miRTarBase - #MIRT545961 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZBTB10   
Synonyms RINZF
Description zinc finger and BTB domain containing 10
Transcript NM_001105539   
Other Transcripts NM_023929   
Expression
Putative miRNA Targets on ZBTB10
3'UTR of ZBTB10
(miRNA target sites are highlighted)
>ZBTB10|NM_001105539|3'UTR
   1 CTGACCTACTATACTCCTCAAGGATGCTGCATTTGGACCTAATATGAATCGACAATTTGGATTGTTGAACTTGAAGGCTT
  81 GCAAAATATGGTACATGCTGGATAGTAGTTATGTTGCTGTGAAAACTGTAGGGTCAAAGCCTTATAGCAAAAAAAATTTT
 161 TTTTTATATTTGCACAGGACTATACAGCAAACAACCATGTGGTTGGATTACATGGAGTCCCCACATACTCAGTCAGTTAT
 241 CAAAGTAAAATATTTTTTATTTATAGGATATACAGTAACTATTTGGGTCCTATGAAAATAGTCCTTAAAGAGCTTACATT
 321 CATGTGCTACTTTAACATGAATGGAGAAAATCCGTTTATGGAAGTACAGTGACAATTGACCCAATCACTCTGTCCATCAA
 401 ACCACTCAGGCTAGTTTGTACTAGTAGAGTTTTGTTTCTATTTTTATTTTTATTAATTTTATTTTTTTTAATACAGATTT
 481 TCAGTGAGGGGCTTTTTCAACCCCATTGGTTCTATTTTCTTGTATTTTTCCATTTAATTTGCTTCATAACTTAAACCAAG
 561 TCTCTTCTAGTCTTAGGTATTATTTCTCGATTTTGTGCTGATGGGCATGTTTATAAGAACTGGAGAGGTAATTTATTGGA
 641 ATGAACTAACTGACTTCCTCCATTCCCCTCTTCCTTTTTGACATGAATTTTACTACTTCACAAATGAAGAATGATGTTAT
 721 GAAGTTACCGTGGCGAAGTTGACAAATACCACTAAAATGATTATGATTTAGAAGTAACTTTCTTCTGCTGCTCTAATCTG
 801 ATAAATGGTTACTATATGATATTTTCTGACATGGTATTTGGTTTTGGGTATCTGTTACTTTGGCACTATTCTTGTTTGCC
 881 TCTTTATTTTTGCCAGTGTACTATACCTCAGTCCTATTTGAAAGACCTAATTGAAAGAAAAATCATAGAAATAAGTAAAA
 961 TGATTTGTTTTATAATTTATCCACCATGTCCAGTTTGGTTAGCTTGTTATGCAATATAAGTGAAATATCAGGTTTTTACC
1041 CGTGTCCCTTTTATCATGAAAATTAACACAAAATGTGCATTCTCTTTTGTTTCATACTTAGCGGGATATTGATTGTTTTG
1121 AAATTATGATCAATACTTAATTTATTTTTTTCTGTCCTTGAAGTCACTACACCTTGATACAGTCTTTCTAGTAGTCACCA
1201 TGATTCAACAGTCTCAAAAATCTTACAAATAAAATTCTGAGAAGCTTTATTATTCTATAAATTCTTCAGGGTACAAAGGG
1281 TGACATATTGAGGTGAAATTGTCAGATTTACTTAGCCTGGTGACATGAATTAGCTGATTGTGGAACTCTCAGCAGCATTT
1361 CACGTATTGTTAACATGTATGGCATTTATTAGCATATTGTATATTATATAAGATTGAGGGATGTCATATTTTCAGCTTTC
1441 TTTTAAATAAAAATTGAGTATATTTTCCTATTTTATATCAGGTAACTAAATTATGCTAGTTATGTGGAAAAAATTGCAAA
1521 GATGCTTTGACAGATATAATCCCTTTGGTGCTCCATCTGATCAAAGTTGAAAAGTTGATGTTTTTTAAGAGACAAGCTTT
1601 ATCATTGTCTCTGATTTCAGTAGAATAATGGTTTATTGTTAGACAATGATGTTTCTGCTTGGATAAATCAAAGATAAATT
1681 ACAGTTACATGGTTAGATGCATCTTTTGTCATCTATATTGTAGTTTCTACATAACTGTAAACCTGACAGATAAGAATAGT
1761 TTCGGTTTGATTTTTGTTTAAAACAGATGAGTACTTCTTAATGTTCTAGACAAATGAGTAAAATGTATTTCTGGTAGAAA
1841 TTAGTTGGGCAAAGATACTATGAATGAAAAAGTATTTTAAACGTAAAATGTTCTTTGTGAATATGTAAGTATAGTATAAA
1921 GATTTCTTTCATCCCATTTATCCCCTTCCTTTAAATAAACTAGTTTACAATTGGTAGATCTGTCTATATATAAATATATA
2001 TTAAAGAACAAAGATATATATCTAAAAATCACCTAAATCTGCTTTATTAGACTACAGTTCACTTATTGCATAGAAACTGG
2081 ACTTGGCTTTACATTCTTAATGTACTTTTACTTTTCCTCAAGATATGAACTTACTCTCTTGAAGCTGAATTTTCTTTTAC
2161 TACTTAAATCATTTATGTATATCTGGTAAATTATGACCAAATTTTTGTTAGATTGCATACAGTAAATTGAAATACACACT
2241 TGGTACACTACGGGATTGTTGTGCTTTTGTTTGGTTTTAGTTGGAAATAAGGTTTGATGTAGATGGCTTGTTACTGTTAA
2321 TTTAAAATATTCTATAATTGTCCATTACTTTATGTTGTGTTGTGACAGATTTGGCTATATTTTTAGTCAATTGAAATATG
2401 ATACTTTAAAAGTTTGTTTTTAGGTAATCCAAAGGAAAAGTGTTTATACTCTTGAATATATTAGCCTCAGCCTATATAAA
2481 AATTTCTTTGAAGTAAACATTTTACCGGAAACAGAATTGACAGATTTTTCTACTTGCTGACTGCCTAACTTATTTTGTTT
2561 CATGATCTCGAGGGACTGCCTTTTCCCATCTAGATCTTTTAAAAAAATAGTTTTAGTACTAAGGTATACTACTGGACATT
2641 TCTATTTTTTTAAGTGTATTCTTTTTCTGACTTACAGTAAAATTTCAGGAAGTTGATAGATACTAAGAACTTATGATTGG
2721 TCTCAGAGGTAACAATGAAATACTCATAATTTTGTCTGTGGAACTCTGGCAGAATTATGTTACACATTTGGCGAAGTTGT
2801 CTCTTGTAATTTATATTTTAAATGAAAAAGTATTTTAGAGCTTTTAATGAAGGGGAAGAGTATAAACTTTCTTTCATATT
2881 CACTCTGTAGTTACAGACCGTCTCATAAATCAAGATTGTGCATTATTAGAGTTCTCAGAGACAGATACTTCCATATGGAC
2961 CCCTGTTCATTTTTCTTATTTACTAGATATTTTGCTAAATTTAGCACACTAGCAATTAAGAGTTTAAAAAAGAAGAAACG
3041 TTATAGGAAAGGGAAACTGAACAGTAATGAGTAGCTTTGAAATTGGGGAAAACACACTAGCTGGGTTAGGTACAGCTATC
3121 CTAATGGAGAAGAGTGAGCTAAATGCGTTAATTCATGTAAAGTGCTTAGAACACTGGTACATAATAGGTGCATAACACAT
3201 CTTAAAGTTGTTTAATAATAGATAAGAACCAAGAGGAAAAAGAAATAAGAAAAGATGGGGGAAAGGAAGGAGAAAATAGG
3281 AAATGAAAGGATTAGGACTTGGGCATTTATATTAATACAAAATGGTGTAAACGGCCTGAATATCACTGTAGTAGTATCAT
3361 ACGGGGGAAAGTGTGATGGAAAATAGGTTTAAAAATCTTAATTTTTAAAACTTTAGTAAGCTTTATTTATATTTTTTAGG
3441 ATTTTCTGAACATAGCATGAAGGGTTTAGATTCATTTTTCTGAAAAACGATTAAAAAAACTACCAATTTTTTTTTTGAGT
3521 GCCCACACTTGCCGTTGTGCTGTATACATGATTTTACCTTAATCCTCTATAAGGTAGGTGCTAATTGTCTCCATTTTATA
3601 GATGAGGAAAGGCTCAGAGAAATTCAGAAACTTGGCTAATTTAACACAGCTGTGACAGAGCTCGAATTTGACCACGTCTG
3681 ATTCTGAAGCCCATACTCTTTCAGGGAGGCTCTATTGCTGCCTCATTAAACAACTCTTGTAGAATTTCAGCTCTTAATGG
3761 AGTCTATGGATTATATTTTTCCTATAAGACAGCTGTGTTTAGAATTTTGAGTGTCTTTCCTCCCCCCAATAAATTTCCTT
3841 ACTACTCTTTCTTCATAAAGCAGTTGTTTTGTCACTTTGACTATATTAAGACACATCAGTGTAGCACATGCTCTTAACTG
3921 GCTGTGGCATTTTAATTTTATAAAAGAATGGTTTTTATCTGAAGAACTAGATAGAAACCCCAGTTTTTGTGCCGTTCAGT
4001 CACCCAGATCCTTAAACTTAACTATGGTACATAATATCCACACTTAGAACTAACAGGTGTTTAGTCACTTTAGGACTTAA
4081 AATGGAAAGTTTTTTTTTTTTTCCTGCTGTATCTCTGCTTTCAACTGAAGTTAAAGAATTCTAGATAGTTTAAAATGTGT
4161 TAGGGATAAGCACACTTCAAAAGATGTTTTCTAGCCCTAAATTTTATGACATTGGGTACTTAAATTTGGAGTACACTAGC
4241 TATTGAGAACAATATTTTGGGTTGAGGAGAGATGGTTGAGGCCATTATTTAGTGGGAGCATTGGCATTTTGAACACTGTA
4321 AACAAAAGAACACTTCCGCCTGCTGTTTGTAAAAGCTCTTTGGGAAGATCTTTTACGAAGACCAACTTTTTAAAATGTAA
4401 ATTACCTACCTAATATAAGTGTCCTAAGACATGTATGTAAACTTCCGGAACTGTTTTGTCTGTGTATTTAGAAAATACAC
4481 AAGAATCTTTATTCAAACCTAAAAATATAAACTTGTGAGCACTAAACTGCTTCTGGCTTTGTGAATTTTATTGACTGACA
4561 TTTAATTCAGATTTCTTTGCAAGTGTACTAATTTAGACTAATTGGGGTAAGGGGAACACCTTAATGAACTTTGACTTATG
4641 TATAATTCAGATATCTTTGTACTTAAGGCTTACAAGTTTGAATTATGGAATACTATAAGGGTTTTTTGTTTATTTGTATG
4721 TTTTTATATGAAAGTACATAAATGACAGACTACCTCCAAGTAATCCTGCTTTAATTAATAGCAGTGATTTGTAATCAGTG
4801 TATCTTTTAAGATTCTCTACAGGTTTTAGAAAATATTAAAAATTCCCTGTAATTTACATTTGTGCATAATCTTGGAAATG
4881 GGTTGAAAAGCAAAGGTAAACTGCTTCATCCCATGTTGTATATTTGTGGACTGATTGACTACAAGTGATGTGATGTTATA
4961 AATTTGAAGTCTTTGAAACTTTATTAATGTAGAGAAAACATAACTAGCTTTTTAGGTTATTTCAAAGTTAGTAATAGAGC
5041 AAAGGAAATCAGAACTGGCCAGATATTCAGACTTGACTTAGAAAAACAGGAGTTTGTTGATTTTGTTTGGAGAAGGGCAC
5121 AATAAAGGGGAGCCCACATAGCATTATAATGCCTAGTATCTTTAAACATGTAAAGAGCTATCATGAGGCAGAAGAATTAA
5201 GAAACTTTATATGTTTCTAAGGGGTCATGATTGGGACCATTGGCTCAAGATTGAAAATCGGTTTTTAATTATCCAAAGAT
5281 GAAATGGGGCTGCTTCAGAAAAAGGTCTACCACTGGAGATAACGCTATGAAAAGTGAAAGAGATTACTTAATCATTTTGA
5361 CAAAGGCAGTATTGACCAGACATTTCTATTTCAGAGTTGGATTTGTGCTTAGTTTTTTTTAGGTGTTGGGACCCTTGTAG
5441 TTGCTTTTTATTTTGCTTAGTCAACAAACACTAAAATGATAAAATTTGGTATGTATAAGTACTGGACGAAGGATGTTTTG
5521 ACACTAAAAAGGACATAATTTAGGAAATTAAGAATTTAGACACCAAGTTTGGCTTAATAGAAAAAGTCACTATCTGAACT
5601 TCTTTCTTTTTCACCACAAATCACCGCAGACCAGTGTTTGGGAGCAGGTGTAGGAAATTGAATTATTGGATCTATGTTTA
5681 GGTAAGAAAACTAAAGGTACTTCAGAATTTAGGCTATGACATAACTGTCTTTCTGAAGTTTAAAGAAAGAAAGTGAACTA
5761 TAGAAATCTATTCAGCTAATTAAAGTGAATGAAAAATATTACAGATTCCATAACTGCATGGCGCCTTACCTGCTATTAAT
5841 ACTGCCGCCTTACTGTCAGCCAGATGATTTTTTCCCACCACGGCCAGTCTTAAATTTGGCAATAAGAAAAAGCTAATCTT
5921 CCAAGTGTAAGTAGGTATGTGTTAGAATCTTGGTGAAAGATAAACACAAGACAGTCTTCTTGGCGCAGGTCCTAACAGTT
6001 GGTGAGATAATACATAAGATGGTTTCAGGATTATTGTAGAATTATTTAGGTTGAAAGAGACTGTAAGAGACTAATGAAGC
6081 ATACCCAGAGAGGTTGCTACAGTGACTCCAGTCAGTTTTAGGACCCAGGACTCCTGAACTTCAATTTCAGTATTATTTTT
6161 CTGTACCAAACTCATTCAATAAATACTTGAGATTAGGGATAAGTTTGAAGTTAGAAGATTCCAGAGTACACTCAAATAGT
6241 ATTTGGCACATAGCTTGTTGATCAAAAGTATTTACTAAGTGAGTGACAAAAGGCACTAGCAACTTTAAGGATTTTGCCTA
6321 TTAGTATCATATGGCATGTAGCTATCAAGCCAGTTTCGTTTAGTTATTTTGTGTTGCCAAGCATATGATACGTGGTGTCA
6401 CACTGAGCCTTTGGGATCCTTTCCCTGGATACATAACCCTAGTAGATAATGTTACTGCAAGATGTAATGACCAAATCCAA
6481 CCTACTGCAAATGTTACTATGGAAATCTCAATGCAAAAGTAGCCTTTGTGATTTTTTTTTTAAACCGTCTCCATAACAGA
6561 ACACTTAGAATTATTAGCCATTTGCTGCAAAGTATTTGTTTTAAAATGTCTGGCATATACACCACTAACATTTAAATGCC
6641 CAACATTCGGTCTATACGTGAAAAAACTAGAAGAAAAGCCCTGTTGGAGTTTTGATGTAGAGTGCAATAATACATCAATA
6721 AAGGTATTTTAAAATGAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              |||: |  | ||||||| 
Target 5' aagtAACTTTCTTCTGCTGCTc 3'
772 - 793 154.00 -9.40
2
miRNA  3' gugUUUGGUAA----UACACGACGau 5'
             :||::|||    || ||||||  
Target 5' ttaGAATTATTAGCCATTTGCTGCaa 3'
6565 - 6590 141.00 -12.60
3
miRNA  3' guGUUUGGUAAUAC-ACGACGAu 5'
            :|:|| || ||| | ||||| 
Target 5' gtTAGACAATGATGTTTCTGCTt 3'
1638 - 1660 136.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26548332 36 COSMIC
COSN14354731 52 COSMIC
COSN30123118 90 COSMIC
COSN31600717 156 COSMIC
COSN20081276 157 COSMIC
COSN28637878 157 COSMIC
COSN30711156 157 COSMIC
COSN14354733 158 COSMIC
COSN31527618 253 COSMIC
COSN31603299 259 COSMIC
COSN31551363 625 COSMIC
COSN31483627 671 COSMIC
COSN20091827 731 COSMIC
COSN9270169 746 COSMIC
COSN23383845 776 COSMIC
COSN15777016 866 COSMIC
COSN28747949 925 COSMIC
COSN28683688 1059 COSMIC
COSN20105613 1262 COSMIC
COSN20825470 1472 COSMIC
COSN16044144 1587 COSMIC
COSN8104067 1884 COSMIC
COSN5689220 1912 COSMIC
COSN16853990 2014 COSMIC
COSN24160719 2139 COSMIC
COSN30023794 2293 COSMIC
COSN9682337 2328 COSMIC
COSN22589197 2350 COSMIC
COSN5689221 3035 COSMIC
COSN17413709 3080 COSMIC
COSN28247106 3120 COSMIC
COSN17733725 3236 COSMIC
COSN4942142 3481 COSMIC
COSN20651171 3535 COSMIC
COSN29263734 3775 COSMIC
COSN20983094 3957 COSMIC
COSN29847520 4090 COSMIC
COSN29044584 4260 COSMIC
COSN6365040 4280 COSMIC
COSN18817378 4500 COSMIC
COSN18955451 4554 COSMIC
COSN16996662 5026 COSMIC
COSN7678141 5323 COSMIC
COSN27683796 5421 COSMIC
COSN8104068 5707 COSMIC
COSN9682338 5971 COSMIC
COSN26089421 6452 COSMIC
COSN26089326 6459 COSMIC
COSN8104069 6512 COSMIC
rs1051920 6658 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746226939 5 dbSNP
rs781245027 7 dbSNP
rs1301779073 11 dbSNP
rs377087465 12 dbSNP
rs1233174476 13 dbSNP
rs1165590620 14 dbSNP
rs770281124 14 dbSNP
rs1301502674 17 dbSNP
rs1313545861 19 dbSNP
rs1331025954 23 dbSNP
rs1324353045 24 dbSNP
rs538698460 24 dbSNP
rs1259571568 25 dbSNP
rs976292041 27 dbSNP
rs1210511584 32 dbSNP
rs1250975235 34 dbSNP
rs542147137 41 dbSNP
rs749160580 45 dbSNP
rs1427548701 46 dbSNP
rs201660957 51 dbSNP
rs1391800513 52 dbSNP
rs923526259 56 dbSNP
rs529697436 74 dbSNP
rs1247190902 82 dbSNP
rs1411866084 90 dbSNP
rs779218111 92 dbSNP
rs930236790 93 dbSNP
rs752971305 96 dbSNP
rs1435600636 102 dbSNP
rs192521128 103 dbSNP
rs914310119 106 dbSNP
rs888599550 113 dbSNP
rs1343767840 120 dbSNP
rs1415711697 144 dbSNP
rs1217822698 146 dbSNP
rs1275930472 149 dbSNP
rs1344987439 149 dbSNP
rs76997731 149 dbSNP
rs941791240 149 dbSNP
rs1354061027 156 dbSNP
rs1038774465 157 dbSNP
rs1410674901 157 dbSNP
rs184338102 157 dbSNP
rs1041462885 158 dbSNP
rs924257992 164 dbSNP
rs1171575859 175 dbSNP
rs1413666015 175 dbSNP
rs938354839 177 dbSNP
rs1193704293 179 dbSNP
rs1468484868 183 dbSNP
rs1056946755 184 dbSNP
rs1483864588 186 dbSNP
rs894419441 188 dbSNP
rs1442790571 200 dbSNP
rs1012732735 202 dbSNP
rs1212698738 216 dbSNP
rs878892066 220 dbSNP
rs1048732360 221 dbSNP
rs557029664 227 dbSNP
rs999445412 229 dbSNP
rs1287885682 234 dbSNP
rs1229071900 236 dbSNP
rs1032611130 243 dbSNP
rs1301347336 264 dbSNP
rs888298135 272 dbSNP
rs1359540279 293 dbSNP
rs781119132 294 dbSNP
rs1435753885 317 dbSNP
rs1023652002 323 dbSNP
rs1315154565 325 dbSNP
rs970703935 327 dbSNP
rs1473270067 332 dbSNP
rs1414970569 342 dbSNP
rs982486284 349 dbSNP
rs1015018598 350 dbSNP
rs761813001 353 dbSNP
rs866406973 354 dbSNP
rs532247938 355 dbSNP
rs1030580678 358 dbSNP
rs953782041 378 dbSNP
rs984377417 384 dbSNP
rs986304349 390 dbSNP
rs1022184198 395 dbSNP
rs910067486 395 dbSNP
rs942824374 400 dbSNP
rs551956707 415 dbSNP
rs968878146 424 dbSNP
rs1380156542 426 dbSNP
rs71516993 436 dbSNP
rs1285794347 441 dbSNP
rs1038806594 446 dbSNP
rs201350779 452 dbSNP
rs1321176753 461 dbSNP
rs1327694626 462 dbSNP
rs1391668932 462 dbSNP
rs1458705378 462 dbSNP
rs1163385829 469 dbSNP
rs1405667104 470 dbSNP
rs1415496639 472 dbSNP
rs557309642 475 dbSNP
rs1224522485 476 dbSNP
rs977103911 489 dbSNP
rs1247740553 492 dbSNP
rs933075103 493 dbSNP
rs924374137 496 dbSNP
rs1263826484 499 dbSNP
rs139694671 503 dbSNP
rs1220910367 506 dbSNP
rs938345016 515 dbSNP
rs1322603658 527 dbSNP
rs1292256564 529 dbSNP
rs992924631 541 dbSNP
rs915814922 542 dbSNP
rs1364220582 543 dbSNP
rs1297987458 549 dbSNP
rs1051904485 550 dbSNP
rs948613833 551 dbSNP
rs1292497905 555 dbSNP
rs745694386 557 dbSNP
rs888236894 566 dbSNP
rs1428637835 583 dbSNP
rs577612622 589 dbSNP
rs1023681755 590 dbSNP
rs769737049 596 dbSNP
rs1003612978 598 dbSNP
rs1026095432 610 dbSNP
rs897951778 613 dbSNP
rs951384448 614 dbSNP
rs1248480328 618 dbSNP
rs1203299774 624 dbSNP
rs1241797032 626 dbSNP
rs997500592 635 dbSNP
rs1275178268 651 dbSNP
rs910098471 652 dbSNP
rs188430655 664 dbSNP
rs1434428644 669 dbSNP
rs1369115382 670 dbSNP
rs1305566169 696 dbSNP
rs1408907853 702 dbSNP
rs1370773130 704 dbSNP
rs1309069588 713 dbSNP
rs975614252 722 dbSNP
rs1030778113 728 dbSNP
rs568356246 729 dbSNP
rs1380046937 730 dbSNP
rs923612559 731 dbSNP
rs1252788565 734 dbSNP
rs79146741 735 dbSNP
rs554143858 736 dbSNP
rs570724907 737 dbSNP
rs779882940 738 dbSNP
rs1313874136 750 dbSNP
rs1239456702 755 dbSNP
rs1262445952 756 dbSNP
rs906353946 763 dbSNP
rs534725564 767 dbSNP
rs1004050331 771 dbSNP
rs1309504694 775 dbSNP
rs1203514640 776 dbSNP
rs1393882639 777 dbSNP
rs772983502 783 dbSNP
rs1302563154 785 dbSNP
rs1400815519 785 dbSNP
rs528279673 786 dbSNP
rs1408930240 793 dbSNP
rs977596253 808 dbSNP
rs1031362644 810 dbSNP
rs1472289164 813 dbSNP
rs1469118034 816 dbSNP
rs1025707221 820 dbSNP
rs539946109 823 dbSNP
rs556219911 831 dbSNP
rs1255289858 834 dbSNP
rs144432315 842 dbSNP
rs535644860 845 dbSNP
rs1484222641 846 dbSNP
rs555688734 847 dbSNP
rs1207986819 848 dbSNP
rs1329266654 850 dbSNP
rs1289619474 851 dbSNP
rs1242167387 855 dbSNP
rs915524118 857 dbSNP
rs1312538274 881 dbSNP
rs1396954956 884 dbSNP
rs192658123 898 dbSNP
rs1182916992 910 dbSNP
rs1457120942 925 dbSNP
rs1016938962 928 dbSNP
rs984416520 932 dbSNP
rs964327834 946 dbSNP
rs909829619 948 dbSNP
rs939817669 957 dbSNP
rs1368092217 963 dbSNP
rs1036905154 966 dbSNP
rs975642162 967 dbSNP
rs541327688 971 dbSNP
rs1187869249 977 dbSNP
rs933365839 983 dbSNP
rs955537135 987 dbSNP
rs1051858493 989 dbSNP
rs1355270926 991 dbSNP
rs1462502718 1004 dbSNP
rs1246488566 1008 dbSNP
rs1362073526 1011 dbSNP
rs889089669 1015 dbSNP
rs987644369 1017 dbSNP
rs1007569929 1029 dbSNP
rs540315784 1039 dbSNP
rs1391807338 1041 dbSNP
rs923673869 1042 dbSNP
rs78450036 1043 dbSNP
rs773920879 1049 dbSNP
rs904826464 1050 dbSNP
rs151111811 1052 dbSNP
rs1388097265 1054 dbSNP
rs1293767137 1069 dbSNP
rs914891793 1078 dbSNP
rs867809224 1085 dbSNP
rs184649753 1091 dbSNP
rs562558730 1095 dbSNP
rs1488264057 1101 dbSNP
rs1450574040 1103 dbSNP
rs1014398975 1104 dbSNP
rs1267382913 1105 dbSNP
rs1224253877 1108 dbSNP
rs1196781773 1109 dbSNP
rs574556013 1110 dbSNP
rs1253093011 1119 dbSNP
rs1022727115 1122 dbSNP
rs970116373 1128 dbSNP
rs1339627282 1137 dbSNP
rs1350582317 1137 dbSNP
rs531580978 1137 dbSNP
rs1228092853 1145 dbSNP
rs1343547864 1145 dbSNP
rs983827823 1153 dbSNP
rs909798311 1158 dbSNP
rs961318479 1163 dbSNP
rs766552354 1166 dbSNP
rs1044932494 1170 dbSNP
rs972652058 1171 dbSNP
rs1307236731 1173 dbSNP
rs1182100536 1176 dbSNP
rs1430135202 1177 dbSNP
rs906377300 1181 dbSNP
rs1170770961 1182 dbSNP
rs1477625560 1183 dbSNP
rs1419166541 1191 dbSNP
rs922389203 1194 dbSNP
rs939162506 1196 dbSNP
rs1481894991 1209 dbSNP
rs1047599729 1212 dbSNP
rs1205379565 1216 dbSNP
rs887235796 1225 dbSNP
rs1275483911 1227 dbSNP
rs114920800 1229 dbSNP
rs771763692 1239 dbSNP
rs1016969462 1240 dbSNP
rs1052251742 1246 dbSNP
rs561690434 1253 dbSNP
rs146449198 1258 dbSNP
rs60732402 1258 dbSNP
rs200483247 1259 dbSNP
rs1299729136 1260 dbSNP
rs33955254 1263 dbSNP
rs369084286 1263 dbSNP
rs371763578 1265 dbSNP
rs375871983 1266 dbSNP
rs369788606 1267 dbSNP
rs943343884 1270 dbSNP
rs188964929 1271 dbSNP
rs553547551 1272 dbSNP
rs904543079 1274 dbSNP
rs1413891695 1285 dbSNP
rs997112570 1287 dbSNP
rs999025109 1300 dbSNP
rs1053319492 1302 dbSNP
rs773536269 1305 dbSNP
rs1410517376 1307 dbSNP
rs547348923 1326 dbSNP
rs1470921154 1330 dbSNP
rs1235029400 1331 dbSNP
rs760978261 1338 dbSNP
rs1228449110 1343 dbSNP
rs766859751 1347 dbSNP
rs989178381 1350 dbSNP
rs1206083509 1353 dbSNP
rs570855100 1364 dbSNP
rs115624080 1365 dbSNP
rs1186816984 1375 dbSNP
rs1204829406 1375 dbSNP
rs759591818 1376 dbSNP
rs1258887483 1377 dbSNP
rs1486923294 1383 dbSNP
rs961033771 1392 dbSNP
rs972620767 1393 dbSNP
rs765402720 1395 dbSNP
rs549903015 1404 dbSNP
rs573700304 1408 dbSNP
rs1383199535 1416 dbSNP
rs1338644784 1423 dbSNP
rs1159251882 1426 dbSNP
rs1412431723 1426 dbSNP
rs1455520175 1426 dbSNP
rs955368619 1427 dbSNP
rs1428530867 1430 dbSNP
rs1172093689 1436 dbSNP
rs1411155464 1438 dbSNP
rs1180520786 1439 dbSNP
rs939258931 1440 dbSNP
rs1185983742 1449 dbSNP
rs1370943471 1468 dbSNP
rs1247551996 1469 dbSNP
rs535510612 1469 dbSNP
rs1428895803 1476 dbSNP
rs1318994463 1477 dbSNP
rs1313234637 1479 dbSNP
rs1377239527 1486 dbSNP
rs1412849223 1494 dbSNP
rs1359903853 1497 dbSNP
rs115938117 1501 dbSNP
rs752879285 1503 dbSNP
rs1364357474 1504 dbSNP
rs1288993756 1509 dbSNP
rs141078463 1518 dbSNP
rs764446473 1531 dbSNP
rs934676545 1537 dbSNP
rs1405534823 1538 dbSNP
rs1305966811 1541 dbSNP
rs1228180374 1543 dbSNP
rs541538272 1544 dbSNP
rs1053287884 1546 dbSNP
rs779112311 1562 dbSNP
rs557310692 1583 dbSNP
rs572517781 1588 dbSNP
rs1165861036 1589 dbSNP
rs868216045 1590 dbSNP
rs1350757259 1593 dbSNP
rs1247911266 1594 dbSNP
rs996810464 1595 dbSNP
rs1030334750 1596 dbSNP
rs950261773 1601 dbSNP
rs1221114861 1604 dbSNP
rs535353906 1608 dbSNP
rs1225874978 1611 dbSNP
rs79662281 1615 dbSNP
rs575839310 1625 dbSNP
rs1016710958 1626 dbSNP
rs1292372918 1632 dbSNP
rs989209341 1632 dbSNP
rs1367023597 1634 dbSNP
rs896794377 1638 dbSNP
rs755878505 1642 dbSNP
rs1448466679 1647 dbSNP
rs1029564788 1648 dbSNP
rs1372814954 1658 dbSNP
rs969037120 1659 dbSNP
rs1430741532 1661 dbSNP
rs1174096967 1663 dbSNP
rs1423234804 1668 dbSNP
rs576811884 1683 dbSNP
rs1396643795 1698 dbSNP
rs980499043 1709 dbSNP
rs985791840 1712 dbSNP
rs1175317038 1716 dbSNP
rs1271280193 1725 dbSNP
rs756633014 1728 dbSNP
rs968306398 1729 dbSNP
rs1482619350 1732 dbSNP
rs1431641918 1736 dbSNP
rs960682422 1752 dbSNP
rs1290677369 1755 dbSNP
rs1360218566 1758 dbSNP
rs1300068374 1760 dbSNP
rs149856943 1764 dbSNP
rs926069156 1765 dbSNP
rs1286092727 1772 dbSNP
rs1408775789 1779 dbSNP
rs1304370719 1788 dbSNP
rs562418750 1792 dbSNP
rs908382657 1794 dbSNP
rs988812174 1802 dbSNP
rs1464029679 1807 dbSNP
rs1357905696 1820 dbSNP
rs1175847009 1826 dbSNP
rs576213115 1828 dbSNP
rs917481874 1833 dbSNP
rs1431479733 1844 dbSNP
rs145676617 1849 dbSNP
rs1472350624 1850 dbSNP
rs1045045277 1853 dbSNP
rs1251061929 1856 dbSNP
rs1178717855 1860 dbSNP
rs906006650 1866 dbSNP
rs1318024365 1871 dbSNP
rs1255368460 1872 dbSNP
rs1482256389 1872 dbSNP
rs941521941 1873 dbSNP
rs1204164930 1880 dbSNP
rs1325087351 1883 dbSNP
rs1038111124 1884 dbSNP
rs1335967444 1893 dbSNP
rs1258425337 1900 dbSNP
rs1393469873 1904 dbSNP
rs1377381299 1906 dbSNP
rs1464202472 1906 dbSNP
rs1336677967 1913 dbSNP
rs1470557774 1914 dbSNP
rs1038464820 1917 dbSNP
rs181976231 1922 dbSNP
rs749180694 1926 dbSNP
rs1364581626 1927 dbSNP
rs993829109 1937 dbSNP
rs1051139921 1940 dbSNP
rs1190391275 1943 dbSNP
rs754200736 1944 dbSNP
rs1184132327 1945 dbSNP
rs1408686074 1964 dbSNP
rs1402371312 1985 dbSNP
rs1462591772 1985 dbSNP
rs1245728481 1987 dbSNP
rs141553867 1989 dbSNP
rs1386563466 1991 dbSNP
rs890791342 1994 dbSNP
rs1456713843 1996 dbSNP
rs1262156389 1998 dbSNP
rs1006786721 1999 dbSNP
rs1320308257 1999 dbSNP
rs527475499 2007 dbSNP
rs1053757767 2014 dbSNP
rs1326860636 2014 dbSNP
rs1396900837 2015 dbSNP
rs1018623395 2018 dbSNP
rs893308439 2020 dbSNP
rs1381749110 2023 dbSNP
rs1274598064 2025 dbSNP
rs1160524023 2029 dbSNP
rs1011666952 2032 dbSNP
rs547706216 2037 dbSNP
rs1384449465 2038 dbSNP
rs1163964916 2043 dbSNP
rs758183987 2049 dbSNP
rs1023084007 2054 dbSNP
rs967895051 2061 dbSNP
rs1388211927 2063 dbSNP
rs969151564 2067 dbSNP
rs1002344986 2069 dbSNP
rs1034718616 2070 dbSNP
rs979258999 2072 dbSNP
rs1033055442 2081 dbSNP
rs956158598 2086 dbSNP
rs1362276618 2099 dbSNP
rs1296068255 2101 dbSNP
rs564218182 2110 dbSNP
rs960621865 2116 dbSNP
rs988863217 2118 dbSNP
rs1320361824 2123 dbSNP
rs1385365831 2125 dbSNP
rs1365165242 2127 dbSNP
rs1374776205 2137 dbSNP
rs1303577423 2142 dbSNP
rs1426350436 2147 dbSNP
rs1225957672 2148 dbSNP
rs1305416029 2150 dbSNP
rs982735499 2163 dbSNP
rs1374365316 2166 dbSNP
rs1196120672 2169 dbSNP
rs184761828 2172 dbSNP
rs757727775 2174 dbSNP
rs962543585 2174 dbSNP
rs1490945727 2187 dbSNP
rs921095383 2190 dbSNP
rs971821425 2191 dbSNP
rs1195792641 2195 dbSNP
rs1340657437 2201 dbSNP
rs1213724546 2203 dbSNP
rs879165286 2213 dbSNP
rs932746455 2216 dbSNP
rs980350235 2217 dbSNP
rs912583858 2222 dbSNP
rs1466838255 2227 dbSNP
rs1053380868 2234 dbSNP
rs934618243 2234 dbSNP
rs927564410 2241 dbSNP
rs1348403708 2245 dbSNP
rs1327936453 2251 dbSNP
rs1011783212 2252 dbSNP
rs1044567307 2253 dbSNP
rs906028895 2263 dbSNP
rs1233231519 2265 dbSNP
rs754970219 2270 dbSNP
rs1429302934 2273 dbSNP
rs1201136355 2281 dbSNP
rs555660914 2289 dbSNP
rs1181498827 2293 dbSNP
rs1175418795 2298 dbSNP
rs1275750459 2301 dbSNP
rs1202286592 2304 dbSNP
rs1322922373 2306 dbSNP
rs1038586255 2326 dbSNP
rs1035158042 2331 dbSNP
rs1225642822 2335 dbSNP
rs1371448663 2344 dbSNP
rs918329860 2349 dbSNP
rs1278776905 2352 dbSNP
rs929674421 2385 dbSNP
rs1337254198 2387 dbSNP
rs778374527 2391 dbSNP
rs1472316875 2400 dbSNP
rs1015260588 2405 dbSNP
rs962658414 2409 dbSNP
rs973967098 2415 dbSNP
rs1406764056 2417 dbSNP
rs890769875 2418 dbSNP
rs1158740015 2419 dbSNP
rs1470735233 2424 dbSNP
rs1234892226 2426 dbSNP
rs1182301954 2428 dbSNP
rs1028188636 2439 dbSNP
rs953990530 2442 dbSNP
rs1397005001 2443 dbSNP
rs1315401893 2447 dbSNP
rs1403809321 2448 dbSNP
rs986907620 2449 dbSNP
rs1283848365 2450 dbSNP
rs1224498579 2466 dbSNP
rs115119756 2470 dbSNP
rs1355492197 2477 dbSNP
rs934755525 2487 dbSNP
rs779804274 2491 dbSNP
rs569675178 2497 dbSNP
rs1383401235 2498 dbSNP
rs1338191879 2500 dbSNP
rs1444728950 2507 dbSNP
rs1000647268 2508 dbSNP
rs988813920 2511 dbSNP
rs408925 2524 dbSNP
rs956541717 2526 dbSNP
rs947671342 2531 dbSNP
rs1444603341 2533 dbSNP
rs1386381155 2546 dbSNP
rs1233411092 2566 dbSNP
rs1044594819 2569 dbSNP
rs768213052 2570 dbSNP
rs1216853629 2571 dbSNP
rs1448955204 2580 dbSNP
rs1024823094 2587 dbSNP
rs938808224 2596 dbSNP
rs971408461 2597 dbSNP
rs1056222489 2601 dbSNP
rs1359828340 2601 dbSNP
rs1212667270 2602 dbSNP
rs896258799 2609 dbSNP
rs1363295961 2611 dbSNP
rs1432541698 2611 dbSNP
rs780748035 2617 dbSNP
rs1424443145 2619 dbSNP
rs1273190961 2621 dbSNP
rs1439377381 2624 dbSNP
rs980532269 2627 dbSNP
rs1202117112 2630 dbSNP
rs927563612 2639 dbSNP
rs1418983998 2640 dbSNP
rs1251048186 2645 dbSNP
rs1476542553 2645 dbSNP
rs1485938277 2653 dbSNP
rs962987901 2659 dbSNP
rs1267067566 2672 dbSNP
rs1188826232 2674 dbSNP
rs1420096901 2693 dbSNP
rs974326462 2696 dbSNP
rs549042580 2697 dbSNP
rs1293600042 2702 dbSNP
rs1015291650 2705 dbSNP
rs189198365 2711 dbSNP
rs898149699 2711 dbSNP
rs930142322 2715 dbSNP
rs1215788828 2725 dbSNP
rs1343037414 2728 dbSNP
rs1282274141 2730 dbSNP
rs1405103449 2736 dbSNP
rs1346551247 2738 dbSNP
rs1420435888 2744 dbSNP
rs1460956767 2746 dbSNP
rs747667972 2747 dbSNP
rs1171677646 2750 dbSNP
rs1467277077 2757 dbSNP
rs1427209128 2758 dbSNP
rs1412046712 2764 dbSNP
rs1028205390 2768 dbSNP
rs953911777 2770 dbSNP
rs1175233130 2774 dbSNP
rs1050853753 2792 dbSNP
rs1167066682 2794 dbSNP
rs912325214 2795 dbSNP
rs1415926172 2800 dbSNP
rs942379080 2802 dbSNP
rs956344809 2804 dbSNP
rs1315293426 2810 dbSNP
rs1039810756 2811 dbSNP
rs1338200554 2814 dbSNP
rs903537490 2824 dbSNP
rs1223820760 2825 dbSNP
rs534896787 2826 dbSNP
rs1446604933 2838 dbSNP
rs1325209568 2842 dbSNP
rs988844905 2848 dbSNP
rs914590539 2851 dbSNP
rs1390053510 2852 dbSNP
rs1373005107 2858 dbSNP
rs1299249617 2860 dbSNP
rs138436350 2867 dbSNP
rs1052321036 2871 dbSNP
rs1404074554 2877 dbSNP
rs980323477 2880 dbSNP
rs1273641280 2887 dbSNP
rs892269968 2890 dbSNP
rs564836093 2900 dbSNP
rs181086499 2901 dbSNP
rs1250886548 2922 dbSNP
rs1255230717 2926 dbSNP
rs1459911970 2928 dbSNP
rs1242035732 2930 dbSNP
rs537697259 2937 dbSNP
rs1462231943 2945 dbSNP
rs971926035 2952 dbSNP
rs1001532790 2954 dbSNP
rs747340575 2955 dbSNP
rs962725365 2959 dbSNP
rs1186906725 2970 dbSNP
rs1381186806 2980 dbSNP
rs1336216628 2983 dbSNP
rs1453499671 2986 dbSNP
rs1242956415 2987 dbSNP
rs974295351 2988 dbSNP
rs1287335790 2989 dbSNP
rs773060553 2996 dbSNP
rs939793956 2998 dbSNP
rs1036752634 3013 dbSNP
rs1160205884 3022 dbSNP
rs1442762531 3023 dbSNP
rs1184090438 3026 dbSNP
rs1258987960 3026 dbSNP
rs1384560640 3026 dbSNP
rs898167606 3026 dbSNP
rs556208735 3028 dbSNP
rs1485988713 3030 dbSNP
rs1435658544 3031 dbSNP
rs951561995 3038 dbSNP
rs185882510 3040 dbSNP
rs541976664 3041 dbSNP
rs942411114 3045 dbSNP
rs1315003329 3058 dbSNP
rs555156133 3064 dbSNP
rs1413457448 3066 dbSNP
rs572248712 3077 dbSNP
rs1293501299 3092 dbSNP
rs1318368161 3092 dbSNP
rs1385923237 3094 dbSNP
rs1008130526 3098 dbSNP
rs1422550336 3100 dbSNP
rs1364658985 3111 dbSNP
rs1164150427 3124 dbSNP
rs1327896642 3132 dbSNP
rs1432423393 3135 dbSNP
rs1370910492 3139 dbSNP
rs924926767 3142 dbSNP
rs936352529 3147 dbSNP
rs955872561 3148 dbSNP
rs1264908695 3162 dbSNP
rs777118762 3175 dbSNP
rs1021622925 3180 dbSNP
rs1291420899 3193 dbSNP
rs968696342 3203 dbSNP
rs980104610 3205 dbSNP
rs1249744647 3213 dbSNP
rs1226819508 3214 dbSNP
rs1296344494 3217 dbSNP
rs1280345308 3218 dbSNP
rs1403275064 3220 dbSNP
rs1344707027 3236 dbSNP
rs927313376 3237 dbSNP
rs1371464128 3239 dbSNP
rs1236168569 3243 dbSNP
rs1407054412 3245 dbSNP
rs1417078304 3247 dbSNP
rs892405204 3249 dbSNP
rs142145588 3250 dbSNP
rs1344179828 3251 dbSNP
rs573438056 3255 dbSNP
rs759943941 3258 dbSNP
rs1479897126 3262 dbSNP
rs34704386 3262 dbSNP
rs372130919 3270 dbSNP
rs1466267794 3277 dbSNP
rs1453639555 3282 dbSNP
rs1249080835 3286 dbSNP
rs1002004456 3292 dbSNP
rs1186918610 3302 dbSNP
rs1034449461 3303 dbSNP
rs1318713877 3304 dbSNP
rs533067580 3306 dbSNP
rs1221986626 3320 dbSNP
rs1323053352 3323 dbSNP
rs995532693 3333 dbSNP
rs1195866498 3334 dbSNP
rs1333724076 3347 dbSNP
rs1313863263 3355 dbSNP
rs543280717 3358 dbSNP
rs1025900023 3361 dbSNP
rs1391836624 3364 dbSNP
rs919710408 3368 dbSNP
rs1376470917 3377 dbSNP
rs1173623373 3379 dbSNP
rs775675785 3396 dbSNP
rs1049886690 3402 dbSNP
rs987078695 3403 dbSNP
rs1479214167 3407 dbSNP
rs1362369019 3412 dbSNP
rs1020162513 3419 dbSNP
rs1386510424 3422 dbSNP
rs1458603627 3422 dbSNP
rs1008577981 3423 dbSNP
rs563368797 3425 dbSNP
rs1319507240 3430 dbSNP
rs1221088546 3455 dbSNP
rs191523533 3460 dbSNP
rs891624396 3463 dbSNP
rs1240864815 3468 dbSNP
rs1378980317 3475 dbSNP
rs1334173917 3488 dbSNP
rs1442885898 3489 dbSNP
rs1009988379 3490 dbSNP
rs1335800021 3491 dbSNP
rs1398584473 3493 dbSNP
rs1383342842 3494 dbSNP
rs1158324594 3501 dbSNP
rs1440903261 3502 dbSNP
rs1382723722 3505 dbSNP
rs879094814 3507 dbSNP
rs968811220 3507 dbSNP
rs1330509396 3510 dbSNP
rs1239698226 3516 dbSNP
rs1238066459 3522 dbSNP
rs925061297 3523 dbSNP
rs936321481 3527 dbSNP
rs987804808 3529 dbSNP
rs1283341359 3533 dbSNP
rs913811560 3534 dbSNP
rs949290800 3538 dbSNP
rs1034791398 3545 dbSNP
rs960039585 3546 dbSNP
rs1285445312 3547 dbSNP
rs1267799698 3549 dbSNP
rs1344217257 3556 dbSNP
rs1318517223 3557 dbSNP
rs1046311226 3565 dbSNP
rs1469049753 3570 dbSNP
rs542808693 3574 dbSNP
rs1162237677 3580 dbSNP
rs1424568996 3585 dbSNP
rs763152550 3588 dbSNP
rs1055871636 3606 dbSNP
rs1183638768 3607 dbSNP
rs898622187 3611 dbSNP
rs962280713 3613 dbSNP
rs995499980 3617 dbSNP
rs117865206 3631 dbSNP
rs887118292 3637 dbSNP
rs1008872411 3638 dbSNP
rs1019877320 3639 dbSNP
rs1221750621 3640 dbSNP
rs764358255 3653 dbSNP
rs931081425 3655 dbSNP
rs996993833 3664 dbSNP
rs1049463493 3665 dbSNP
rs1401400005 3667 dbSNP
rs1342838832 3668 dbSNP
rs1301669275 3675 dbSNP
rs1414781627 3676 dbSNP
rs1436438242 3678 dbSNP
rs1350949118 3690 dbSNP
rs1167463681 3691 dbSNP
rs181090330 3692 dbSNP
rs957815905 3695 dbSNP
rs987855623 3696 dbSNP
rs913517340 3698 dbSNP
rs1171734842 3702 dbSNP
rs757569115 3707 dbSNP
rs1041365493 3710 dbSNP
rs891746518 3713 dbSNP
rs1488658016 3715 dbSNP
rs766077791 3718 dbSNP
rs1248417328 3728 dbSNP
rs1202274436 3739 dbSNP
rs774493986 3745 dbSNP
rs1258128744 3757 dbSNP
rs1389759270 3765 dbSNP
rs1010105200 3767 dbSNP
rs1320928332 3768 dbSNP
rs982427251 3770 dbSNP
rs144212815 3771 dbSNP
rs199795324 3773 dbSNP
rs1386584634 3774 dbSNP
rs1042893256 3785 dbSNP
rs1440634245 3786 dbSNP
rs926585536 3786 dbSNP
rs1399739123 3790 dbSNP
rs937826461 3797 dbSNP
rs1332093229 3798 dbSNP
rs1467426854 3812 dbSNP
rs528536879 3813 dbSNP
rs1427488512 3816 dbSNP
rs1175579724 3820 dbSNP
rs904351436 3823 dbSNP
rs753716540 3826 dbSNP
rs879021815 3827 dbSNP
rs1175468674 3828 dbSNP
rs1480265276 3829 dbSNP
rs1037574117 3830 dbSNP
rs1287802543 3832 dbSNP
rs1459550837 3834 dbSNP
rs1262151471 3841 dbSNP
rs754881227 3848 dbSNP
rs1313215998 3851 dbSNP
rs1002038825 3872 dbSNP
rs1222607444 3873 dbSNP
rs931346416 3875 dbSNP
rs1376781428 3876 dbSNP
rs1310570076 3884 dbSNP
rs551689056 3886 dbSNP
rs1263834841 3898 dbSNP
rs895812497 3909 dbSNP
rs571833035 3914 dbSNP
rs1014291419 3921 dbSNP
rs1196697821 3927 dbSNP
rs1156630023 3929 dbSNP
rs1439056967 3941 dbSNP
rs1254653448 3942 dbSNP
rs1180386842 3944 dbSNP
rs1015338725 3945 dbSNP
rs962313008 3947 dbSNP
rs1200746553 3952 dbSNP
rs1484013304 3952 dbSNP
rs540849159 3953 dbSNP
rs1214117230 3958 dbSNP
rs1353389123 3960 dbSNP
rs1310638805 3962 dbSNP
rs1482358879 3980 dbSNP
rs1180902330 3985 dbSNP
rs537760766 3994 dbSNP
rs185919547 3995 dbSNP
rs1008256778 3999 dbSNP
rs3174021 4002 dbSNP
rs1287278765 4003 dbSNP
rs1162301827 4004 dbSNP
rs1041675017 4025 dbSNP
rs1462352047 4033 dbSNP
rs143114019 4034 dbSNP
rs374507966 4036 dbSNP
rs1032437549 4037 dbSNP
rs943775262 4038 dbSNP
rs1409118551 4048 dbSNP
rs976482596 4054 dbSNP
rs1488177027 4055 dbSNP
rs1313345449 4057 dbSNP
rs1356177709 4060 dbSNP
rs958200603 4064 dbSNP
rs1357882087 4065 dbSNP
rs945994337 4072 dbSNP
rs1245634198 4078 dbSNP
rs569704711 4085 dbSNP
rs1009246244 4087 dbSNP
rs1293703007 4090 dbSNP
rs1299779065 4090 dbSNP
rs1340970771 4090 dbSNP
rs58162056 4090 dbSNP
rs796796116 4090 dbSNP
rs878941554 4090 dbSNP
rs1020732939 4091 dbSNP
rs970783191 4092 dbSNP
rs981842791 4093 dbSNP
rs1458999266 4094 dbSNP
rs1370786268 4096 dbSNP
rs77068716 4103 dbSNP
rs780792133 4103 dbSNP
rs1047356 4104 dbSNP
rs62515078 4105 dbSNP
rs1277198483 4107 dbSNP
rs1340409109 4108 dbSNP
rs926527309 4109 dbSNP
rs1205081254 4110 dbSNP
rs1281624014 4112 dbSNP
rs1267303247 4113 dbSNP
rs1210886588 4114 dbSNP
rs1358575575 4121 dbSNP
rs1334643742 4131 dbSNP
rs1318847290 4142 dbSNP
rs1179589721 4144 dbSNP
rs1280288399 4146 dbSNP
rs757917045 4148 dbSNP
rs973318796 4158 dbSNP
rs1324143019 4159 dbSNP
rs1388434338 4160 dbSNP
rs1428739815 4161 dbSNP
rs904383928 4166 dbSNP
rs1330053081 4167 dbSNP
rs920403562 4171 dbSNP
rs1388100599 4174 dbSNP
rs16907781 4180 dbSNP
rs1173759781 4198 dbSNP
rs1477245162 4207 dbSNP
rs1047576580 4208 dbSNP
rs190336053 4209 dbSNP
rs76815089 4210 dbSNP
rs1236489162 4213 dbSNP
rs1198119821 4214 dbSNP
rs770673457 4217 dbSNP
rs1458242038 4218 dbSNP
rs1260241114 4219 dbSNP
rs1014963048 4226 dbSNP
rs1378794597 4227 dbSNP
rs1275217605 4234 dbSNP
rs760709650 4240 dbSNP
rs1333884411 4253 dbSNP
rs995106998 4254 dbSNP
rs1027871557 4264 dbSNP
rs1401753052 4265 dbSNP
rs1363505784 4273 dbSNP
rs1228068514 4274 dbSNP
rs1413541430 4293 dbSNP
rs1401995708 4300 dbSNP
rs1173504729 4303 dbSNP
rs1479182548 4314 dbSNP
rs1379036094 4317 dbSNP
rs541045057 4317 dbSNP
rs1440416904 4319 dbSNP
rs1281734223 4326 dbSNP
rs953536142 4326 dbSNP
rs899837509 4328 dbSNP
rs1314427759 4329 dbSNP
rs1207497326 4333 dbSNP
rs997013743 4338 dbSNP
rs541080707 4339 dbSNP
rs1210211231 4341 dbSNP
rs1240711534 4345 dbSNP
rs1378547025 4349 dbSNP
rs550655897 4370 dbSNP
rs1340721527 4371 dbSNP
rs35827527 4371 dbSNP
rs1335738497 4377 dbSNP
rs1416523077 4378 dbSNP
rs1009715903 4383 dbSNP
rs945691868 4384 dbSNP
rs764622780 4385 dbSNP
rs1420837949 4390 dbSNP
rs559352666 4392 dbSNP
rs746272612 4392 dbSNP
rs1472478809 4401 dbSNP
rs937253072 4409 dbSNP
rs1055656538 4410 dbSNP
rs895626371 4411 dbSNP
rs950178271 4431 dbSNP
rs1036425355 4432 dbSNP
rs897834350 4436 dbSNP
rs1227274894 4442 dbSNP
rs906319386 4444 dbSNP
rs1356356056 4445 dbSNP
rs1194006374 4446 dbSNP
rs577393651 4447 dbSNP
rs1397737471 4458 dbSNP
rs1338998900 4459 dbSNP
rs1297940312 4468 dbSNP
rs1401194698 4493 dbSNP
rs1200883512 4505 dbSNP
rs770381364 4508 dbSNP
rs1404840990 4521 dbSNP
rs1414553991 4522 dbSNP
rs868828715 4524 dbSNP
rs1476961024 4525 dbSNP
rs1431363722 4530 dbSNP
rs1049081392 4533 dbSNP
rs889412535 4551 dbSNP
rs1008206192 4555 dbSNP
rs1220666047 4560 dbSNP
rs1358658505 4565 dbSNP
rs543346106 4569 dbSNP
rs368216241 4571 dbSNP
rs1322836108 4588 dbSNP
rs1216458670 4589 dbSNP
rs1316901436 4611 dbSNP
rs1033311544 4612 dbSNP
rs568956357 4614 dbSNP
rs563231512 4615 dbSNP
rs1364439479 4621 dbSNP
rs1304624446 4625 dbSNP
rs1370428540 4627 dbSNP
rs763064376 4628 dbSNP
rs1217989359 4640 dbSNP
rs1350605810 4646 dbSNP
rs1019953003 4648 dbSNP
rs1464086410 4649 dbSNP
rs1423221707 4656 dbSNP
rs1171572170 4660 dbSNP
rs1478688396 4671 dbSNP
rs1027601153 4673 dbSNP
rs1422789715 4674 dbSNP
rs1190614534 4676 dbSNP
rs967024884 4677 dbSNP
rs978437970 4687 dbSNP
rs925604072 4688 dbSNP
rs371242822 4690 dbSNP
rs1456898551 4694 dbSNP
rs1301101921 4696 dbSNP
rs958679457 4697 dbSNP
rs1309691076 4700 dbSNP
rs1299639803 4702 dbSNP
rs529295168 4712 dbSNP
rs533186931 4717 dbSNP
rs1464135932 4727 dbSNP
rs1444664014 4735 dbSNP
rs1399569089 4745 dbSNP
rs949884748 4747 dbSNP
rs908611732 4752 dbSNP
rs944099818 4755 dbSNP
rs1036458556 4758 dbSNP
rs148252554 4763 dbSNP
rs1487345935 4765 dbSNP
rs1414777572 4775 dbSNP
rs919376948 4778 dbSNP
rs1190579603 4780 dbSNP
rs1438552169 4785 dbSNP
rs866428696 4791 dbSNP
rs1408562857 4794 dbSNP
rs1180196183 4797 dbSNP
rs774551621 4803 dbSNP
rs528591042 4808 dbSNP
rs930709947 4813 dbSNP
rs1472990083 4814 dbSNP
rs551821921 4820 dbSNP
rs551363688 4825 dbSNP
rs1313081063 4838 dbSNP
rs1410122062 4839 dbSNP
rs1283105686 4842 dbSNP
rs565508066 4846 dbSNP
rs1456905315 4860 dbSNP
rs1393410299 4861 dbSNP
rs1377278360 4868 dbSNP
rs1324378386 4871 dbSNP
rs757637863 4876 dbSNP
rs1351987213 4879 dbSNP
rs1007821629 4883 dbSNP
rs894102582 4886 dbSNP
rs1419016831 4892 dbSNP
rs1041003151 4893 dbSNP
rs902012588 4904 dbSNP
rs796501817 4912 dbSNP
rs1421490177 4919 dbSNP
rs945530816 4921 dbSNP
rs1293479800 4923 dbSNP
rs1255055365 4929 dbSNP
rs1182025923 4930 dbSNP
rs73257188 4931 dbSNP
rs141298784 4932 dbSNP
rs1215139855 4934 dbSNP
rs1285903929 4935 dbSNP
rs1328121770 4937 dbSNP
rs1003271304 4938 dbSNP
rs371686204 4941 dbSNP
rs1241319232 4942 dbSNP
rs759349565 4943 dbSNP
rs1233531480 4944 dbSNP
rs1291531871 4945 dbSNP
rs1312294217 4946 dbSNP
rs894800545 4951 dbSNP
rs1319728658 4956 dbSNP
rs1357203273 4960 dbSNP
rs1220534335 4961 dbSNP
rs893546792 4972 dbSNP
rs994528063 4977 dbSNP
rs1027570098 4982 dbSNP
rs1233430502 4989 dbSNP
rs1290493298 4993 dbSNP
rs1455947935 4996 dbSNP
rs1367366241 4997 dbSNP
rs1165125622 5001 dbSNP
rs1475968470 5007 dbSNP
rs1420542571 5020 dbSNP
rs1483995006 5029 dbSNP
rs950646059 5034 dbSNP
rs999889488 5038 dbSNP
rs1032694209 5040 dbSNP
rs958593451 5043 dbSNP
rs983779837 5049 dbSNP
rs765102856 5051 dbSNP
rs1337196749 5053 dbSNP
rs991425959 5056 dbSNP
rs917122653 5060 dbSNP
rs971298226 5067 dbSNP
rs1320278026 5070 dbSNP
rs966289759 5071 dbSNP
rs1472265357 5077 dbSNP
rs1293586021 5078 dbSNP
rs1462518527 5085 dbSNP
rs567957097 5090 dbSNP
rs183241258 5091 dbSNP
rs1169438278 5097 dbSNP
rs932653679 5108 dbSNP
rs1373980017 5120 dbSNP
rs752635528 5122 dbSNP
rs915252823 5123 dbSNP
rs754661620 5125 dbSNP
rs1266823885 5127 dbSNP
rs189246196 5129 dbSNP
rs930742381 5132 dbSNP
rs945609756 5134 dbSNP
rs1469847192 5137 dbSNP
rs1164477724 5138 dbSNP
rs1198236724 5143 dbSNP
rs565638152 5147 dbSNP
rs1271683138 5149 dbSNP
rs1371787256 5152 dbSNP
rs534442791 5154 dbSNP
rs1231045750 5155 dbSNP
rs1330477186 5157 dbSNP
rs150801349 5159 dbSNP
rs1049145035 5169 dbSNP
rs1373934747 5170 dbSNP
rs1330328655 5191 dbSNP
rs910570887 5199 dbSNP
rs780753785 5206 dbSNP
rs1349371619 5208 dbSNP
rs1173081726 5209 dbSNP
rs370648705 5210 dbSNP
rs879065844 5218 dbSNP
rs894934737 5230 dbSNP
rs994497114 5233 dbSNP
rs1194735139 5235 dbSNP
rs1042562461 5237 dbSNP
rs374684027 5237 dbSNP
rs191934757 5241 dbSNP
rs573607576 5244 dbSNP
rs1376483662 5246 dbSNP
rs886104777 5260 dbSNP
rs751126632 5261 dbSNP
rs1280977258 5262 dbSNP
rs142404153 5262 dbSNP
rs1019291810 5268 dbSNP
rs965890957 5269 dbSNP
rs1307855604 5274 dbSNP
rs756825455 5277 dbSNP
rs1482781379 5279 dbSNP
rs1331743363 5285 dbSNP
rs971324517 5286 dbSNP
rs1188302472 5304 dbSNP
rs971959211 5306 dbSNP
rs1174892607 5308 dbSNP
rs559509147 5309 dbSNP
rs573168480 5314 dbSNP
rs1028357837 5319 dbSNP
rs1181700585 5324 dbSNP
rs1470532272 5325 dbSNP
rs1234823969 5339 dbSNP
rs562354343 5344 dbSNP
rs568114397 5346 dbSNP
rs989528978 5352 dbSNP
rs1212983549 5353 dbSNP
rs984895104 5354 dbSNP
rs1167289938 5356 dbSNP
rs1223882081 5367 dbSNP
rs1352132243 5370 dbSNP
rs910591696 5372 dbSNP
rs755607146 5376 dbSNP
rs1355268573 5384 dbSNP
rs915219985 5386 dbSNP
rs967126762 5387 dbSNP
rs943459509 5398 dbSNP
rs976513003 5406 dbSNP
rs1338400469 5413 dbSNP
rs545206929 5423 dbSNP
rs923284142 5426 dbSNP
rs1297785406 5440 dbSNP
rs928230763 5440 dbSNP
rs144774848 5445 dbSNP
rs1042597050 5452 dbSNP
rs1418366446 5461 dbSNP
rs374571176 5462 dbSNP
rs145963433 5469 dbSNP
rs1262389991 5478 dbSNP
rs1055292519 5488 dbSNP
rs1055334496 5490 dbSNP
rs1345591004 5492 dbSNP
rs1201171938 5496 dbSNP
rs76969990 5500 dbSNP
rs1440714061 5502 dbSNP
rs1209723602 5504 dbSNP
rs1012648319 5508 dbSNP
rs139882859 5509 dbSNP
rs561429602 5514 dbSNP
rs1048858698 5522 dbSNP
rs530344572 5523 dbSNP
rs575735483 5525 dbSNP
rs1026195419 5526 dbSNP
rs770924012 5527 dbSNP
rs1040290869 5528 dbSNP
rs769258152 5530 dbSNP
rs1187078770 5531 dbSNP
rs1476339426 5531 dbSNP
rs1244862290 5535 dbSNP
rs1399445413 5564 dbSNP
rs1220229691 5565 dbSNP
rs1413364013 5567 dbSNP
rs996059464 5572 dbSNP
rs1320831495 5579 dbSNP
rs1316518879 5584 dbSNP
rs1272700525 5591 dbSNP
rs1028746945 5593 dbSNP
rs774122625 5594 dbSNP
rs965186195 5599 dbSNP
rs1440266535 5600 dbSNP
rs976165161 5609 dbSNP
rs957220618 5618 dbSNP
rs1331665053 5620 dbSNP
rs547245838 5623 dbSNP
rs1464258475 5626 dbSNP
rs182990845 5627 dbSNP
rs1170911531 5634 dbSNP
rs1411410957 5657 dbSNP
rs774265165 5659 dbSNP
rs1272933337 5667 dbSNP
rs978323394 5668 dbSNP
rs534599140 5675 dbSNP
rs1254332846 5677 dbSNP
rs1176434053 5682 dbSNP
rs551105005 5683 dbSNP
rs1222958448 5685 dbSNP
rs1457019485 5691 dbSNP
rs1233046426 5692 dbSNP
rs1269055052 5693 dbSNP
rs1205694775 5711 dbSNP
rs143283158 5717 dbSNP
rs978536636 5728 dbSNP
rs546407999 5729 dbSNP
rs761984678 5735 dbSNP
rs1305691632 5742 dbSNP
rs1348774162 5742 dbSNP
rs1444595559 5748 dbSNP
rs1201681241 5751 dbSNP
rs773060094 5757 dbSNP
rs772359350 5758 dbSNP
rs916739170 5760 dbSNP
rs1357202830 5761 dbSNP
rs948486617 5766 dbSNP
rs1435229249 5768 dbSNP
rs1396408910 5775 dbSNP
rs1462841377 5787 dbSNP
rs1156324299 5801 dbSNP
rs144322133 5803 dbSNP
rs573751538 5811 dbSNP
rs1178515007 5817 dbSNP
rs1481856924 5818 dbSNP
rs16907785 5823 dbSNP
rs553218611 5824 dbSNP
rs773438208 5832 dbSNP
rs148770505 5836 dbSNP
rs187529622 5837 dbSNP
rs930809575 5847 dbSNP
rs1283042931 5849 dbSNP
rs1048827882 5854 dbSNP
rs1388246902 5856 dbSNP
rs1321562790 5858 dbSNP
rs1330420033 5866 dbSNP
rs1225683284 5868 dbSNP
rs907638959 5882 dbSNP
rs1404484331 5883 dbSNP
rs565233229 5901 dbSNP
rs940362913 5902 dbSNP
rs964553830 5903 dbSNP
rs1331255022 5916 dbSNP
rs998013445 5932 dbSNP
rs1226807087 5938 dbSNP
rs1363859556 5942 dbSNP
rs1040412454 5945 dbSNP
rs1421656865 5951 dbSNP
rs966759189 5955 dbSNP
rs978104771 5959 dbSNP
rs1475702411 5961 dbSNP
rs925271328 5962 dbSNP
rs1215073032 5970 dbSNP
rs1211976758 5974 dbSNP
rs1265926516 5978 dbSNP
rs1218277376 5981 dbSNP
rs1320161879 5984 dbSNP
rs901513832 5985 dbSNP
rs575821595 5986 dbSNP
rs1276289745 5988 dbSNP
rs1385098951 5989 dbSNP
rs544685715 5995 dbSNP
rs149061702 5997 dbSNP
rs1050317459 5998 dbSNP
rs1165125815 6004 dbSNP
rs1475773815 6007 dbSNP
rs1471286081 6015 dbSNP
rs1158004305 6033 dbSNP
rs1191722659 6045 dbSNP
rs892959504 6058 dbSNP
rs1262978193 6066 dbSNP
rs1011388815 6067 dbSNP
rs1022376943 6072 dbSNP
rs1368663002 6079 dbSNP
rs272615 6086 dbSNP
rs1161239805 6091 dbSNP
rs142435429 6092 dbSNP
rs928402922 6093 dbSNP
rs1035392836 6100 dbSNP
rs191856330 6107 dbSNP
rs1336758919 6109 dbSNP
rs929037332 6109 dbSNP
rs1430350423 6110 dbSNP
rs1309705858 6125 dbSNP
rs764128124 6134 dbSNP
rs1226664747 6137 dbSNP
rs1326987545 6145 dbSNP
rs991039999 6151 dbSNP
rs1297552664 6168 dbSNP
rs560834595 6171 dbSNP
rs952171633 6180 dbSNP
rs1408018727 6187 dbSNP
rs151336422 6195 dbSNP
rs760759668 6210 dbSNP
rs139867198 6217 dbSNP
rs570875829 6222 dbSNP
rs1166543237 6232 dbSNP
rs1264033085 6234 dbSNP
rs1374143249 6235 dbSNP
rs1173089361 6240 dbSNP
rs940398144 6265 dbSNP
rs184035430 6266 dbSNP
rs1359096111 6276 dbSNP
rs1194546842 6278 dbSNP
rs1248629107 6288 dbSNP
rs900342062 6288 dbSNP
rs1195016080 6289 dbSNP
rs1206503610 6290 dbSNP
rs1277344673 6295 dbSNP
rs1339763038 6296 dbSNP
rs1253068624 6304 dbSNP
rs922901521 6310 dbSNP
rs1481815371 6312 dbSNP
rs1442410749 6319 dbSNP
rs931679352 6319 dbSNP
rs1374231727 6325 dbSNP
rs187549807 6326 dbSNP
rs6998725 6331 dbSNP
rs1256504291 6332 dbSNP
rs1170213545 6334 dbSNP
rs756811932 6337 dbSNP
rs1394605473 6338 dbSNP
rs1425174805 6349 dbSNP
rs1201960218 6357 dbSNP
rs1032316325 6358 dbSNP
rs536439015 6359 dbSNP
rs991480641 6362 dbSNP
rs916804035 6364 dbSNP
rs893095754 6367 dbSNP
rs1427947625 6369 dbSNP
rs1208704474 6383 dbSNP
rs1485319202 6384 dbSNP
rs1280901675 6389 dbSNP
rs1347854147 6390 dbSNP
rs971378048 6390 dbSNP
rs545452683 6392 dbSNP
rs750098989 6393 dbSNP
rs1331268129 6397 dbSNP
rs918740823 6403 dbSNP
rs1041906889 6405 dbSNP
rs929053660 6406 dbSNP
rs903018200 6409 dbSNP
rs1382873165 6410 dbSNP
rs879886440 6410 dbSNP
rs1158250080 6418 dbSNP
rs999994741 6420 dbSNP
rs1035121144 6428 dbSNP
rs908871862 6432 dbSNP
rs1474722404 6434 dbSNP
rs1310762187 6437 dbSNP
rs1258158746 6447 dbSNP
rs941669822 6451 dbSNP
rs896473482 6455 dbSNP
rs1229533923 6456 dbSNP
rs900454048 6463 dbSNP
rs933219238 6466 dbSNP
rs1012274804 6471 dbSNP
rs1023889057 6472 dbSNP
rs1203280400 6477 dbSNP
rs1355208840 6482 dbSNP
rs1256091726 6489 dbSNP
rs563854327 6491 dbSNP
rs553040062 6492 dbSNP
rs985064583 6494 dbSNP
rs540938698 6496 dbSNP
rs1015484642 6497 dbSNP
rs1401313228 6498 dbSNP
rs962251648 6527 dbSNP
rs1387416843 6529 dbSNP
rs976224556 6530 dbSNP
rs566762020 6532 dbSNP
rs902329584 6532 dbSNP
rs999585531 6532 dbSNP
rs1418304764 6533 dbSNP
rs56012037 6542 dbSNP
rs184533797 6547 dbSNP
rs1051919 6548 dbSNP
rs914245815 6551 dbSNP
rs1012284161 6554 dbSNP
rs528945144 6558 dbSNP
rs1024054793 6561 dbSNP
rs1448154944 6563 dbSNP
rs1270945415 6567 dbSNP
rs1190232731 6569 dbSNP
rs947265838 6571 dbSNP
rs190807682 6575 dbSNP
rs1274171687 6578 dbSNP
rs971027853 6580 dbSNP
rs982347789 6592 dbSNP
rs181997569 6593 dbSNP
rs1367430310 6595 dbSNP
rs951486666 6603 dbSNP
rs1395012096 6604 dbSNP
rs1166858832 6608 dbSNP
rs924411855 6610 dbSNP
rs145372670 6611 dbSNP
rs1418716888 6614 dbSNP
rs1168412903 6618 dbSNP
rs1479550773 6628 dbSNP
rs1467613005 6643 dbSNP
rs1056931702 6644 dbSNP
rs983206640 6649 dbSNP
rs1197277589 6650 dbSNP
rs147671836 6655 dbSNP
rs1436366215 6657 dbSNP
rs1051920 6658 dbSNP
rs1306064993 6659 dbSNP
rs1215666791 6661 dbSNP
rs562629015 6668 dbSNP
rs1301315498 6669 dbSNP
rs974457547 6669 dbSNP
rs1233599730 6675 dbSNP
rs1045049563 6676 dbSNP
rs1372041212 6679 dbSNP
rs1295439818 6687 dbSNP
rs1363399668 6688 dbSNP
rs1353703678 6695 dbSNP
rs1214505816 6701 dbSNP