miRTarBase - #MIRT545190 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAP4K2   
Synonyms BL44, GCK, RAB8IP
Description mitogen-activated protein kinase kinase kinase kinase 2
Transcript NM_004579   
Expression
Putative miRNA Targets on MAP4K2
3'UTR of MAP4K2
(miRNA target sites are highlighted)
>MAP4K2|NM_004579|3'UTR
   1 GAGCAGCGGGCCTGTCCAGGGGCTCCCCGCCCCACCCCACGCCTTAGCTGCAGGCCCTTTTGGGCAAAGGGGCCCATCCT
  81 AGACCAGAGGAGCCCAGGCCCTGGCCCTGCTGGGGCTGAAGGTCAGAAGTAATCCTGAGAAATGTTTCAGGCCTGGGGAG
 161 GGAGGGGAGCCCCCGACGCCTCTGCAATAACTGGACCAGGGGGAGCTGCTGTCACTCCCCCATCCCCGAGGCAGCCCAGT
 241 CCCTAGTGCCCAAGGCAGGGACCCTGGGCCTGGGCCATCCATTCCATTTTGTTCCACATTTCCTTTCTACTCTTTCTGCC
 321 AAGAGCCTGCCCCTGCATTTGTCCTGGGAAACACGGTATTTAAGAGAGAACTATATTGGTATTAAAGCTGGTTTGTTTTA
 401 GTCCTCTGGTCCCTCTGGGTAGGGGGAGTGAACCCAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :::||||  : | |||||| 
Target 5' acTGGACCAGGGGGAGCTGCTg 3'
190 - 211 128.00 -15.90
2
miRNA  3' guGUUUGGUAAU-ACACGACgau 5'
            ||::|| | :   |||||   
Target 5' ccCAGGCCCTGGCCCTGCTGggg 3'
93 - 115 108.00 -12.50
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            || :|| |||   |||||  
Target 5' ccCACGCC-TTA---GCTGCag 3'
36 - 53 107.00 -8.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31591473 10 COSMIC
COSN28851037 28 COSMIC
COSN30528532 53 COSMIC
COSN26345053 101 COSMIC
COSN31778855 174 COSMIC
COSN31488626 220 COSMIC
COSN31554869 264 COSMIC
COSN30164384 294 COSMIC
COSN16443882 448 COSMIC
COSN5263024 538 COSMIC
COSN8282653 878 COSMIC
COSN24974231 1680 COSMIC
COSN22824364 2139 COSMIC
COSN27144928 2286 COSMIC
COSN7016885 2323 COSMIC
COSN8687754 2510 COSMIC
COSN23902708 2623 COSMIC
COSN21237525 2960 COSMIC
COSN24551512 2964 COSMIC
COSN21209821 2997 COSMIC
COSN7016884 3000 COSMIC
COSN5828546 3340 COSMIC
COSN15789510 3383 COSMIC
COSN7016883 3385 COSMIC
COSN21408133 4307 COSMIC
COSN7016882 4308 COSMIC
COSN7016881 4405 COSMIC
rs117925626 892 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1344029800 2 dbSNP
rs751416356 7 dbSNP
rs777686791 8 dbSNP
rs758340406 10 dbSNP
rs752149077 12 dbSNP
rs1160630306 13 dbSNP
rs1463703502 14 dbSNP
rs370427980 18 dbSNP
rs1176019682 19 dbSNP
rs759188754 24 dbSNP
rs753402982 25 dbSNP
rs565546034 28 dbSNP
rs900750990 29 dbSNP
rs1247775529 30 dbSNP
rs1196979567 35 dbSNP
rs1480689150 36 dbSNP
rs1254979055 39 dbSNP
rs762069053 40 dbSNP
rs1208329573 41 dbSNP
rs545430774 41 dbSNP
rs769218032 44 dbSNP
rs1224628295 45 dbSNP
rs1335737945 48 dbSNP
rs943701945 54 dbSNP
rs912234591 55 dbSNP
rs1047220684 59 dbSNP
rs1415655869 63 dbSNP
rs929728164 66 dbSNP
rs963738214 69 dbSNP
rs1436283011 72 dbSNP
rs576550210 73 dbSNP
rs1458668143 78 dbSNP
rs1325223916 90 dbSNP
rs973887189 99 dbSNP
rs1007690214 103 dbSNP
rs2229721 109 dbSNP
rs1197524489 110 dbSNP
rs1052018396 111 dbSNP
rs536377951 114 dbSNP
rs1336201402 116 dbSNP
rs1330016559 119 dbSNP
rs916497259 120 dbSNP
rs992090908 125 dbSNP
rs1291633551 129 dbSNP
rs1249617110 130 dbSNP
rs1445242443 137 dbSNP
rs960956881 153 dbSNP
rs1031013571 164 dbSNP
rs1192434326 166 dbSNP
rs1247193836 168 dbSNP
rs1478759287 170 dbSNP
rs993772257 174 dbSNP
rs1354724275 175 dbSNP
rs1284052176 176 dbSNP
rs749172948 177 dbSNP
rs1241524193 178 dbSNP
rs1161859236 179 dbSNP
rs3180513 182 dbSNP
rs1379833177 186 dbSNP
rs770016357 187 dbSNP
rs1400465618 194 dbSNP
rs1037676639 197 dbSNP
rs1333329832 199 dbSNP
rs747776089 199 dbSNP
rs574054455 201 dbSNP
rs1282663111 202 dbSNP
rs1351366408 207 dbSNP
rs1230420522 209 dbSNP
rs554488240 211 dbSNP
rs942028399 215 dbSNP
rs1204320114 217 dbSNP
rs996294384 219 dbSNP
rs900720047 225 dbSNP
rs1040990215 227 dbSNP
rs1267508801 228 dbSNP
rs1472613229 235 dbSNP
rs1183957811 242 dbSNP
rs1361689929 254 dbSNP
rs1350661374 255 dbSNP
rs1164131376 266 dbSNP
rs868042219 268 dbSNP
rs890760822 275 dbSNP
rs1302671288 281 dbSNP
rs534781404 284 dbSNP
rs1411717457 304 dbSNP
rs1335397460 316 dbSNP
rs929654648 322 dbSNP
rs112747982 323 dbSNP
rs1284520683 324 dbSNP
rs898239524 329 dbSNP
rs565645345 331 dbSNP
rs1290917436 334 dbSNP
rs1061125 353 dbSNP
rs1483129751 354 dbSNP
rs1197029227 355 dbSNP
rs1441452623 359 dbSNP
rs1436808618 369 dbSNP
rs988059298 373 dbSNP
rs956652035 378 dbSNP
rs1177436394 385 dbSNP
rs925218812 387 dbSNP
rs947829345 393 dbSNP
rs545520413 403 dbSNP
rs1248051448 404 dbSNP
rs1396780037 406 dbSNP
rs552004831 414 dbSNP
rs1018014375 415 dbSNP
rs1384785518 417 dbSNP
rs1008430574 425 dbSNP
rs1342700789 426 dbSNP
rs1218928639 427 dbSNP
rs954881514 428 dbSNP
rs1338381929 437 dbSNP
rs1450171516 441 dbSNP
rs1200715235 446 dbSNP
rs1244579087 447 dbSNP
rs1289598640 448 dbSNP
rs538543560 448 dbSNP
rs1183365474 450 dbSNP
rs569353604 460 dbSNP
rs1030944903 464 dbSNP
rs549734452 468 dbSNP
rs747577766 469 dbSNP
rs113751176 471 dbSNP
rs1356428559 473 dbSNP
rs1307776916 474 dbSNP
rs898056340 479 dbSNP
rs1174592257 491 dbSNP
rs1037960632 495 dbSNP
rs1450186967 498 dbSNP
rs1335773891 500 dbSNP
rs1365870587 504 dbSNP
rs939301707 516 dbSNP
rs1383810722 522 dbSNP
rs923878392 525 dbSNP
rs529781497 536 dbSNP
rs978050799 543 dbSNP
rs1306468761 546 dbSNP
rs199655584 553 dbSNP
rs1006191749 556 dbSNP
rs1264694896 557 dbSNP
rs1368438821 560 dbSNP
rs905226389 565 dbSNP
rs1045153768 566 dbSNP
rs1487033960 570 dbSNP
rs1185332386 573 dbSNP
rs777795417 581 dbSNP
rs1433911056 588 dbSNP
rs1434598428 589 dbSNP
rs750159158 598 dbSNP
rs1427475051 603 dbSNP
rs781112274 604 dbSNP
rs968056750 614 dbSNP
rs576866409 619 dbSNP
rs925165755 624 dbSNP
rs979349085 639 dbSNP
rs1358524646 646 dbSNP
rs375708361 660 dbSNP
rs1158002847 663 dbSNP
rs963676955 665 dbSNP
rs1361183911 666 dbSNP
rs1386852843 670 dbSNP
rs910900858 680 dbSNP
rs986553079 683 dbSNP
rs752810493 686 dbSNP
rs964816881 690 dbSNP
rs1019127367 693 dbSNP
rs1009500491 706 dbSNP
rs1224849641 710 dbSNP
rs116564679 711 dbSNP
rs1480133178 725 dbSNP
rs191112937 730 dbSNP
rs993830579 733 dbSNP
rs1477488951 734 dbSNP
rs1016517985 736 dbSNP
rs1420727223 747 dbSNP
rs527848843 761 dbSNP
rs1156589996 764 dbSNP
rs1344551759 773 dbSNP
rs1425175042 775 dbSNP
rs898164591 782 dbSNP
rs1363218857 786 dbSNP
rs1038091820 788 dbSNP
rs1217777590 792 dbSNP
rs1403780067 796 dbSNP
rs1279839820 800 dbSNP
rs947798182 811 dbSNP
rs1222436051 815 dbSNP
rs565474424 823 dbSNP
rs1322888713 826 dbSNP
rs755796812 827 dbSNP
rs939211314 829 dbSNP
rs1490223875 830 dbSNP
rs1205956867 833 dbSNP
rs1216529022 847 dbSNP
rs1312790634 866 dbSNP
rs896521725 866 dbSNP
rs923874522 874 dbSNP
rs1280811582 877 dbSNP
rs1444992253 881 dbSNP
rs117925626 892 dbSNP
rs1383295893 899 dbSNP
rs1367137370 913 dbSNP
rs946681749 914 dbSNP
rs903722347 916 dbSNP
rs1434552013 928 dbSNP
rs1439522645 928 dbSNP
rs576790355 931 dbSNP
rs915252861 936 dbSNP
rs974772217 938 dbSNP
rs1297438778 945 dbSNP
rs1466472377 947 dbSNP
rs911149822 948 dbSNP
rs1173303793 949 dbSNP
rs986833225 959 dbSNP
rs1275150550 970 dbSNP
rs964804826 975 dbSNP
rs1204148671 982 dbSNP
rs1238251966 987 dbSNP
rs1413458598 988 dbSNP
rs1185130949 992 dbSNP
rs1423831408 993 dbSNP
rs1241212535 1001 dbSNP
rs1195440770 1009 dbSNP
rs9326434 1012 dbSNP
rs1261499254 1019 dbSNP
rs1193470488 1025 dbSNP
rs111762410 1031 dbSNP
rs1483865094 1038 dbSNP
rs1407693852 1046 dbSNP
rs1169379115 1050 dbSNP
rs542979386 1053 dbSNP
rs768390930 1053 dbSNP
rs950986878 1054 dbSNP
rs1026526990 1055 dbSNP
rs1432063934 1059 dbSNP
rs1423501303 1060 dbSNP
rs574066084 1063 dbSNP
rs1360022960 1073 dbSNP
rs554196869 1075 dbSNP
rs1214054755 1076 dbSNP
rs534519466 1077 dbSNP
rs898133554 1078 dbSNP
rs1311704894 1079 dbSNP
rs761812065 1080 dbSNP
rs1016480212 1083 dbSNP
rs985032699 1087 dbSNP
rs1011942996 1089 dbSNP
rs1193874650 1095 dbSNP
rs1243763143 1099 dbSNP
rs894881910 1103 dbSNP
rs571957698 1104 dbSNP
rs1277324377 1106 dbSNP
rs1429578498 1108 dbSNP
rs1396430645 1111 dbSNP
rs1023890198 1112 dbSNP
rs1381225384 1118 dbSNP
rs558322284 1131 dbSNP
rs902348617 1132 dbSNP
rs538582975 1137 dbSNP
rs1320924654 1138 dbSNP
rs1400398824 1143 dbSNP
rs946651633 1144 dbSNP
rs751598105 1145 dbSNP
rs569594070 1146 dbSNP
rs1170156696 1148 dbSNP
rs555910676 1150 dbSNP
rs536212802 1168 dbSNP
rs1043507922 1173 dbSNP
rs1180660468 1178 dbSNP
rs942552164 1179 dbSNP
rs1460880706 1184 dbSNP
rs9326433 1193 dbSNP
rs1445156852 1204 dbSNP
rs547424572 1206 dbSNP
rs1268932514 1216 dbSNP
rs987962669 1217 dbSNP
rs1196907902 1218 dbSNP
rs1428157509 1219 dbSNP
rs1051035001 1220 dbSNP
rs1200671853 1223 dbSNP
rs1456587077 1224 dbSNP
rs933638625 1226 dbSNP
rs1257720315 1229 dbSNP
rs1245183610 1231 dbSNP
rs1323315509 1232 dbSNP
rs1367583444 1233 dbSNP
rs1403169009 1237 dbSNP
rs1310408578 1238 dbSNP
rs1227686863 1239 dbSNP
rs918279233 1242 dbSNP
rs1377630664 1243 dbSNP
rs1332787750 1250 dbSNP
rs950878692 1256 dbSNP
rs919437898 1257 dbSNP
rs941122789 1258 dbSNP
rs1293776835 1259 dbSNP
rs1239390128 1263 dbSNP
rs1458699388 1266 dbSNP
rs973627485 1267 dbSNP
rs1219530223 1268 dbSNP
rs1163185859 1269 dbSNP
rs963604756 1272 dbSNP
rs1437997000 1279 dbSNP
rs527369447 1281 dbSNP
rs985322524 1283 dbSNP
rs1469926325 1284 dbSNP
rs1444553501 1285 dbSNP
rs1381515723 1289 dbSNP
rs1164843670 1293 dbSNP
rs1180563041 1299 dbSNP
rs1387627321 1303 dbSNP
rs1456518568 1311 dbSNP
rs969600317 1313 dbSNP
rs1397513775 1314 dbSNP
rs1393325395 1315 dbSNP
rs1179503703 1323 dbSNP
rs1445764705 1324 dbSNP
rs1023251101 1329 dbSNP
rs1250032847 1334 dbSNP
rs1361431046 1343 dbSNP
rs1011907776 1344 dbSNP
rs571902020 1345 dbSNP
rs959339239 1352 dbSNP
rs1263445183 1358 dbSNP
rs1457652399 1359 dbSNP
rs1220644340 1360 dbSNP
rs1354290972 1363 dbSNP
rs1245529082 1367 dbSNP
rs1311440333 1373 dbSNP
rs1443274308 1375 dbSNP
rs1034738002 1376 dbSNP
rs375130008 1385 dbSNP
rs1237267922 1386 dbSNP
rs1373763446 1400 dbSNP
rs960991570 1409 dbSNP
rs1375562486 1423 dbSNP
rs1003713543 1440 dbSNP
rs1301457579 1446 dbSNP
rs1395952920 1447 dbSNP
rs1388135134 1452 dbSNP
rs1470788301 1460 dbSNP
rs1388212272 1464 dbSNP
rs1337090867 1465 dbSNP
rs1384944345 1466 dbSNP
rs1030997393 1470 dbSNP
rs902317094 1471 dbSNP
rs1326563421 1475 dbSNP
rs1292112007 1479 dbSNP
rs999492067 1481 dbSNP
rs1042222909 1482 dbSNP
rs77450770 1487 dbSNP
rs374685482 1488 dbSNP
rs1437831796 1504 dbSNP
rs1363316715 1505 dbSNP
rs1007107737 1508 dbSNP
rs1263033182 1509 dbSNP
rs889656360 1510 dbSNP
rs1199748034 1515 dbSNP
rs368061946 1528 dbSNP
rs1423204144 1536 dbSNP
rs1038964532 1540 dbSNP
rs943343378 1546 dbSNP
rs1408086802 1548 dbSNP
rs1468025337 1549 dbSNP
rs911888334 1551 dbSNP
rs1051827055 1554 dbSNP
rs929399033 1556 dbSNP
rs1292762963 1558 dbSNP
rs1223793560 1560 dbSNP
rs1339480780 1560 dbSNP
rs1284785577 1561 dbSNP
rs1488509785 1563 dbSNP
rs1321931649 1564 dbSNP
rs919363854 1573 dbSNP
rs1261833130 1582 dbSNP
rs909607045 1591 dbSNP
rs774936506 1592 dbSNP
rs963574205 1600 dbSNP
rs1262616378 1603 dbSNP
rs1490527249 1605 dbSNP
rs187191961 1609 dbSNP
rs529239129 1627 dbSNP
rs1427455036 1635 dbSNP
rs1431235061 1645 dbSNP
rs1328972825 1646 dbSNP
rs948204025 1665 dbSNP
rs916164053 1668 dbSNP
rs1455248944 1672 dbSNP
rs1296239454 1678 dbSNP
rs769497039 1679 dbSNP
rs916796093 1688 dbSNP
rs1343187073 1693 dbSNP
rs1219026332 1697 dbSNP
rs1300191663 1699 dbSNP
rs959038196 1702 dbSNP
rs992813386 1705 dbSNP
rs373204335 1713 dbSNP
rs560282644 1719 dbSNP
rs960912447 1720 dbSNP
rs375376898 1724 dbSNP
rs140297619 1725 dbSNP
rs1003273066 1726 dbSNP
rs1300523610 1730 dbSNP
rs1490553218 1730 dbSNP
rs1224724792 1738 dbSNP
rs537461805 1747 dbSNP
rs1488251898 1748 dbSNP
rs1190439871 1749 dbSNP
rs968035360 1752 dbSNP
rs1020692296 1757 dbSNP
rs553806650 1758 dbSNP
rs1173203569 1759 dbSNP
rs1156844800 1767 dbSNP
rs1379614860 1774 dbSNP
rs1467692714 1778 dbSNP
rs1164878332 1786 dbSNP
rs1010690426 1789 dbSNP
rs1298369584 1791 dbSNP
rs1176023409 1796 dbSNP
rs1390025315 1797 dbSNP
rs558358866 1798 dbSNP
rs112277411 1799 dbSNP
rs1248290052 1806 dbSNP
rs1289634318 1812 dbSNP
rs1017514868 1815 dbSNP
rs1006997921 1822 dbSNP
rs1007918864 1823 dbSNP
rs954010125 1835 dbSNP
rs544777161 1836 dbSNP
rs1191316327 1838 dbSNP
rs779408303 1841 dbSNP
rs1446321639 1848 dbSNP
rs1029530724 1857 dbSNP
rs1256832363 1865 dbSNP
rs998434033 1866 dbSNP
rs1282036393 1869 dbSNP
rs576277095 1874 dbSNP
rs897033896 1875 dbSNP
rs1170787608 1877 dbSNP
rs1355851933 1884 dbSNP
rs1464404578 1886 dbSNP
rs556384472 1897 dbSNP
rs1331041320 1903 dbSNP
rs1384225051 1905 dbSNP
rs1036967156 1912 dbSNP
rs777053386 1916 dbSNP
rs890444560 1920 dbSNP
rs1052176216 1926 dbSNP
rs1215240319 1929 dbSNP
rs1262047921 1930 dbSNP
rs929336348 1931 dbSNP
rs182907263 1936 dbSNP
rs771328586 1937 dbSNP
rs567292701 1950 dbSNP
rs567398544 1951 dbSNP
rs916114910 1953 dbSNP
rs1280488737 1955 dbSNP
rs533658753 1962 dbSNP
rs114510091 1966 dbSNP
rs1326335733 1967 dbSNP
rs938953303 1974 dbSNP
rs1335478647 1980 dbSNP
rs372131314 1981 dbSNP
rs1472180838 1985 dbSNP
rs1186534446 1986 dbSNP
rs916995382 1996 dbSNP
rs982153198 1999 dbSNP
rs966353489 2000 dbSNP
rs1407364620 2001 dbSNP
rs1397823686 2003 dbSNP
rs1020661008 2017 dbSNP
rs1332848930 2022 dbSNP
rs989225740 2027 dbSNP
rs1431593570 2039 dbSNP
rs1175902657 2042 dbSNP
rs1271958503 2043 dbSNP
rs1338477126 2045 dbSNP
rs1056599035 2049 dbSNP
rs571333925 2050 dbSNP
rs886176136 2057 dbSNP
rs866063458 2061 dbSNP
rs978343143 2065 dbSNP
rs1368942644 2070 dbSNP
rs946701272 2071 dbSNP
rs1215926352 2081 dbSNP
rs1017879901 2084 dbSNP
rs915284736 2085 dbSNP
rs747495871 2089 dbSNP
rs1487010628 2103 dbSNP
rs1192564052 2104 dbSNP
rs1429552935 2117 dbSNP
rs1007411687 2123 dbSNP
rs985940336 2129 dbSNP
rs954120828 2137 dbSNP
rs370912287 2139 dbSNP
rs1425116978 2141 dbSNP
rs890341083 2143 dbSNP
rs1320820657 2144 dbSNP
rs1241972498 2145 dbSNP
rs1030256610 2146 dbSNP
rs552019296 2148 dbSNP
rs778278342 2151 dbSNP
rs897866898 2152 dbSNP
rs1005514154 2159 dbSNP
rs1272816774 2160 dbSNP
rs569904239 2161 dbSNP
rs1343993182 2178 dbSNP
rs531900329 2182 dbSNP
rs569452138 2190 dbSNP
rs942120149 2191 dbSNP
rs1350958314 2197 dbSNP
rs1022597633 2198 dbSNP
rs1013001445 2199 dbSNP
rs549695633 2202 dbSNP
rs1056341950 2214 dbSNP
rs529552319 2219 dbSNP
rs1160869731 2220 dbSNP
rs1378934234 2222 dbSNP
rs1419185896 2230 dbSNP
rs928843856 2235 dbSNP
rs1285237013 2245 dbSNP
rs977743195 2256 dbSNP
rs367549934 2257 dbSNP
rs1323117049 2260 dbSNP
rs560570529 2261 dbSNP
rs913600496 2262 dbSNP
rs1311382464 2265 dbSNP
rs1374500716 2266 dbSNP
rs1238825295 2272 dbSNP
rs1336124589 2273 dbSNP
rs1373996390 2273 dbSNP
rs1207756274 2274 dbSNP
rs1447671344 2276 dbSNP
rs1011479711 2277 dbSNP
rs1438756973 2278 dbSNP
rs1402661405 2282 dbSNP
rs989173361 2286 dbSNP
rs1439579014 2287 dbSNP
rs540211464 2292 dbSNP
rs1391202437 2294 dbSNP
rs1164840020 2298 dbSNP
rs1387214683 2301 dbSNP
rs192029758 2305 dbSNP
rs564210211 2306 dbSNP
rs957760793 2308 dbSNP
rs1178691137 2309 dbSNP
rs1397474815 2310 dbSNP
rs1410378931 2317 dbSNP
rs910316104 2318 dbSNP
rs1398069932 2325 dbSNP
rs1445987466 2334 dbSNP
rs772101280 2335 dbSNP
rs986334735 2340 dbSNP
rs1235938903 2343 dbSNP
rs1203384986 2344 dbSNP
rs1437552829 2351 dbSNP
rs1339634088 2357 dbSNP
rs1256594733 2358 dbSNP
rs796817461 2358 dbSNP
rs188444163 2359 dbSNP
rs1204878028 2361 dbSNP
rs748265969 2362 dbSNP
rs568083983 2367 dbSNP
rs1422203107 2369 dbSNP
rs1212045432 2370 dbSNP
rs1373901588 2376 dbSNP
rs1357894470 2382 dbSNP
rs1168737794 2383 dbSNP
rs1287603388 2385 dbSNP
rs1397869525 2390 dbSNP
rs1464851359 2393 dbSNP
rs1337389623 2404 dbSNP
rs146690705 2422 dbSNP
rs1240910031 2423 dbSNP
rs1379214755 2432 dbSNP
rs1277943347 2434 dbSNP
rs377685089 2446 dbSNP
rs962024229 2447 dbSNP
rs1326463700 2451 dbSNP
rs1016295049 2452 dbSNP
rs1275849528 2456 dbSNP
rs893032852 2457 dbSNP
rs1350753014 2468 dbSNP
rs1325247588 2469 dbSNP
rs1422570299 2475 dbSNP
rs1482548555 2484 dbSNP
rs183561180 2485 dbSNP
rs1361059019 2489 dbSNP
rs1420918620 2491 dbSNP
rs542940433 2492 dbSNP
rs72156300 2492 dbSNP
rs1477407620 2502 dbSNP
rs1491136381 2503 dbSNP
rs1171880862 2504 dbSNP
rs1357436285 2504 dbSNP
rs1385068093 2504 dbSNP
rs1491519958 2504 dbSNP
rs397745278 2504 dbSNP
rs56139846 2504 dbSNP
rs1478151430 2505 dbSNP
rs1006242322 2507 dbSNP
rs1303817385 2508 dbSNP
rs573830005 2508 dbSNP
rs1233182125 2511 dbSNP
rs1055889128 2512 dbSNP
rs1214525904 2514 dbSNP
rs1262803699 2514 dbSNP
rs1356032956 2514 dbSNP
rs553821830 2514 dbSNP
rs985438141 2514 dbSNP
rs191978141 2515 dbSNP
rs1175275978 2516 dbSNP
rs1380835913 2517 dbSNP
rs1041940590 2519 dbSNP
rs1156279593 2525 dbSNP
rs141164828 2525 dbSNP
rs1458120936 2525 dbSNP
rs922681106 2525 dbSNP
rs1365939647 2527 dbSNP
rs1386564080 2536 dbSNP
rs946326278 2537 dbSNP
rs1308413594 2541 dbSNP
rs577821036 2551 dbSNP
rs1379736729 2552 dbSNP
rs914844470 2555 dbSNP
rs1285441209 2557 dbSNP
rs1360195777 2558 dbSNP
rs1224067302 2570 dbSNP
rs1263835894 2570 dbSNP
rs1356537126 2574 dbSNP
rs1190395709 2581 dbSNP
rs961180233 2583 dbSNP
rs1441430849 2589 dbSNP
rs1015471981 2591 dbSNP
rs1379175603 2596 dbSNP
rs1053355923 2597 dbSNP
rs186305193 2598 dbSNP
rs1276854865 2604 dbSNP
rs1402831203 2608 dbSNP
rs1344646148 2610 dbSNP
rs1457763560 2614 dbSNP
rs1332426687 2615 dbSNP
rs550872751 2623 dbSNP
rs1012556148 2624 dbSNP
rs201528411 2624 dbSNP
rs985937743 2624 dbSNP
rs537935346 2630 dbSNP
rs1196684824 2637 dbSNP
rs1220600869 2637 dbSNP
rs1458884007 2637 dbSNP
rs5792334 2637 dbSNP
rs1237493849 2640 dbSNP
rs1472876240 2644 dbSNP
rs1035385057 2646 dbSNP
rs1343434473 2652 dbSNP
rs1411238048 2655 dbSNP
rs1422913620 2663 dbSNP
rs1170888513 2667 dbSNP
rs1426251707 2671 dbSNP
rs998601403 2685 dbSNP
rs574267535 2687 dbSNP
rs763158535 2690 dbSNP
rs954692752 2695 dbSNP
rs1414561849 2697 dbSNP
rs1301132044 2703 dbSNP
rs569475476 2705 dbSNP
rs1042499364 2706 dbSNP
rs1280270706 2712 dbSNP
rs923156514 2716 dbSNP
rs1479627232 2723 dbSNP
rs1257401239 2739 dbSNP
rs946887748 2741 dbSNP
rs549296436 2742 dbSNP
rs1050442886 2748 dbSNP
rs879478945 2761 dbSNP
rs922614947 2762 dbSNP
rs1194930790 2765 dbSNP
rs1407902750 2765 dbSNP
rs1016200410 2774 dbSNP
rs1006189876 2777 dbSNP
rs958775901 2779 dbSNP
rs181030821 2780 dbSNP
rs1416681167 2789 dbSNP
rs1002990545 2804 dbSNP
rs1280920934 2811 dbSNP
rs908632345 2815 dbSNP
rs983933062 2818 dbSNP
rs752865200 2819 dbSNP
rs1041847210 2827 dbSNP
rs754047856 2843 dbSNP
rs567025186 2844 dbSNP
rs1220887893 2845 dbSNP
rs1276336878 2847 dbSNP
rs546605138 2859 dbSNP
rs991838332 2860 dbSNP
rs959731313 2861 dbSNP
rs1487085260 2866 dbSNP
rs893355996 2868 dbSNP
rs1247676698 2870 dbSNP
rs868446629 2886 dbSNP
rs998485135 2891 dbSNP
rs1189982580 2903 dbSNP
rs1425071295 2904 dbSNP
rs533119422 2912 dbSNP
rs1420441755 2917 dbSNP
rs1054638357 2929 dbSNP
rs1324384249 2930 dbSNP
rs1358661620 2930 dbSNP
rs1448036394 2930 dbSNP
rs564245954 2934 dbSNP
rs1331478345 2942 dbSNP
rs1438342785 2944 dbSNP
rs189832606 2955 dbSNP
rs781111139 2956 dbSNP
rs1334187227 2959 dbSNP
rs1011044393 2964 dbSNP
rs893993687 2965 dbSNP
rs1049988671 2966 dbSNP
rs910252426 2967 dbSNP
rs1050585205 2969 dbSNP
rs1041029913 2970 dbSNP
rs1246683303 2972 dbSNP
rs940022835 2972 dbSNP
rs908601222 2981 dbSNP
rs1378564189 2994 dbSNP
rs1439093803 2994 dbSNP
rs933107612 2997 dbSNP
rs1171806123 2998 dbSNP
rs923030888 2999 dbSNP
rs757139009 3005 dbSNP
rs971860737 3006 dbSNP
rs1417945439 3012 dbSNP
rs915769375 3017 dbSNP
rs991414456 3018 dbSNP
rs374428057 3023 dbSNP
rs960194238 3030 dbSNP
rs879672534 3031 dbSNP
rs928558058 3034 dbSNP
rs1357995462 3035 dbSNP
rs1483587783 3037 dbSNP
rs1239274925 3038 dbSNP
rs562729095 3044 dbSNP
rs1461017221 3046 dbSNP
rs1236878178 3047 dbSNP
rs371287826 3051 dbSNP
rs1021315396 3054 dbSNP
rs984741954 3055 dbSNP
rs1471951024 3066 dbSNP
rs958226554 3069 dbSNP
rs752234436 3071 dbSNP
rs1034378828 3072 dbSNP
rs1333358004 3073 dbSNP
rs1398005555 3075 dbSNP
rs573891532 3079 dbSNP
rs1028941424 3087 dbSNP
rs1381330137 3089 dbSNP
rs981869422 3091 dbSNP
rs1242181823 3108 dbSNP
rs1312241106 3112 dbSNP
rs1292221318 3117 dbSNP
rs1319117280 3124 dbSNP
rs1451341561 3130 dbSNP
rs1220838531 3140 dbSNP
rs1256770266 3142 dbSNP
rs971477459 3144 dbSNP
rs1339267213 3151 dbSNP
rs1400513401 3154 dbSNP
rs1201485607 3159 dbSNP
rs901403582 3160 dbSNP
rs1440713113 3172 dbSNP
rs1332989727 3174 dbSNP
rs1020334050 3180 dbSNP
rs1010321023 3182 dbSNP
rs893344516 3184 dbSNP
rs1033215886 3187 dbSNP
rs560447719 3188 dbSNP
rs540235875 3190 dbSNP
rs1421159608 3192 dbSNP
rs1461443229 3200 dbSNP
rs1048471830 3201 dbSNP
rs532239045 3204 dbSNP
rs1393786997 3211 dbSNP
rs1311955041 3213 dbSNP
rs1340722397 3219 dbSNP
rs764716668 3226 dbSNP
rs1170264965 3228 dbSNP
rs932992794 3242 dbSNP
rs901557471 3248 dbSNP
rs1234621417 3257 dbSNP
rs1258212862 3257 dbSNP
rs894567597 3261 dbSNP
rs1210233812 3262 dbSNP
rs1287066191 3263 dbSNP
rs1424901753 3270 dbSNP
rs1036114683 3274 dbSNP
rs577759127 3277 dbSNP
rs1191720026 3280 dbSNP
rs1055996249 3291 dbSNP
rs1181809743 3297 dbSNP
rs1444113567 3299 dbSNP
rs1238945897 3300 dbSNP
rs938546102 3302 dbSNP
rs1379285087 3306 dbSNP
rs1258996426 3310 dbSNP
rs928525042 3338 dbSNP
rs1197787376 3342 dbSNP
rs185806485 3343 dbSNP
rs977335734 3346 dbSNP
rs1250545169 3349 dbSNP
rs759199519 3350 dbSNP
rs776318759 3354 dbSNP
rs1329831197 3358 dbSNP
rs1323408931 3363 dbSNP
rs1312859973 3383 dbSNP
rs537980711 3385 dbSNP
rs985095485 3387 dbSNP
rs1485455201 3399 dbSNP
rs1210192712 3402 dbSNP
rs953210130 3411 dbSNP
rs1310922788 3430 dbSNP
rs607389 3431 dbSNP
rs927216574 3441 dbSNP
rs1156571179 3444 dbSNP
rs1372250180 3451 dbSNP
rs1344220092 3458 dbSNP
rs965567453 3459 dbSNP
rs571190303 3462 dbSNP
rs555950250 3463 dbSNP
rs971806623 3468 dbSNP
rs1379301711 3473 dbSNP
rs1020324008 3487 dbSNP
rs988889323 3489 dbSNP
rs1424030414 3490 dbSNP
rs1380982996 3506 dbSNP
rs181219416 3510 dbSNP
rs1322525230 3517 dbSNP
rs1033163368 3520 dbSNP
rs1267016077 3525 dbSNP
rs1027368185 3526 dbSNP
rs1007487383 3533 dbSNP
rs1212996532 3542 dbSNP
rs144621665 3550 dbSNP
rs1238707299 3554 dbSNP
rs1458753427 3561 dbSNP
rs761060695 3562 dbSNP
rs890013441 3565 dbSNP
rs1030333280 3570 dbSNP
rs894528692 3574 dbSNP
rs1055895799 3577 dbSNP
rs1250138330 3580 dbSNP
rs938504805 3592 dbSNP
rs997150488 3596 dbSNP
rs189701467 3598 dbSNP
rs1403057631 3603 dbSNP
rs1440166201 3610 dbSNP
rs1490788708 3611 dbSNP
rs1036103396 3612 dbSNP
rs940446888 3629 dbSNP
rs1289422815 3635 dbSNP
rs914501087 3648 dbSNP
rs1310763704 3652 dbSNP
rs887546810 3661 dbSNP
rs1235336197 3662 dbSNP
rs1232438810 3667 dbSNP
rs1258684102 3668 dbSNP
rs1319868657 3672 dbSNP
rs1202304174 3674 dbSNP
rs1231830046 3677 dbSNP
rs1483253941 3678 dbSNP
rs606132 3691 dbSNP
rs1048859640 3698 dbSNP
rs140800418 3701 dbSNP
rs185248149 3707 dbSNP
rs59902882 3707 dbSNP
rs1019828821 3717 dbSNP
rs9666975 3727 dbSNP
rs982957363 3733 dbSNP
rs1359817776 3734 dbSNP
rs1236307208 3739 dbSNP
rs1046101269 3740 dbSNP
rs1467644158 3742 dbSNP
rs951569230 3749 dbSNP
rs561223 3751 dbSNP
