNP
rs1351096964 2416 dbSNP
rs1239226563 2417 dbSNP
rs1468844173 2419 dbSNP
rs1365578401 2420 dbSNP
rs1490800943 2421 dbSNP
rs1223147824 2422 dbSNP
rs1182574279 2424 dbSNP
rs546158249 2430 dbSNP
rs1184212935 2432 dbSNP
rs759193895 2435 dbSNP
rs1233716729 2437 dbSNP
rs1439461433 2444 dbSNP
rs752079794 2450 dbSNP
rs1157304731 2460 dbSNP
rs1251005015 2461 dbSNP
rs1425785479 2462 dbSNP
rs950225018 2467 dbSNP
rs1163219514 2469 dbSNP
rs1215496189 2470 dbSNP
rs553574694 2471 dbSNP
rs112462490 2472 dbSNP
rs1377267339 2473 dbSNP
rs1445586435 2477 dbSNP
rs1206402713 2478 dbSNP
rs930682463 2482 dbSNP
rs1361356361 2483 dbSNP
rs1246573892 2487 dbSNP
rs1264836915 2493 dbSNP
rs1352338248 2499 dbSNP
rs1354311299 2500 dbSNP
rs1197690594 2502 dbSNP
rs1251515385 2510 dbSNP
rs1245305588 2511 dbSNP
rs1457433706 2511 dbSNP
rs775933407 2511 dbSNP
rs1445658091 2518 dbSNP
rs920555497 2525 dbSNP
rs1231812529 2529 dbSNP
rs1169075066 2532 dbSNP
rs1328851202 2533 dbSNP
rs768888513 2535 dbSNP
rs1328909611 2536 dbSNP
rs1384687418 2538 dbSNP
rs1301873457 2549 dbSNP
rs1311904634 2550 dbSNP
rs533705738 2551 dbSNP
rs1338701904 2554 dbSNP
rs1229531042 2562 dbSNP
rs1258731686 2568 dbSNP
rs1317401921 2570 dbSNP
rs1196946979 2574 dbSNP
rs1443829886 2575 dbSNP
rs1254515253 2585 dbSNP
rs1430753224 2585 dbSNP
rs1462032768 2585 dbSNP
rs150560035 2585 dbSNP
rs3041374 2585 dbSNP
rs1395644733 2586 dbSNP
rs1423672305 2590 dbSNP
rs973967909 2591 dbSNP
rs1399353272 2592 dbSNP
rs1466357153 2593 dbSNP
rs1387355641 2598 dbSNP
rs1383803274 2608 dbSNP
rs1159382005 2616 dbSNP
rs1477703611 2619 dbSNP
rs1393423426 2629 dbSNP
rs1312921642 2631 dbSNP
rs1209698794 2633 dbSNP
rs1254582315 2635 dbSNP
rs1195397839 2645 dbSNP
rs1263165326 2646 dbSNP
rs1487669658 2647 dbSNP
rs1190961318 2651 dbSNP
rs1430797966 2653 dbSNP
rs961560711 2655 dbSNP
rs532096486 2661 dbSNP
rs1454684176 2662 dbSNP
rs1433354395 2663 dbSNP
rs1174948119 2665 dbSNP
rs374782971 2665 dbSNP
rs1247374846 2669 dbSNP
rs113902268 2672 dbSNP
rs112145410 2673 dbSNP
rs11324344 2673 dbSNP
rs1375684919 2673 dbSNP
rs398019726 2673 dbSNP
rs1298713826 2675 dbSNP
rs201224590 2675 dbSNP
rs1359894923 2676 dbSNP
rs1398073787 2678 dbSNP
rs1304969776 2681 dbSNP
rs1368421866 2682 dbSNP
rs571119877 2683 dbSNP
rs772240047 2684 dbSNP
rs866083173 2684 dbSNP
rs866126459 2687 dbSNP
rs373207432 2692 dbSNP
rs1448531504 2696 dbSNP
rs1015444979 2700 dbSNP
rs1285926337 2702 dbSNP
rs968356845 2702 dbSNP
rs1022245966 2706 dbSNP
rs987066861 2709 dbSNP
rs1284436695 2711 dbSNP
rs1488541734 2713 dbSNP
rs955227362 2713 dbSNP
rs549785279 2717 dbSNP
rs1028530514 2720 dbSNP
rs1420645450 2722 dbSNP
rs996559617 2723 dbSNP
rs1158953087 2725 dbSNP
rs1281905208 2730 dbSNP
rs892816027 2731 dbSNP
rs1032652166 2734 dbSNP
rs1417730382 2735 dbSNP
rs763766971 2736 dbSNP
rs1008326741 2737 dbSNP
rs903458671 2738 dbSNP
rs1045965367 2740 dbSNP
rs950296027 2741 dbSNP
rs555721668 2743 dbSNP
rs894639535 2744 dbSNP
rs1055806329 2750 dbSNP
rs1297545346 2752 dbSNP
rs1375178103 2752 dbSNP
rs994383293 2758 dbSNP
rs898742075 2761 dbSNP
rs930693844 2763 dbSNP
rs1328572042 2765 dbSNP
rs1321777690 2767 dbSNP
rs1220268310 2778 dbSNP
rs1263169610 2780 dbSNP
rs1038620508 2782 dbSNP
rs947691175 2789 dbSNP
rs894828856 2791 dbSNP
rs1437637641 2793 dbSNP
rs144260932 2794 dbSNP
rs1414521272 2796 dbSNP
rs1404836452 2799 dbSNP
rs561675168 2802 dbSNP
rs773505412 2811 dbSNP
rs940683632 2814 dbSNP
rs908488982 2816 dbSNP
rs1330971951 2817 dbSNP
rs1454964792 2822 dbSNP
rs1285294483 2824 dbSNP
rs986733753 2825 dbSNP
rs1227117605 2830 dbSNP
rs955386620 2848 dbSNP
rs1309896639 2856 dbSNP
rs140517636 2858 dbSNP
rs1389415368 2860 dbSNP
rs1184709998 2865 dbSNP
rs1257086843 2874 dbSNP
rs1476267788 2876 dbSNP
rs1456266970 2881 dbSNP
rs772128195 2882 dbSNP
rs974664903 2887 dbSNP
rs957087793 2892 dbSNP
rs1018303716 2897 dbSNP
