miRTarBase - #MIRT547305 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NUCKS1   
Synonyms JC7, NUCKS
Description nuclear casein kinase and cyclin dependent kinase substrate 1
Transcript NM_022731   
Expression
Putative miRNA Targets on NUCKS1
3'UTR of NUCKS1
(miRNA target sites are highlighted)
>NUCKS1|NM_022731|3'UTR
   1 AAGTGATGATGGTCTGGGGAGAGATTTTATTAAAAAAAAAAAGAAAAAAAAAGAAAAAAGAGGGAGGAAAAAAAAGAACC
  81 TACTTAAGATAGAACATGGTTTTGGCTATGGCTTGACTCATGGGCTTTCAGTGCTTTTTTCCATTTGTTGAAAGTAACAT
 161 TTCTCTCTCTCTCTCTTTTTTTTTTTTTTTTTTTAAAGCAAACCATTGTATGTGTAAGTGTTTAAGTTACCTTTTTGTCT
 241 ATTGGTCTCTTTGCCAGCCCTCCCCTTTCCCAATGAAAGCCATGTCAAATTAATCACTGGATTGACTGCTTCATCTTTTT
 321 ATTTTTAATGAAAGGTGTACCACGGTTGTAAAGCAATAAGATTTGAGATGAACACTATTGAAACTTCGCTTTTTGCTAAA
 401 AAATAGCAAGTTGAATAGTAATCAAAAAACATAGAAAGATTTTAGTTCAAAATGATTGCTCCTTTCTCTACCTGGACTTT
 481 TAAAAAATCAATTGTCATCTAATATGAGTTTATTTGTCTATAGACACAAGTATCAATGTCTAAAAAAAATCATGACTTTA
 561 AACTTCCACCGATGAGGCAGGTAGGAGATAAAGATGAATTCTGAACTGTTACTAAAAGTACTCATTTTTTACCTTGTAGG
 641 GAGGGTGGGCAATGGGGTTACCTGACCTTATTTGAGGGTATGGGCTTTCTTTTTTATTTCATCACTTGTTATCTCAAAGA
 721 GACTCGGAGCCAGTGATCCTTTTATCCTGCTACAGTCTTTAGGGAGCTAAAAAAAAAAAAAAAGCAGGGGCTGCCAAAAC
 801 TCTTGATTTCATATTTCCTTCTCTAAATATATATGTATCCTGTTTTTTGGATAAAATTTTACCAAGAATCCAAAAAAAAA
 881 AAAACCCTAGAATTTAATCAACAAGATCAGTCTACAGGTCACAGTGGATTTCTTTTCAAACTGACAATGTTTAGGTTTTA
 961 AGCAAATAAAGTTCCAGTTAATGTGAAACTCAGTCACAAAGAGTTGAGATTTTTCCTTTATGAAATAGAATTGACATTCT
1041 TTTATGCTATAAATGTGCATTCAGGTCCCATTAACCATGCTCTGCTTTTATTTGGGGATAGAACATTTTCTTTTTCATAT
1121 CCCGATCTTCCCATTTCTTCATAGAAATGTGATAAGAAGTACATCCCTGTGATCCTGCTGCTTCGTAGAGCACCACTGCA
1201 CACCCTACCCCGAGTGCCAACCACCTCTGCTATAGGACACTATTTTCCTGGCCCTATTCTTCACTTACTTCCCATCCTGT
1281 CCTTGACTAGGAATATGTTAAATGCTGCTCCCATACAATTCAGTTAGCTCTTGTCTTTTTATTTGGTCCAACCCCTGCTT
1361 TACTGCTCATGCTGCTTAAAGCAGGAGGGACTAGAGAAACAAGGCATTTTAGGAGGCCTGTGTGCAGTTGAAAACCGACT
1441 TTTACACGCCTTATAAAAGCAGTCAGGAGATAGATCCGTAGGTTTGATCCTTCACATCTAATACCAGGCGCTAATGGGAA
1521 CAAGGTTTAAAGGGTCCTGGTATGCTAATAAATTGAAAAATTAGTGAAATTTAAACTTCTGCCTTTTTTTCCTGCCTTTT
1601 AATCTAGATTTGCTTCCTCAATATCCTACTTTGTGGTTTACTAGGAACATGCTTACTCTGATCTTTTTTTAAAAAACACA
1681 CAGTGGCAGAGTCATTTCACTATTGCACTGTGTGTTAAAGAATGAATAAGGAGTTTTCAGTTACATGGCCAAAAATACAG
1761 GACTTGAACATAAATAGCAGTTGGATCATTCTCTTTCATGACGGTTAAATTCAGAGGTGTGAACTTTGTAATGAGGGTGT
1841 TAAAGATTAATCTATTTGCCTAAATGGGTTTGTTCAGGTATCCATTTTTAACAAAGAAGTTTGTGTTCATATAGTAAAAG
1921 ACCTATCAGTGTTTCCACCATGCACTTCTATTTTTTAGGAGTTTATAATTTTAAGTCTTACATTCCTAGTAACATTTGGG
2001 CTTTTCTTAGGTTATGTTTCGTGAAGATTTGGGGGGAGGGCTCTTTTAAAACTTCAGCCTCAGTTGTTTAACAGTCTCTT