rs950046880 3758 dbSNP
rs545741538 3759 dbSNP
rs1413979335 3768 dbSNP
rs1278638891 3782 dbSNP
rs373128628 3783 dbSNP
rs1363751040 3785 dbSNP
rs913263258 3786 dbSNP
rs550536613 3791 dbSNP
rs569097722 3793 dbSNP
rs1211596283 3794 dbSNP
rs957427739 3795 dbSNP
rs1485159150 3797 dbSNP
rs531053958 3802 dbSNP
rs985611403 3803 dbSNP
rs995885041 3819 dbSNP
rs1301742960 3834 dbSNP
rs1474592623 3854 dbSNP
rs1186512340 3864 dbSNP
rs1426467521 3869 dbSNP
rs1416286457 3881 dbSNP
rs954355758 3887 dbSNP
rs1374882595 3892 dbSNP
rs1420560410 3898 dbSNP
rs1300204020 3903 dbSNP
rs1346821452 3905 dbSNP
rs1361778919 3919 dbSNP
rs1029910178 3921 dbSNP
rs1160348208 3928 dbSNP
rs1451749324 3929 dbSNP
rs1363397886 3930 dbSNP
rs1034827261 3934 dbSNP
rs901929292 3935 dbSNP
rs1236356966 3938 dbSNP
rs562004142 3938 dbSNP
rs1346448018 3939 dbSNP
rs28622268 3940 dbSNP
rs1198510043 3943 dbSNP
rs659943 3948 dbSNP
rs1215490971 3949 dbSNP
rs1247840041 3949 dbSNP
rs1445693864 3949 dbSNP
rs72193917 3949 dbSNP
rs965685943 3951 dbSNP
rs1479306229 3953 dbSNP
rs1041496704 3957 dbSNP
rs529031615 3958 dbSNP
rs560384557 3961 dbSNP
rs559353 3962 dbSNP
rs1256160528 3978 dbSNP
rs1224949490 3982 dbSNP
rs893015985 3986 dbSNP
rs577986140 3987 dbSNP
rs1054409967 3989 dbSNP
rs1001373483 3990 dbSNP
rs905726424 3995 dbSNP
rs768667487 3999 dbSNP
rs1281736395 4001 dbSNP
rs949994488 4002 dbSNP
rs1223331394 4010 dbSNP
rs181604505 4011 dbSNP
rs1053019869 4017 dbSNP
rs776855800 4024 dbSNP
rs1291060254 4025 dbSNP
rs1320888484 4029 dbSNP
rs1252909722 4033 dbSNP
rs1458314387 4049 dbSNP
rs1180557664 4053 dbSNP
rs1231208425 4054 dbSNP
rs543833894 4055 dbSNP
rs10897525 4063 dbSNP
rs1462812488 4064 dbSNP
rs1384365178 4065 dbSNP
rs985985990 4075 dbSNP
rs368606890 4077 dbSNP
rs1471077195 4082 dbSNP
rs780452871 4093 dbSNP
rs1284353058 4123 dbSNP
rs976938618 4128 dbSNP
rs555544527 4135 dbSNP
rs1273156916 4137 dbSNP
rs1319257584 4157 dbSNP
rs961593880 4160 dbSNP
rs1015862780 4165 dbSNP
rs1190947670 4169 dbSNP
rs1004513471 4173 dbSNP
rs951731517 4192 dbSNP
rs1027398749 4195 dbSNP
rs1248529122 4197 dbSNP
rs1437249208 4198 dbSNP
rs1001719864 4201 dbSNP
rs905677052 4203 dbSNP
rs1256231259 4213 dbSNP
rs555129550 4216 dbSNP
rs974374209 4217 dbSNP
rs9666831 4222 dbSNP
rs1185486841 4223 dbSNP
rs1416846923 4224 dbSNP
rs1014054995 4226 dbSNP
rs1169518321 4227 dbSNP
rs1393695618 4232 dbSNP
rs1262142585 4235 dbSNP
rs1408851676 4236 dbSNP
rs1334459474 4239 dbSNP
rs891677815 4245 dbSNP
rs1340505405 4246 dbSNP
rs767772365 4249 dbSNP
rs1356942681 4259 dbSNP
rs1412494085 4265 dbSNP
rs1293091299 4273 dbSNP
rs1272375002 4274 dbSNP
rs1052967009 4275 dbSNP
rs1326428064 4277 dbSNP
rs116137216 4279 dbSNP
rs1454697374 4285 dbSNP
rs904553898 4287 dbSNP
rs1034386634 4288 dbSNP
rs1049820035 4300 dbSNP
rs1210377919 4304 dbSNP
rs932707059 4310 dbSNP
rs922724981 4311 dbSNP
rs548667556 4313 dbSNP
rs9666331 4313 dbSNP
rs971413174 4321 dbSNP
rs1172688104 4323 dbSNP
rs553143832 4329 dbSNP
rs1388345385 4331 dbSNP
rs940174932 4334 dbSNP
rs1376691201 4335 dbSNP
rs1020340621 4338 dbSNP
rs1311830727 4339 dbSNP
rs1361651363 4352 dbSNP
rs1384263438 4355 dbSNP
rs1010012905 4359 dbSNP
rs908793764 4360 dbSNP
rs1326321613 4361 dbSNP
rs142692894 4379 dbSNP
rs1305748251 4381 dbSNP
rs1054778508 4386 dbSNP
rs1210441898 4390 dbSNP
rs1475023830 4404 dbSNP
rs570778829 4407 dbSNP
rs1486101566 4416 dbSNP
rs148473896 4418 dbSNP
rs1184850614 4429 dbSNP
rs1259352947 4430 dbSNP
rs1442272584 4436 dbSNP
rs1446380938 4450 dbSNP
rs1242071613 4458 dbSNP
rs1194125355 4459 dbSNP
rs1396371476 4459 dbSNP
rs1027757619 4461 dbSNP
rs1178879990 4462 dbSNP
rs1439254363 4464 dbSNP
rs979811033 4474 dbSNP
rs1384635258 4480 dbSNP
rs970182053 4483 dbSNP
rs1275548315 4486 dbSNP
rs1328434771 4490 dbSNP
rs1368952728 4493 dbSNP
rs1233641097 4497 dbSNP
rs1310318994 4500 dbSNP
rs1040024800 4501 dbSNP
rs1194481631 4501 dbSNP
rs537002429 4515 dbSNP
rs777765915 4519 dbSNP
rs907595248 4525 dbSNP
rs1214322649 4528 dbSNP
rs1254804485 4532 dbSNP
rs1466791203 4534 dbSNP
rs1024015459 4537 dbSNP
rs1192425118 4551 dbSNP
rs1250565145 4559 dbSNP
rs774012446 4563 dbSNP
rs75461864 4569 dbSNP
rs1363588124 4573 dbSNP
rs1462289086 4577 dbSNP
rs116476958 4579 dbSNP
rs1380686244 4580 dbSNP
rs764785322 4581 dbSNP
rs528576767 4601 dbSNP
rs1298843147 4603 dbSNP
rs1375550726 4607 dbSNP
rs1389899102 4609 dbSNP
rs1306559877 4618 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaauacaCGACGAu 5'
                         |||||| 
Target 5' -cuauuacaaauaaaGCUGCUa 3'
1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000294066.2 | 3UTR | CUAUUACAAAUAAAGCUGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000294066.2 | 3UTR | CUAUUACAAAUAAAGCUGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000294066.2 | 3UTR | CUAUUACAAAUAAAGCUGCUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.301 2.8e-3 -0.271 6.6e-3 83 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.525 8.7e-3 -0.618 1.8e-3 20 Click to see details
GSE17306 Multiple myeloma -0.261 3.5e-2 -0.281 2.5e-2 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.367 3.9e-2 -0.337 5.4e-2 24 Click to see details
GSE19783 ER- ER- breast cancer 0.198 4.0e-2 0.277 6.7e-3 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.389 4.5e-2 -0.463 2.0e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.341 4.8e-2 -0.137 2.6e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.298 8.4e-2 -0.307 7.7e-2 23 Click to see details
GSE19536 Breast cancer 0.111 1.4e-1 0.140 8.2e-2 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.164 2.2e-1 -0.239 1.2e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.083 2.2e-1 0.056 3.0e-1 90 Click to see details
GSE28544 Breast cancer 0.146 2.5e-1 0.163 2.2e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.202 2.5e-1 -0.126 3.4e-1 13 Click to see details
GSE21849 B cell lymphoma -0.093 3.2e-1 -0.180 1.8e-1 29 Click to see details
GSE19350 CNS germ cell tumors 0.13 3.4e-1 0.280 1.9e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.074 3.4e-1 -0.065 3.6e-1 32 Click to see details
GSE38226 Liver fibrosis -0.082 3.6e-1 -0.127 2.9e-1 21 Click to see details
GSE17498 Multiple myeloma 0.024 4.4e-1 -0.021 4.5e-1 40 Click to see details
GSE27834 Pluripotent stem cells 0.039 4.4e-1 -0.085 3.8e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.008 4.7e-1 -0.050 3.5e-1 64 Click to see details
GSE21687 Ependynoma primary tumors -0.008 4.7e-1 -0.050 3.5e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.26 0.02 0.251 0.03 59 Click to see details
HNSC -0.262 0.05 -0.234 0.07 42 Click to see details
KIRC -0.193 0.06 -0.166 0.09 68 Click to see details
COAD 0.512 0.1 0.476 0.12 8 Click to see details
BLCA -0.304 0.11 -0.280 0.13 18 Click to see details
ESCA -0.329 0.16 -0.464 0.08 11 Click to see details
KIRP 0.166 0.18 0.196 0.14 32 Click to see details
PCPG -0.794 0.21 -1.000 0.5 3 Click to see details
UCEC -0.197 0.21 -0.251 0.15 19 Click to see details
LUSC -0.11 0.26 -0.120 0.24 38 Click to see details
BRCA -0.04 0.36 0.014 0.45 84 Click to see details
CESC -0.422 0.36 -0.500 0.33 3 Click to see details
LIHC 0.051 0.36 0.130 0.19 49 Click to see details
STAD -0.057 0.38 0.007 0.48 32 Click to see details
CHOL -0.092 0.41 -0.033 0.47 9 Click to see details
PRAD 0.026 0.43 -0.022 0.44 50 Click to see details
KICH -0.031 0.44 -0.102 0.31 25 Click to see details
LUAD 0.008 0.49 -0.105 0.37 12 Click to see details
PAAD 1 0.5 1.000 0.5 4 Click to see details
PAAD 1 0.5 1.000 0.5 4 Click to see details
PAAD 1 0.5 1.000 0.5 4 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3