rs1032745620 2900 dbSNP
rs1425820520 2903 dbSNP
rs147184305 2915 dbSNP
rs770472826 2924 dbSNP
rs560672009 2927 dbSNP
rs902839559 2928 dbSNP
rs955436332 2932 dbSNP
rs1335203098 2941 dbSNP
rs1210920076 2955 dbSNP
rs1340864179 2959 dbSNP
rs143755262 2964 dbSNP
rs1446408415 2965 dbSNP
rs1272843657 2966 dbSNP
rs1341811675 2967 dbSNP
rs1277176360 2969 dbSNP
rs1025015042 2970 dbSNP
rs1341899955 2973 dbSNP
rs1025768154 2975 dbSNP
rs1279011717 2977 dbSNP
rs1441667329 2985 dbSNP
rs1207899716 2991 dbSNP
rs746507371 2991 dbSNP
rs994706090 2992 dbSNP
rs1488652615 2997 dbSNP
rs184495493 2999 dbSNP
rs1012472820 3000 dbSNP
rs1017575812 3000 dbSNP
rs1173405165 3008 dbSNP
rs895425970 3010 dbSNP
rs1056044202 3016 dbSNP
rs772159682 3017 dbSNP
rs1399937719 3023 dbSNP
rs939053936 3023 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUA-AUACACGACGAu 5'
            |:::|| |  |  ||||||| 
Target 5' acCGGGCCCUGGACAUGCUGCUu 3'
7 - 29
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000379441.3 | 3UTR | CCGGACACCGGGCCCUGGACAUGCUGCUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.351 4.3e-2 -0.427 1.7e-2 25 Click to see details
GSE19536 Breast cancer 0.163 5.3e-2 0.150 6.8e-2 100 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.365 5.7e-2 -0.651 9.4e-4 20 Click to see details
GSE21032 Prostate cancer 0.164 6.9e-2 0.118 1.4e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.42 7.7e-2 -0.445 6.4e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.29 8.5e-2 -0.303 7.5e-2 24 Click to see details
GSE28544 Breast cancer -0.239 1.3e-1 -0.617 6.6e-4 24 Click to see details
GSE19783 ER- ER- breast cancer 0.126 1.3e-1 0.159 8.1e-2 79 Click to see details
GSE19350 CNS germ cell tumors -0.327 1.5e-1 -0.545 3.3e-2 12 Click to see details
GSE17306 Multiple myeloma 0.133 1.8e-1 0.114 2.2e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.161 1.9e-1 0.266 7.1e-2 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.153 2.3e-1 -0.105 3.1e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.154 2.4e-1 0.129 2.8e-1 23 Click to see details
GSE14794 Lymphoblastoid cells -0.068 2.6e-1 -0.010 4.6e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer -0.122 3.0e-1 -0.215 1.8e-1 20 Click to see details
GSE17498 Multiple myeloma -0.049 3.8e-1 -0.124 2.2e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.038 3.8e-1 0.002 4.9e-1 64 Click to see details
GSE38226 Liver fibrosis 0.065 3.9e-1 0.139 2.7e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.053 4.2e-1 0.115 3.4e-1 16 Click to see details
GSE21849 B cell lymphoma -0.03 4.4e-1 -0.162 2.0e-1 29 Click to see details
GSE21849 B cell lymphoma -0.03 4.4e-1 -0.162 2.0e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.354 0.02 -0.381 0.02 32 Click to see details
COAD 0.701 0.03 0.571 0.07 8 Click to see details
LUAD 0.53 0.04 0.350 0.13 12 Click to see details
PAAD 0.873 0.06 0.800 0.1 4 Click to see details
PRAD 0.216 0.07 0.166 0.12 50 Click to see details
BLCA 0.327 0.09 0.366 0.07 18 Click to see details
CHOL -0.36 0.17 -0.500 0.09 9 Click to see details
STAD 0.133 0.23 0.168 0.18 32 Click to see details
HNSC 0.081 0.31 0.093 0.28 42 Click to see details
KICH 0.105 0.31 0.144 0.25 25 Click to see details
UCEC -0.118 0.32 -0.189 0.22 19 Click to see details
PCPG -0.547 0.32 -0.500 0.33 3 Click to see details
LIHC 0.033 0.41 0.063 0.33 49 Click to see details
CESC 0.273 0.41 0.500 0.33 3 Click to see details
ESCA 0.055 0.44 -0.027 0.47 11 Click to see details
THCA -0.013 0.46 -0.068 0.3 59 Click to see details
LUSC 0.007 0.48 0.049 0.39 38 Click to see details
KIRC 0.004 0.49 0.032 0.4 68 Click to see details
BRCA -0.002 0.49 -0.024 0.41 84 Click to see details
BRCA -0.002 0.49 -0.024 0.41 84 Click to see details
BRCA -0.002 0.49 -0.024 0.41 84 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated