miRTarBase - #MIRT543310 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF585B   
Synonyms SZFP41
Description zinc finger protein 585B
Transcript NM_152279   
Expression
Putative miRNA Targets on ZNF585B
3'UTR of ZNF585B
(miRNA target sites are highlighted)
>ZNF585B|NM_152279|3'UTR
   1 GAGAAACAGTGTGAGAAAACCCCCCTGAGGGTTGGGTCTGATTGTACACTGTTGCACGCATGCAGCAGAAAAATATGTAT
  81 ATTATTGTAAATAGAAATGACCACATCAGAATGTCACACATGGCTGTTCTGGAGAGGGCCTCTGAGAAGGCACTGAATGA
 161 GGCGAGGGACCCTTCCTACATTGTCACCATCCCCAGTAAACCTTGGGTCATTATTCATACTGACAAGGAACCGAGTCAAT
 241 TTGGTGAATAGGAAAAGCCTTCTCATGAAAACTACAATAGAATACTGTTACCAAATTCTTCATAAGAAAGATCATATTAT
 321 GGGAATGATAATCCTGTTTACTGTGGATTAGGTATAGTGCCAACAGTTTGAATGGTAAGACAACATAATATATATGATAG
 401 TGATGAATCCTTCTGTGAGTTGTTTGTTCCAGAACACACTGTCTAGTAGAATTGTGGGTATTTTCTTCTTTTGAATCGAA
 481 CACAGTTGTGCATATCCAATTCCCCATTGAGTATTTCTATCAAGCAAGAGATACTGCAATAAGACAAACTCCCTGTGTAT
 561 TCAGACACAGACCTCAGAGCGTATGTTGAGTCCCCATTGTCATAGAAAAAGACTTACAGTCCCCTTCATTATCTGCCAGG
 641 ACTCTCTCTGAGCCCCACAGGTTCTCAGCACATTGTGTTTGACACCCAGCACAGTGTTTTTTCTTTTTCTTTCTTTCTTT
 721 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCCTTCTTTCTTTCTTTTT
 801 CTTTCTTTCTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTGAGACA
 881 GAGTCTTGCTCTGTCGGGCAAGCTAGAGTGCAGTGGCGCTATCTTGGCTCACTGCAACCTCCGTCTCCCGGGCTCAAGCA
 961 ATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTGCGTGTGCCACCACGCCCAGCTAATTTTTGTATGTTTAGTAGAAA
1041 CGGGGGTTTCACCATGCTGGCCAGGCTGGTCTCGAACTCCTGACCTCATGATCCGCCCGCCTCGGCCTCCCAAAGTCCTG
1121 GGATTACGGACGTGAGCCACTGCGCCCGGCCCAGCACAGTGTTTTGTACACTCCCACCACCCTCAAGAAAGCCTTTGAGG
1201 TTAGGATTTTCAGGTCATCTGGGAGAACTTAAATTCTTCCTTCTGCTATTACAATTCTTCTCACTCAGTTGCCTGCCTCT
1281 TTTTTTTTTTTAATTTACTTGTGACTGAGTTGAAGCCCAGCATTTTACTTTCCTTAATGATCTGACTTTCATAAGTTGAT
1361 AAGTCATGAAATCATTATCTTACATTATATGAGATATGAGATAAATCATAAATCATATGAAATTGATAACTCATATGAAA
1441 ACCAACCCCACCATATGTTCACTGTCTACTTGTGTCCATCTTCGTCCCACGCACCCCACAAGGACCTTCCCCGCCATGTG
1521 CCTCAAACATCAGTTCCTGACTCAGGGCCTTTGTATTTGCAGTGCCCGTTGCAAAGAGCACAATTCTTTATTTTATCTGT
1601 GGCTTGTCCGTCATGTCTTTTTTTCCATGACACCTCCACACAGGCCTTCCCTGCCTGCCTGGTTTAAAATTCCAGCCCCT
1681 TACCCTTCCTCCTTTATTCTTCTCCCTAGCAATTTCCACCATGCTGCCTGGTGTATTTTCCTCATTTCTCTGTGGCTTCT
1761 ACACTAGAAAATATTTCCCTTTTGTTCACCACTATGAGTCTAGACCCATGACTGCCATACAGCAGGCATTCCATAAATGC
1841 ACCTGTGGAGAGTTGACCCATGCTTGTTGCGTGACTTCTGTCTGATTTTTTTCTGTGTTGCAGCATAAGAAGCGCTAATA
1921 GGGAGAACCAACTTGGCTAAAACACACCAGGCTTTTTCACCTCTAGTCTGTACCTGGGCTGTATCCCTTCTCAACCCTAA
2001 AGCTAAAAAGTCATTGTGAACCTTTTGGTCTGATGCTAAAGAAGGGAAAACAGGTACAGGAAATCCCATGTGGATGCTTG
2081 CTTCCAGGATTTCCTGCCATGATTCCAGAATCCCACAGCTCCAACATGATTGCAAAAGACTCCCTGCTCATTTTTCCTCA
2161 GCATGCACAGCGCTGTCCTGTCTCAGTTGCAACTCGACAGAGCCGCATTTACTCCAGAACCCAATCCACACACCTGCTCA
2241 TCCTGCCCCGAGAGGAGTGCCTGAAGCCAATAGCAGGGAACTAGAGCAGACTTGGGTGGATCTTCATTGGATATTAGGTA
2321 TCTTGCCCTAGATAGGCAGCAGTGGCCTTACAGATGCTGACAGATGATCTGATTAGATGCACAGTTGCTGGGTGGCGTCT
2401 GGGGCCAGTCTATTGGCAGTTCTGGGAGTGGGAACTATTTGGGCTCTGCAAAGATGGTTTCACCTTTAAGAAGGGCAGTA
2481 TGGGGAGGTGAAGATGGGGCCCAAAGGATAGAACATAGTCAAAGAAGCAGGGCCACAATGCCCCTTTAATTCCCAAGCCC
2561 TAGTTGGGCAGTGCTTGGTGACACATCCCATTACCTCACCTTAGATCAATGTCTACTGAGCCATCATTAGCTCTGCTTCC
2641 TCACTTCTTCACAGTATCTGATGGCCCATCACATGCTGCTCAACATCTTAGACCAATGTCTGCTCACCCATTACCTCCCT
2721 TCACCTCATCCAGCACTGTATCTGAAGCTTCACTATTCTTCCTTCAGTTTTGGATATTTTGTGATACAACATTATCCCCA
2801 ACTTAGGACAATGTCAGCTGACTCTCAGGAGGGTGCCTGGAGATCACCTCTTCCTTCCTAACATACCCTAGAACAAGGTC
2881 TGGTCCCCTTCATTATTCCCATTTTACCTTACTCCTAAGTGTATCACTCCTCATGAATTCCAGGAAATATGGAGGAAAAC
2961 ACATTTCACTGTACATGACTTTCAATAATTTCTCCTTTATATTTATTGTAACGTGATATTTTAGTGCTGACATATATATG
3041 TATATGTATGCCCATTTATATAAAAGACTAGTTTTTAGAGAAATTTTAGGTTCACAGCAAAATGGGGCAGAAGGTACAGA
3121 GATTTCCCATATATCCCCTACCCTCACATATACACAGCCTCCCCCATCATCAACATCCCCCTTCAGAGTGGTACATTTGT
3201 TACAATTGATGAAACTACATTGACACTATCGGCCAAAGTCCATGGTTTAATTAGGGTTCAGTCTTGATGTGCATTCTGTG
3281 GGTTGAGACAAATGAATAATGACATGTATGCATTATTACAGAAGGATAAAGAGCCGTTTCACTGTCCCAATAATCCTCTG
3361 TGTTTCGCCTACTCCTCTAAACTCCTGGCTATTTTCTTTTGTCTCCATAATTTTGCCTCTGAACCATAAAGTATGCAGCC
3441 TTTTCAGATTGATTTGTTTCACTTAGTAATGTGGATTTAAGTTTCTTCCATGTCTTTTCGTAGCTTGCTAGCTCTTTTTT
3521 TTTTTTTTTTCTCATTGAATAATATGCTATTGTCTGGAAGTACCATGACTTATTTATCCATTCACCTACTGAAGGACACC
3601 TTAATTGCTTCCAAGTTTTGTTGATTATGAATAAAGATGCTATAAACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuGGUAAUACACGACGAu 5'
                |||| |  ||||||| 
Target 5' gatggcCCATCACATGCTGCTc 3'
2660 - 2681 156.00 -11.80
2
miRNA  3' guGUUUGGUAA--UACACGACGAu 5'
            ::|||| ||  :| || |||| 
Target 5' tgTGAACCTTTTGGTCTGATGCTa 3'
2015 - 2038 130.00 -10.20
3
miRNA  3' guGUU--UGGUAAUACACGACGau 5'
            |||   |||  |  ||||||  
Target 5' agCAATTTCCACCA--TGCTGCct 3'
1708 - 1729 126.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30116217 1 COSMIC
COSN30467252 20 COSMIC
COSN24006750 24 COSMIC
COSN30482607 29 COSMIC
COSN30482606 30 COSMIC
COSN7125969 32 COSMIC
COSN30188764 36 COSMIC
COSN30156433 40 COSMIC
COSN30497609 55 COSMIC
COSN20093583 57 COSMIC
COSN30107808 63 COSMIC
COSN31560991 72 COSMIC
COSN30524018 131 COSMIC
COSN32063729 413 COSMIC
COSN7125968 775 COSMIC
COSN28535350 811 COSMIC
COSN23918224 820 COSMIC
COSN28517193 825 COSMIC
COSN28513557 833 COSMIC
COSN30003400 1014 COSMIC
COSN22583426 1148 COSMIC
COSN21562744 1660 COSMIC
COSN24725096 2004 COSMIC
COSN9356544 2128 COSMIC
COSN21855058 2214 COSMIC
COSN16106731 2245 COSMIC
COSN9356543 2363 COSMIC
COSN25590842 2698 COSMIC
COSN29441364 2866 COSMIC
COSN1767525 3137 COSMIC
COSN19368486 3515 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs529082409 9 dbSNP
rs764936915 9 dbSNP
rs1159972879 10 dbSNP
rs1362000162 11 dbSNP
rs1166783886 14 dbSNP
rs759297224 19 dbSNP
rs1489991497 20 dbSNP
rs765969374 20 dbSNP
rs760522141 22 dbSNP
rs773239134 24 dbSNP
rs371111340 25 dbSNP
rs374990717 26 dbSNP
rs745763850 26 dbSNP
rs532916604 27 dbSNP
rs771829264 29 dbSNP
rs372419837 30 dbSNP
rs774161366 31 dbSNP
rs768799624 37 dbSNP
rs539345233 39 dbSNP
rs1422630563 44 dbSNP
rs1302521483 52 dbSNP
rs1475463707 57 dbSNP
rs1416062346 58 dbSNP
rs1326625453 71 dbSNP
rs1335348491 77 dbSNP
rs1240070060 91 dbSNP
rs571544484 97 dbSNP
rs111471565 100 dbSNP
rs920088430 105 dbSNP
rs1293226060 106 dbSNP
rs537863450 106 dbSNP
rs1242895482 120 dbSNP
rs939724401 124 dbSNP
rs1250281015 132 dbSNP
rs1211017232 137 dbSNP
rs1436820772 151 dbSNP
rs912334616 161 dbSNP
rs113749980 163 dbSNP
rs1442316817 168 dbSNP
rs1162385658 172 dbSNP
rs1157208440 180 dbSNP
rs1459404801 187 dbSNP
rs1272879640 188 dbSNP
rs1234443066 191 dbSNP
rs953745356 196 dbSNP
rs1324025546 213 dbSNP
rs920963234 214 dbSNP
rs1212270047 228 dbSNP
rs867534219 232 dbSNP
rs1360885168 233 dbSNP
rs990080983 239 dbSNP
rs957538839 241 dbSNP
rs1297916429 249 dbSNP
rs1031451023 258 dbSNP
rs1436769424 260 dbSNP
rs1392040262 261 dbSNP
rs1259519304 274 dbSNP
rs549089422 277 dbSNP
rs1182394352 278 dbSNP
rs966741029 285 dbSNP
rs1190997320 286 dbSNP
rs1372277425 287 dbSNP
rs1047327 302 dbSNP
rs1172558752 303 dbSNP
rs1458409987 304 dbSNP
rs1469502172 306 dbSNP
rs1025023752 308 dbSNP
rs1014122961 309 dbSNP
rs1380997672 313 dbSNP
rs1047328 314 dbSNP
rs1327537347 316 dbSNP
rs895148438 318 dbSNP
rs143133035 319 dbSNP
rs1047329 320 dbSNP
rs1047331 322 dbSNP
rs1047332 323 dbSNP
rs397832539 326 dbSNP
rs773491580 340 dbSNP
rs1195514441 341 dbSNP
rs746526522 345 dbSNP
rs368174463 352 dbSNP
rs1426978893 354 dbSNP
rs183312759 363 dbSNP
rs1129449 366 dbSNP
rs1129450 367 dbSNP
rs1427964077 371 dbSNP
rs1177478342 375 dbSNP
rs1360950671 375 dbSNP
rs772270954 385 dbSNP
rs1190768848 389 dbSNP
rs551365922 390 dbSNP
rs906693036 391 dbSNP
rs1252835651 392 dbSNP
rs760171935 396 dbSNP
rs1025093780 400 dbSNP
rs533304761 411 dbSNP
rs1345331570 413 dbSNP
rs1004238561 423 dbSNP
rs1301627178 430 dbSNP
rs1489780848 432 dbSNP
rs887130162 434 dbSNP
rs912280051 435 dbSNP
rs192007464 438 dbSNP
rs1488552742 445 dbSNP
rs1218751301 446 dbSNP
rs1048357020 451 dbSNP
rs1490140889 465 dbSNP
rs550503239 475 dbSNP
rs199565382 477 dbSNP
rs1039944577 478 dbSNP
rs1158431413 482 dbSNP
rs1364503635 485 dbSNP
rs943924728 489 dbSNP
rs1422038026 493 dbSNP
rs528918673 494 dbSNP
rs1365337421 502 dbSNP
rs912375697 507 dbSNP
rs73624813 519 dbSNP
rs549679532 526 dbSNP
rs924548450 530 dbSNP
rs977192234 531 dbSNP
rs1296415102 536 dbSNP
rs1461368014 539 dbSNP
rs945756512 545 dbSNP
rs1024133705 547 dbSNP
rs1170559918 548 dbSNP
rs1433156557 549 dbSNP
rs1248279195 551 dbSNP
rs1479764904 561 dbSNP
rs914255275 570 dbSNP
rs989782592 579 dbSNP
rs111394915 580 dbSNP
rs1033978101 581 dbSNP
rs1441696016 582 dbSNP
rs112794863 583 dbSNP
rs995932498 589 dbSNP
rs560783482 590 dbSNP
rs531460789 592 dbSNP
rs578164447 598 dbSNP
rs1177153225 604 dbSNP
rs149212922 616 dbSNP
rs1274826282 617 dbSNP
rs1206669049 618 dbSNP
rs891296319 619 dbSNP
rs1376985155 623 dbSNP
rs1448262383 628 dbSNP
rs1004271216 630 dbSNP
rs1312309649 646 dbSNP
rs1381902459 647 dbSNP
rs1228864363 648 dbSNP
rs1051726182 649 dbSNP
rs1305610637 650 dbSNP
rs1204088526 655 dbSNP
rs951436488 657 dbSNP
rs537823856 661 dbSNP
rs1459271007 662 dbSNP
rs1279125749 664 dbSNP
rs1181777134 684 dbSNP
rs1242641595 686 dbSNP
rs1026950636 693 dbSNP
rs995479564 705 dbSNP
rs899829375 707 dbSNP
rs1304513952 713 dbSNP
rs1171833443 719 dbSNP
rs370664542 719 dbSNP
rs200104316 721 dbSNP
rs1448657789 723 dbSNP
rs1466893961 723 dbSNP
rs868415845 723 dbSNP
rs1359786415 724 dbSNP
rs1213715796 725 dbSNP
rs867904098 725 dbSNP
rs1351020146 727 dbSNP
rs1041545473 729 dbSNP
rs1202052178 729 dbSNP
rs1320220411 729 dbSNP
rs758954966 729 dbSNP
rs1194794311 731 dbSNP
rs142195228 731 dbSNP
rs771819322 731 dbSNP
rs573714551 732 dbSNP
rs747722587 733 dbSNP
rs78131947 733 dbSNP
rs1423850338 734 dbSNP
rs1399359294 735 dbSNP
rs1491040364 735 dbSNP
rs774434228 735 dbSNP
rs879494020 735 dbSNP
rs914286506 735 dbSNP
rs1221896974 737 dbSNP
rs1282952224 737 dbSNP
rs1342196049 737 dbSNP
rs1345979101 737 dbSNP
rs746382035 737 dbSNP
rs1374882317 738 dbSNP
rs1282270461 739 dbSNP
rs1446900926 739 dbSNP
rs555427803 739 dbSNP
rs879418688 739 dbSNP
rs1173397072 740 dbSNP
rs1265783169 740 dbSNP
rs1199153799 741 dbSNP
rs937058495 741 dbSNP
rs1467720026 742 dbSNP
rs1173781767 743 dbSNP
rs1245710091 743 dbSNP
rs1405212377 743 dbSNP
rs1478165372 743 dbSNP
rs1250658594 744 dbSNP
rs186849839 744 dbSNP
rs1159240964 745 dbSNP
rs1362209152 745 dbSNP
rs1362430708 745 dbSNP
rs1402796894 745 dbSNP
rs1158834920 746 dbSNP
rs1277833150 746 dbSNP
rs1438928298 746 dbSNP
rs1241501977 747 dbSNP
rs1288700558 747 dbSNP
rs1350121186 747 dbSNP
rs1357948457 747 dbSNP
rs1473240541 748 dbSNP
rs1222156302 749 dbSNP
rs1254567662 749 dbSNP
rs1451786665 749 dbSNP
rs1200609475 751 dbSNP
rs1230661029 751 dbSNP
rs1438605963 751 dbSNP
rs981068242 751 dbSNP
rs1382032585 752 dbSNP
rs1183765242 753 dbSNP
rs1422692035 753 dbSNP
rs1391250907 755 dbSNP
rs538247878 755 dbSNP
rs918096764 756 dbSNP
rs1244754263 757 dbSNP
rs1381179398 757 dbSNP
rs1447538956 757 dbSNP
rs781624891 757 dbSNP
rs1266378767 758 dbSNP
rs1358971326 759 dbSNP
rs982878053 759 dbSNP
rs1491188092 760 dbSNP
rs951467846 760 dbSNP
rs1239496007 761 dbSNP
rs1442677571 761 dbSNP
rs879870006 761 dbSNP
rs1186822781 762 dbSNP
rs1368828646 763 dbSNP
rs181723560 763 dbSNP
rs566327697 764 dbSNP
rs1333415476 765 dbSNP
rs1466368566 765 dbSNP
rs1484025597 765 dbSNP
rs1404059683 766 dbSNP
rs569240880 767 dbSNP
rs59601137 768 dbSNP
rs1225624867 769 dbSNP
rs1258803475 769 dbSNP
rs865959981 771 dbSNP
rs868508829 772 dbSNP
rs1238033643 773 dbSNP
rs1259415091 773 dbSNP
rs1329815388 774 dbSNP
rs539266143 775 dbSNP
rs199914690 776 dbSNP
rs1190713832 777 dbSNP
rs1290166960 777 dbSNP
rs1444090247 777 dbSNP
rs1231325732 779 dbSNP
rs58779673 780 dbSNP
rs750000855 780 dbSNP
rs1465546828 781 dbSNP
rs1491358310 781 dbSNP
rs1334843996 783 dbSNP
rs1279628033 784 dbSNP
rs1297935682 784 dbSNP
rs1341587950 784 dbSNP
rs1381053432 784 dbSNP
rs1491195962 784 dbSNP
rs1717063 784 dbSNP
rs200726370 784 dbSNP
rs35092477 784 dbSNP
rs71177428 784 dbSNP
rs1262183685 785 dbSNP
rs1347003171 785 dbSNP
rs1488531365 785 dbSNP
rs1491180213 785 dbSNP
rs1195577627 786 dbSNP
rs1398079903 786 dbSNP
rs1176829979 787 dbSNP
rs1383062276 787 dbSNP
rs751621663 787 dbSNP
rs185441221 788 dbSNP
rs1452231832 789 dbSNP
rs1158645129 790 dbSNP
rs1288710505 790 dbSNP
rs1361738130 791 dbSNP
rs1458066773 791 dbSNP
rs10417095 792 dbSNP
rs1301705574 793 dbSNP
rs1365008979 794 dbSNP
rs868748743 795 dbSNP
rs866811191 796 dbSNP
rs57457743 797 dbSNP
rs866386257 797 dbSNP
rs1237860454 798 dbSNP
rs59818635 798 dbSNP
rs1488260008 799 dbSNP
rs527267617 799 dbSNP
rs59685400 799 dbSNP
rs1475135048 800 dbSNP
rs1269555817 801 dbSNP
rs66685835 801 dbSNP
rs1437836420 802 dbSNP
rs1178115788 803 dbSNP
rs1381420896 805 dbSNP
rs1422099645 805 dbSNP
rs972949271 805 dbSNP
rs1349716044 807 dbSNP
rs962720594 807 dbSNP
rs1367451190 808 dbSNP
rs1293819066 809 dbSNP
rs867394505 809 dbSNP
rs1443858491 810 dbSNP
rs60442183 810 dbSNP
rs752955082 810 dbSNP
rs1223690290 811 dbSNP
rs12462303 811 dbSNP
rs1307921472 811 dbSNP
rs1238914154 812 dbSNP
rs376398560 813 dbSNP
rs867001904 813 dbSNP
rs1413524804 814 dbSNP
rs527376549 815 dbSNP
rs1424689237 816 dbSNP
rs1351206547 817 dbSNP
rs753838847 817 dbSNP
rs769313126 817 dbSNP
rs1463760333 819 dbSNP
rs149939896 820 dbSNP
rs1400452249 821 dbSNP
rs1448884540 821 dbSNP
rs879640781 822 dbSNP
rs1228625551 823 dbSNP
rs1282289408 823 dbSNP
rs1378369917 823 dbSNP
rs374260953 824 dbSNP
rs1258783519 825 dbSNP
rs1316264933 825 dbSNP
rs760131847 825 dbSNP
rs1443835557 826 dbSNP
rs1208113537 827 dbSNP
rs57460816 827 dbSNP
rs201644784 828 dbSNP
rs1183920660 829 dbSNP
rs1421980316 829 dbSNP
rs1483875639 829 dbSNP
rs1491109967 829 dbSNP
rs1169591619 831 dbSNP
rs1476623331 831 dbSNP
rs569105142 832 dbSNP
rs1411098706 833 dbSNP
rs201987321 833 dbSNP
rs1207663324 834 dbSNP
rs1304350477 835 dbSNP
rs1465197620 835 dbSNP
rs770161445 835 dbSNP
rs780895400 835 dbSNP
rs1269720274 836 dbSNP
rs1338228081 837 dbSNP
rs1491465499 837 dbSNP
rs374766545 837 dbSNP
rs1320283275 839 dbSNP
rs372081542 839 dbSNP
rs747453034 839 dbSNP
rs758863068 839 dbSNP
rs1355556038 840 dbSNP
rs1278040451 841 dbSNP
rs1212918241 843 dbSNP
rs1313262477 843 dbSNP
rs867778675 843 dbSNP
rs1194865516 845 dbSNP
rs1263396070 845 dbSNP
rs1488206138 845 dbSNP
rs1284919206 847 dbSNP
rs1423920593 847 dbSNP
rs1175515949 849 dbSNP
rs546043347 849 dbSNP
rs879562510 849 dbSNP
rs549545476 850 dbSNP
rs1247062476 851 dbSNP
rs1324946583 853 dbSNP
rs1418798407 855 dbSNP
rs891014492 856 dbSNP
rs1295166222 857 dbSNP
rs1328378258 861 dbSNP
rs1274310947 863 dbSNP
rs1434628649 863 dbSNP
rs1368470591 864 dbSNP
rs1221430161 867 dbSNP
rs1041578103 871 dbSNP
rs1217758768 871 dbSNP
rs1284418188 871 dbSNP
rs1288653134 871 dbSNP
rs1351862374 871 dbSNP
rs1353651570 871 dbSNP
rs1448350561 871 dbSNP
rs1436029767 875 dbSNP
rs1391309426 879 dbSNP
rs1324296831 884 dbSNP
rs550616653 895 dbSNP
rs138352626 896 dbSNP
rs1054237574 898 dbSNP
rs1323217067 899 dbSNP
rs1473509541 903 dbSNP
rs150453655 905 dbSNP
rs529486700 906 dbSNP
rs1187550808 916 dbSNP
rs541923555 917 dbSNP
rs1045780568 918 dbSNP
rs1191506274 939 dbSNP
rs377115736 941 dbSNP
rs370339497 942 dbSNP
rs982992506 943 dbSNP
rs1211523947 944 dbSNP
rs951582047 946 dbSNP
rs949994673 947 dbSNP
rs1451840994 949 dbSNP
rs920079986 950 dbSNP
rs188072560 959 dbSNP
rs1273938148 964 dbSNP
rs754792599 968 dbSNP
rs1018284908 971 dbSNP
rs1162445393 973 dbSNP
rs987168488 974 dbSNP
rs1463248384 981 dbSNP
rs750720175 985 dbSNP
rs974066527 992 dbSNP
rs1448166482 993 dbSNP
rs962693316 994 dbSNP
rs1015640249 997 dbSNP
rs867765252 998 dbSNP
rs1004448225 1000 dbSNP
rs1255588159 1001 dbSNP
rs1456982878 1004 dbSNP
rs1331999756 1009 dbSNP
rs1010146781 1010 dbSNP
rs1326131539 1013 dbSNP
rs767834793 1023 dbSNP
rs1186541557 1027 dbSNP
rs1368888371 1030 dbSNP
rs891412400 1032 dbSNP
rs893001520 1041 dbSNP
rs1476303227 1042 dbSNP
rs1033233541 1044 dbSNP
rs1423189918 1051 dbSNP
rs1466159048 1055 dbSNP
rs1029800888 1056 dbSNP
rs997441323 1060 dbSNP
rs1395995939 1068 dbSNP
rs1335248106 1069 dbSNP
rs1001303075 1073 dbSNP
rs1393694058 1074 dbSNP
rs1275839599 1078 dbSNP
rs1316935695 1082 dbSNP
rs945928996 1083 dbSNP
rs1227457907 1085 dbSNP
rs185210245 1094 dbSNP
rs1342758879 1095 dbSNP
rs1199861844 1096 dbSNP
rs935793122 1097 dbSNP
rs1045403269 1098 dbSNP
rs949759179 1099 dbSNP
rs886097095 1101 dbSNP
rs1041394146 1102 dbSNP
rs1376040626 1103 dbSNP
rs1465965698 1104 dbSNP
rs578128272 1112 dbSNP
rs930209705 1114 dbSNP
rs920107559 1127 dbSNP
rs1377803458 1128 dbSNP
rs1418190645 1131 dbSNP
rs140531195 1132 dbSNP
rs1247019625 1134 dbSNP
rs942803362 1137 dbSNP
rs544540904 1143 dbSNP
rs937180922 1144 dbSNP
rs1251248195 1147 dbSNP
rs1280889554 1148 dbSNP
rs986897759 1148 dbSNP
rs1344629513 1152 dbSNP
rs1214132106 1159 dbSNP
rs573677560 1165 dbSNP
rs146849445 1170 dbSNP
rs1486301890 1175 dbSNP
rs1218814767 1191 dbSNP
rs1020280499 1193 dbSNP
rs1265350068 1195 dbSNP
rs988742983 1208 dbSNP
rs1199687840 1217 dbSNP
rs1397374295 1218 dbSNP
rs957243576 1233 dbSNP
rs534019458 1241 dbSNP
rs1001733256 1248 dbSNP
rs1361639796 1252 dbSNP
rs1453993706 1262 dbSNP
rs905693143 1264 dbSNP
rs1290198745 1269 dbSNP
rs962808248 1282 dbSNP
rs1385687379 1291 dbSNP
rs112643404 1292 dbSNP
rs1237928311 1292 dbSNP
rs1453186540 1292 dbSNP
rs777045716 1292 dbSNP
rs1440731811 1293 dbSNP
rs1317363481 1298 dbSNP
rs1350398911 1298 dbSNP
rs1217680690 1301 dbSNP
rs1306929492 1309 dbSNP
rs1214355281 1321 dbSNP
rs1024507867 1325 dbSNP
rs1255004600 1330 dbSNP
rs1409873244 1332 dbSNP
rs1456813489 1333 dbSNP
rs1178637672 1334 dbSNP
rs1409362041 1342 dbSNP
rs1421195389 1343 dbSNP
rs1163152109 1351 dbSNP
rs982794025 1363 dbSNP
rs12982176 1372 dbSNP
rs1457133861 1374 dbSNP
rs879021416 1376 dbSNP
rs1325964876 1394 dbSNP
rs573248472 1397 dbSNP
rs1371829912 1398 dbSNP
rs1330513116 1404 dbSNP
rs955584654 1404 dbSNP
rs1373984125 1407 dbSNP
rs144028373 1414 dbSNP
rs1413496604 1418 dbSNP
rs1310351043 1431 dbSNP
rs539584458 1432 dbSNP
rs1321316020 1433 dbSNP
rs1030328496 1436 dbSNP
rs1275123066 1443 dbSNP
rs1456449021 1444 dbSNP
rs1198108452 1445 dbSNP
rs996990316 1446 dbSNP
rs886129593 1448 dbSNP
rs74174448 1450 dbSNP
rs1481926574 1452 dbSNP
rs79587492 1455 dbSNP
rs1255966478 1457 dbSNP
rs1474666081 1462 dbSNP
rs1174104378 1478 dbSNP
rs930235913 1483 dbSNP
rs763465877 1484 dbSNP
rs999889371 1486 dbSNP
rs1169365987 1487 dbSNP
rs1354996176 1490 dbSNP
rs1444341254 1491 dbSNP
rs898705775 1494 dbSNP
rs1038615783 1495 dbSNP
rs902953875 1496 dbSNP
rs1041343505 1499 dbSNP
rs1378256639 1500 dbSNP
rs1013880255 1504 dbSNP
rs895702091 1509 dbSNP
rs550870446 1512 dbSNP
rs560700637 1513 dbSNP
rs568052074 1516 dbSNP
rs1273857087 1517 dbSNP
rs1484089932 1522 dbSNP
rs911383574 1525 dbSNP
rs111777674 1527 dbSNP
rs1209683183 1528 dbSNP
rs1208708114 1538 dbSNP
rs1255763483 1542 dbSNP
rs934042068 1561 dbSNP
rs1190526900 1564 dbSNP
rs1037565822 1566 dbSNP
rs746218663 1567 dbSNP
rs988775426 1568 dbSNP
rs941396693 1569 dbSNP
rs528093602 1578 dbSNP
rs1299482915 1582 dbSNP
rs908645548 1583 dbSNP
rs1374786941 1585 dbSNP
rs957274545 1602 dbSNP
rs982741412 1603 dbSNP
rs1383949284 1606 dbSNP
rs1314528907 1608 dbSNP
rs925899702 1609 dbSNP
rs980035010 1610 dbSNP
rs146658283 1613 dbSNP
rs780584613 1616 dbSNP
rs1446924804 1628 dbSNP
rs552005552 1630 dbSNP
rs1024123044 1632 dbSNP
rs1301115068 1633 dbSNP
rs1349257936 1646 dbSNP
rs1213413675 1647 dbSNP
rs1284373268 1651 dbSNP
rs533557492 1651 dbSNP
rs758405087 1652 dbSNP
rs1335979413 1654 dbSNP
rs200734796 1674 dbSNP
rs964355802 1676 dbSNP
rs1033566367 1677 dbSNP
rs1159826125 1688 dbSNP
rs1188976293 1689 dbSNP
rs1394364482 1694 dbSNP
rs1013977921 1696 dbSNP
rs1454689934 1704 dbSNP
rs1175263674 1708 dbSNP
rs1473494016 1716 dbSNP
rs1358457306 1722 dbSNP
rs868501607 1726 dbSNP
rs1415856140 1728 dbSNP
rs1400331206 1729 dbSNP
rs1319146891 1733 dbSNP
rs1181337887 1744 dbSNP
rs950437165 1747 dbSNP
rs1025939030 1751 dbSNP
rs1434329926 1754 dbSNP
rs994502307 1761 dbSNP
rs1274366698 1763 dbSNP
rs1372322768 1764 dbSNP
rs776333157 1766 dbSNP
rs1307515752 1768 dbSNP
rs1000340447 1789 dbSNP
rs898825690 1791 dbSNP
rs1284461862 1792 dbSNP
rs1218707133 1793 dbSNP
rs1251892657 1794 dbSNP
rs1468852296 1814 dbSNP
rs562970739 1817 dbSNP
rs1013994618 1818 dbSNP
rs142085558 1821 dbSNP
rs1007126940 1831 dbSNP
rs544133087 1831 dbSNP
rs1269106036 1832 dbSNP
rs529585450 1837 dbSNP
rs1403855546 1840 dbSNP
rs1055487184 1841 dbSNP
rs1395387970 1842 dbSNP
rs1001842784 1862 dbSNP
rs899092497 1869 dbSNP
rs4805208 1870 dbSNP
rs781047714 1871 dbSNP
rs940507533 1874 dbSNP
rs1352362591 1875 dbSNP
rs1333335686 1876 dbSNP
rs1226311919 1878 dbSNP
rs1310033078 1882 dbSNP
rs1334852325 1883 dbSNP
rs1190640328 1887 dbSNP
rs1227213312 1890 dbSNP
rs1047170028 1893 dbSNP
rs908593183 1893 dbSNP
rs1437200826 1895 dbSNP
rs934115610 1899 dbSNP
rs1234445451 1900 dbSNP
rs1379208656 1902 dbSNP
rs148687405 1905 dbSNP
rs1418864326 1908 dbSNP
rs934070023 1911 dbSNP
rs975452478 1913 dbSNP
rs1387641790 1914 dbSNP
rs1396364481 1929 dbSNP
rs942923677 1931 dbSNP
rs573172108 1933 dbSNP
rs1348023883 1961 dbSNP
rs756982023 1965 dbSNP
rs1406059481 1969 dbSNP
rs967512861 1973 dbSNP
rs1020448348 1978 dbSNP
rs992516411 1979 dbSNP
rs959843967 1983 dbSNP
rs1185011697 1997 dbSNP
rs1274854865 2006 dbSNP
rs866450203 2007 dbSNP
rs1001226366 2009 dbSNP
rs1258441307 2011 dbSNP
rs1191567598 2028 dbSNP
rs1372633683 2032 dbSNP
rs899038069 2033 dbSNP
rs558216788 2054 dbSNP
rs1004835826 2055 dbSNP
rs925962565 2057 dbSNP
rs1265400621 2067 dbSNP
rs980450241 2077 dbSNP
rs1313907297 2086 dbSNP
rs1222886050 2088 dbSNP
rs1375648306 2097 dbSNP
rs969976852 2099 dbSNP
rs1051627607 2108 dbSNP
rs1325414452 2115 dbSNP
rs1227526304 2118 dbSNP
rs1271808614 2125 dbSNP
rs1345681150 2126 dbSNP
rs1225807679 2129 dbSNP
rs1280838758 2132 dbSNP
rs546007234 2134 dbSNP
rs1214805376 2136 dbSNP
rs917078553 2143 dbSNP
rs1436971561 2149 dbSNP
rs1195453320 2160 dbSNP
rs1286557719 2165 dbSNP
rs182253104 2168 dbSNP
rs934041036 2172 dbSNP
rs56330606 2176 dbSNP
rs1174635027 2183 dbSNP
rs1040073802 2191 dbSNP
rs1436195717 2195 dbSNP
rs950551723 2196 dbSNP
rs925990942 2203 dbSNP
rs557232494 2204 dbSNP
rs994533983 2205 dbSNP
rs1166795841 2209 dbSNP
rs1233546703 2212 dbSNP
rs913387494 2217 dbSNP
rs748161537 2233 dbSNP
rs1349693667 2234 dbSNP
rs963400432 2236 dbSNP
rs1260317456 2243 dbSNP
rs960031968 2248 dbSNP
rs1206944226 2249 dbSNP
rs1017249031 2250 dbSNP
rs73624806 2257 dbSNP
rs890007045 2263 dbSNP
rs1170670937 2269 dbSNP
rs539484484 2270 dbSNP
rs1051265791 2281 dbSNP
rs1397436140 2291 dbSNP
rs998392668 2295 dbSNP
rs1431820654 2298 dbSNP
rs891959606 2299 dbSNP
rs1053221944 2306 dbSNP
rs1267036600 2308 dbSNP
rs1438158642 2333 dbSNP
rs1158876997 2337 dbSNP
rs1362827620 2340 dbSNP
rs1454036692 2344 dbSNP
rs1159779065 2349 dbSNP
rs568312541 2356 dbSNP
rs574613302 2357 dbSNP
rs925964875 2371 dbSNP
rs1044374214 2377 dbSNP
rs4805207 2396 dbSNP
rs144097649 2397 dbSNP
rs570388875 2404 dbSNP
rs1317723585 2412 dbSNP
rs1241521517 2413 dbSNP
rs369818516 2420 dbSNP
rs376010339 2421 dbSNP
rs1341068661 2426 dbSNP
rs112617373 2435 dbSNP
rs1030146357 2436 dbSNP
rs1255390567 2439 dbSNP
rs1479966683 2443 dbSNP
rs929170898 2448 dbSNP
rs1251760393 2454 dbSNP
rs139635310 2466 dbSNP
rs1160836682 2473 dbSNP
rs1039785544 2475 dbSNP
rs147408614 2478 dbSNP
rs963134112 2479 dbSNP
rs1369629898 2486 dbSNP
rs1396561168 2494 dbSNP
rs1460449702 2519 dbSNP
rs1297384209 2521 dbSNP
rs1373873597 2526 dbSNP
rs1392926283 2527 dbSNP
rs371084713 2530 dbSNP
rs1291605696 2531 dbSNP
rs1369864200 2532 dbSNP
rs762503577 2538 dbSNP
rs1043066354 2547 dbSNP
rs1275179948 2557 dbSNP
rs1409318498 2580 dbSNP
rs1306254206 2584 dbSNP
rs1204516466 2586 dbSNP
rs143091968 2595 dbSNP
rs1481788793 2599 dbSNP
rs1310096740 2600 dbSNP
rs1186277754 2604 dbSNP
rs139171470 2606 dbSNP
rs113531240 2609 dbSNP
rs1188023902 2623 dbSNP
rs1177225284 2624 dbSNP
rs553871865 2626 dbSNP
rs938870977 2633 dbSNP
rs1426661083 2636 dbSNP
rs1435473529 2651 dbSNP
rs757441884 2653 dbSNP
rs927486515 2663 dbSNP
rs1182040346 2668 dbSNP
rs979872179 2671 dbSNP
rs540558811 2681 dbSNP
rs1482456098 2702 dbSNP
rs141861707 2715 dbSNP
rs891992074 2728 dbSNP
rs1197187531 2732 dbSNP
rs751611853 2738 dbSNP
rs764193391 2740 dbSNP
rs534557576 2752 dbSNP
rs1482071160 2767 dbSNP
rs1296857161 2781 dbSNP
rs908851140 2784 dbSNP
rs1031819852 2789 dbSNP
rs1280134202 2806 dbSNP
rs148089544 2807 dbSNP
rs904568013 2811 dbSNP
rs1211245469 2822 dbSNP
rs1238849160 2825 dbSNP
rs950575046 2829 dbSNP
rs1474108686 2831 dbSNP
rs1233680811 2854 dbSNP
rs1030258425 2857 dbSNP
rs1451306718 2880 dbSNP
rs776035804 2892 dbSNP
rs546267148 2898 dbSNP
rs1394319934 2900 dbSNP
rs1435108351 2908 dbSNP
rs1313923812 2911 dbSNP
rs765728962 2914 dbSNP
rs997879431 2917 dbSNP
rs1430053362 2927 dbSNP
rs772826154 2932 dbSNP
rs948783254 2933 dbSNP
rs1289559521 2934 dbSNP
rs895809447 2941 dbSNP
rs1364676262 2944 dbSNP
rs1232821850 2954 dbSNP
rs1303128451 2970 dbSNP
rs1351185597 2974 dbSNP
rs1290281192 2975 dbSNP
rs1057002454 2994 dbSNP
rs575606890 2999 dbSNP
rs557491604 3001 dbSNP
rs929203445 3005 dbSNP
rs1401739835 3006 dbSNP
rs1280241984 3011 dbSNP
rs919106538 3012 dbSNP
rs542015521 3013 dbSNP
rs964574703 3018 dbSNP
rs1386849416 3024 dbSNP
rs941775921 3028 dbSNP
rs1466196024 3032 dbSNP
rs1159093638 3040 dbSNP
rs1252310918 3048 dbSNP
rs1454512125 3050 dbSNP
rs910339276 3052 dbSNP
rs986273872 3053 dbSNP
rs954388491 3059 dbSNP
rs1421742882 3060 dbSNP
rs1391013474 3072 dbSNP
rs1438811899 3077 dbSNP
rs1255013057 3079 dbSNP
rs1325754125 3088 dbSNP
rs1043013250 3090 dbSNP
rs1029982801 3093 dbSNP
rs1443515688 3095 dbSNP
rs1010193253 3097 dbSNP
rs1348083819 3098 dbSNP
rs1222918699 3106 dbSNP
rs1284522719 3107 dbSNP
rs977020281 3109 dbSNP
rs1211300512 3111 dbSNP
rs1272427241 3116 dbSNP
rs1468889959 3118 dbSNP
rs759899670 3119 dbSNP
rs1057372269 3121 dbSNP
rs574701883 3129 dbSNP
rs1177935193 3136 dbSNP
rs938969598 3143 dbSNP
rs1459897047 3145 dbSNP
rs1164341921 3148 dbSNP
rs1395820490 3159 dbSNP
rs1407623326 3160 dbSNP
rs1327260563 3166 dbSNP
rs927465525 3169 dbSNP
rs1443402935 3173 dbSNP
rs1288534632 3180 dbSNP
rs1208097978 3186 dbSNP
rs1031852124 3188 dbSNP
rs371443546 3190 dbSNP
rs941738182 3198 dbSNP
rs908964605 3199 dbSNP
rs1329760305 3201 dbSNP
rs1270807294 3202 dbSNP
rs567923064 3203 dbSNP
rs950357700 3206 dbSNP
rs1474373321 3207 dbSNP
rs143794503 3210 dbSNP
rs1136117 3213 dbSNP
rs1339904444 3214 dbSNP
rs1418749994 3215 dbSNP
rs1473819047 3221 dbSNP
rs976009228 3228 dbSNP
rs1396439674 3230 dbSNP
rs1023078909 3231 dbSNP
rs1410838325 3238 dbSNP
rs1313732929 3245 dbSNP
rs1013401392 3256 dbSNP
rs1017406862 3264 dbSNP
rs1292131327 3267 dbSNP
rs1340480709 3270 dbSNP
rs895840659 3278 dbSNP
rs1057033274 3279 dbSNP
rs1338702811 3283 dbSNP
rs1228828793 3290 dbSNP
rs1276571213 3300 dbSNP
rs929236034 3308 dbSNP
rs1210353615 3317 dbSNP
rs1258501740 3318 dbSNP
rs149013513 3319 dbSNP
rs1159839887 3325 dbSNP
rs897704780 3331 dbSNP
rs1455964246 3332 dbSNP
rs1038017592 3333 dbSNP
rs113236680 3335 dbSNP
rs1021671495 3336 dbSNP
rs1476053186 3339 dbSNP
rs1170858904 3340 dbSNP
rs375934104 3342 dbSNP
rs1050206290 3346 dbSNP
rs558310315 3349 dbSNP
rs113145524 3350 dbSNP
rs369056206 3351 dbSNP
rs1397227905 3355 dbSNP
rs776426472 3356 dbSNP
rs922944604 3360 dbSNP
rs753644994 3364 dbSNP
rs547228286 3366 dbSNP
rs1299735592 3367 dbSNP
rs906128344 3368 dbSNP
rs1233321308 3371 dbSNP
rs956357437 3372 dbSNP
rs924923927 3374 dbSNP
rs979412175 3379 dbSNP
rs968939337 3383 dbSNP
rs1207935790 3398 dbSNP
rs533428244 3400 dbSNP
rs1355747899 3408 dbSNP
rs1023529888 3433 dbSNP
rs772713669 3434 dbSNP
rs868139889 3436 dbSNP
rs1454074896 3445 dbSNP
rs929065258 3448 dbSNP
rs569365962 3450 dbSNP
rs1248527826 3477 dbSNP
rs1377814207 3479 dbSNP
rs1012965810 3493 dbSNP
rs1467304099 3499 dbSNP
rs922950439 3500 dbSNP
rs1297394014 3505 dbSNP
rs1436243781 3510 dbSNP
rs976164222 3511 dbSNP
rs1322402518 3513 dbSNP
rs1367748869 3514 dbSNP
rs1322158544 3515 dbSNP
rs1368739729 3515 dbSNP
rs75715934 3516 dbSNP
rs75156459 3517 dbSNP
rs943274860 3519 dbSNP
rs1301774104 3526 dbSNP
rs910460595 3528 dbSNP
rs77733118 3529 dbSNP
rs979198419 3530 dbSNP
rs1020783785 3531 dbSNP
rs1414520426 3531 dbSNP
rs1434540177 3531 dbSNP
rs1491081079 3531 dbSNP
rs35315978 3531 dbSNP
rs397729598 3531 dbSNP
rs950209243 3531 dbSNP
rs967847008 3531 dbSNP
rs1389465601 3532 dbSNP
rs1163315684 3533 dbSNP
rs1426215115 3534 dbSNP
rs1160793959 3537 dbSNP
rs1387904388 3537 dbSNP
rs988836896 3545 dbSNP
rs1293888952 3549 dbSNP
rs1369374615 3552 dbSNP
rs1389477185 3556 dbSNP
rs1167525878 3563 dbSNP
rs960077609 3564 dbSNP
rs1449869881 3566 dbSNP
rs1243575051 3572 dbSNP
rs1035654045 3573 dbSNP
rs1230274252 3580 dbSNP
rs547903976 3605 dbSNP
rs1196674537 3611 dbSNP
rs1267764031 3615 dbSNP
rs897824313 3621 dbSNP
rs1195617968 3622 dbSNP
rs1037655820 3624 dbSNP
rs1472742286 3629 dbSNP
rs1183693476 3639 dbSNP
rs1268216739 3642 dbSNP
rs535636368 3644 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  || |  ||||||| 
Target 5' --------AUCACAUGCUGCUc 3'
1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000532828.2 | 3UTR | AUCACAUGCUGCUCAACAUCUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.672 5.9e-4 0.716 1.9e-4 20 Click to see details
GSE38226 Liver fibrosis -0.379 4.5e-2 -0.348 6.1e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.495 5.1e-2 0.224 2.4e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.416 7.9e-2 -0.511 3.7e-2 13 Click to see details
GSE21849 B cell lymphoma 0.257 8.9e-2 0.170 1.9e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.242 9.1e-2 0.172 1.7e-1 32 Click to see details
GSE14794 Lymphoblastoid cells 0.129 1.1e-1 0.102 1.7e-1 90 Click to see details
GSE28544 Breast cancer 0.213 1.6e-1 0.057 4.0e-1 24 Click to see details
GSE21032 Prostate cancer 0.099 1.9e-1 0.076 2.5e-1 83 Click to see details
GSE19783 ER- ER- breast cancer 0.075 2.6e-1 0.180 5.6e-2 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.151 2.6e-1 -0.158 2.5e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.136 2.7e-1 -0.136 2.7e-1 23 Click to see details
GSE17306 Multiple myeloma -0.085 2.8e-1 0.026 4.3e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.105 3.1e-1 -0.017 4.7e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.105 3.1e-1 0.133 2.7e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.099 3.2e-1 0.094 3.3e-1 25 Click to see details
GSE19536 Breast cancer 0.035 3.6e-1 0.105 1.5e-1 100 Click to see details
GSE21687 Ependynoma primary tumors 0.038 3.8e-1 0.029 4.1e-1 64 Click to see details
GSE27834 Pluripotent stem cells 0.046 4.3e-1 0.015 4.8e-1 16 Click to see details
GSE27834 Pluripotent stem cells 0.046 4.3e-1 0.015 4.8e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.443 0.01 -0.513 0 32 Click to see details
CHOL -0.646 0.03 -0.500 0.09 9 Click to see details
PAAD 0.905 0.05 1.000 0.5 4 Click to see details
KIRP -0.267 0.07 -0.376 0.02 32 Click to see details
HNSC -0.228 0.07 -0.189 0.12 42 Click to see details
LIHC -0.205 0.08 -0.221 0.06 49 Click to see details
ESCA 0.428 0.09 0.573 0.03 11 Click to see details
THCA -0.166 0.1 -0.225 0.04 59 Click to see details
BLCA -0.307 0.11 -0.292 0.12 18 Click to see details
PRAD 0.168 0.12 0.073 0.31 50 Click to see details
COAD 0.425 0.15 0.310 0.23 8 Click to see details
CESC -0.799 0.21 -0.500 0.33 3 Click to see details
BRCA -0.084 0.22 -0.140 0.1 84 Click to see details
PCPG -0.675 0.26 -0.500 0.33 3 Click to see details
UCEC 0.106 0.33 0.100 0.34 19 Click to see details
LUAD -0.122 0.35 -0.161 0.31 12 Click to see details
KIRC -0.04 0.37 -0.021 0.43 68 Click to see details
LUSC -0.037 0.41 -0.044 0.4 38 Click to see details
KICH 0.002 0.5 0.052 0.4 25 Click to see details
KICH 0.002 0.5 0.052 0.4 25 Click to see details
KICH 0.002 0.5 0.052 0.4 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13