2081 TAATATATTAATCTGCACTAACATCTCTGTGATATATGCACATATTTTAGAGGTAATCATGTCTTCTAGATTACTTGTGT
2161 GCATTTGATTGGGCTTCTTGTTTAGGGTCCCTTTTAAAATTAATTCATTAGATTGAAAAATGTATTCTATATTTCTGATA
2241 GACTGGACAGAAGGATCTGTGTCCCCAAGTGAGACAGGCTCTGAATAACCTTTGTTTTCTCCACTTTTTATTGATGATTT
2321 AAAACACTCTAGTCTTCCCCTCAAATCATGCATGCAAATAGGAGGACAGTGGTGGTGACTCAACTGGATACAGGTGCTCA
2401 ATAGTCAGGCTTGATAGTGATGTCAGGACGCATTACAAGCTGTAAGCCGATACTGACTGGCCATTGGCACCATCCTTGAC
2481 TAACCTTCCTCTTTTTCTCTAGTGTGCCTATGGTGAAATGGCAATAGCATTCACTGTCGTATTTTGCAGTGCTCAGGAAG
2561 TGGGACGTTAACTTTGAAGGTGCTTGTTTGTATTAGCTCTGCTAGGTTTACCTCTACAACGTAGATTTCAGCAGCTATGC
2641 TGACTGACACTACATTCTAGTTCTTAAGATTTTTTTTCCAGATCCCCCCTTCCCCAGCTAGACATACGTAGCATACTTTC
2721 ATCTTATTCAGTCTTTCTGTAACCTGCTGCTGCTTTTAGTCCTCCTCACCTCAGATCGGAATCAATGGAGTGGGCCCAGA
2801 GGATACATTTTAATTCCAGTAATGGTAGGTAGATTTGTCCTGCTTTCTAAAACATCTCCTCATTTCATATTTCCACTCCA
2881 TATTGATTCCATAAGGGAAAATTAATGGGTGTTTCCTCCTTTAGGGAGGTAATGCAAAGAGTGTGGACATCTTCTAATCT
2961 TGAGGAACAGTAGTTGATTTCCCTTGAAGGAGCTTACATATTGACTGTTTTCACAATAACCTGTTTGCCCCAGTTCAATC
3041 CTCATTTTAATACTTAATTTGGTACTGGCTCAAATAGCATTTTCTTACAGATAACAAATCAAGAGTGAAATTTGAGGTTA
3121 TACTCCAGTAAAGTTTTTAACACTTGTGAATATGGTCAGCTAGACTAAACTTGACTCTTTTTTTTAATGGCTTTTTTATC
3201 TGTGAACATTCAGATAAGTGGATTTTCAAGTACTGGTTGGGGATGGGAATCGTGCTTTTCTTTAAACTTCAGTTTACGAG
3281 ATGCTTTGAGAGCGTTAGGCAAAAGCAGAAATAAATATCAGGAGCAACGGGGAAAGCTTTATAAAAGATCATGGTGGCCA
3361 CTGTTGCAGCTTTGAAGAATGAGTGCTGGCTTGAACAGTTCTTTGCCTGCATCATTGGTAGCTGCACTGAAAGGAAAAAA
3441 CTTTCACCTTAAGAATTTGAAAAGGAAGAAACCTGGGCTCTGGTCTTCATGGCATTTAGACTGAGATGCTTAAACAGAAC
3521 AGAAGTAATACGCATTTCCTGCCATAGGATAGGGAAAATGTAACAAGCTGGTTGCTCTTGAGGTTAGAAAATTGTCTGTT
3601 TCTCTGTGGATGAAGCTGGATTTACTTGAAAATGGAGAGTTGGCTTATTGTTTGAATATTGGGACATCAAGCTATCTATA
3681 GCCAAGTTTCAGTCGCAACCAGTTTTCCCTTTGTCTGGGGTAAATTCGATACAAAATGATTCTTTTTGAATCCTGAATCC
3761 ATAAATTACACTTTTTTTTTTCAAATTCACAAAATTCACAGTGGTGCTGACTGTGTAATAACCACTATTGGGAAACATCC
3841 CGTAAACCTGCCTGTTGCCATGCCAATGGAGTGACTGAACTGGTGACATCTGTTTGAGCATGCTTTGTGTGGCTGGTAGA
3921 ATGCCACCGTTGTGCATACACTTTGTACATCAGGGGTGAAGGGAGGGTTTTCTAGATTATTGGGGGAGGGTAAAATTGGG
4001 ATTTTTTTGTTGTTCCTTTTTTGATGGGGTGTGGGGGTATAGTACTCAGCTTATGCCCTAAAATAACATGTATAAAAACC
4081 CCTGAAGTATTGTGTGGGTGTGTACGTGTGAGTGTGTGTTTGTATACATCTGGCAATTAAAGCTTTGTCTTCTGGAACTT
4161 AGTGAATTCTTTTCTCTTTTTCCTCCAGAAGTATTTGTTACAAGATTTGTAAATAAGAGCTCTACTTAGTTTGTTTACCA
4241 TGAACATGTTGCAGCAAACCTTATGCATCTAATTCCTACAAGGTTAAAGAAAGGCTTTTAGACTTGCCAGGTTAAGCAAC
4321 AGCCAAGTTCTCAGTAATTGTTTGCCTTGATTTATCTTTTAGACTTCATTTTGCCAGCTCTAAAACTCCCAGTCTTCCTT
4401 GATTTTAGTCCTTAATCTTTTATGTTCTGAGCAGGAAGGGTAAAAGACAGGAACCTGCTTCACTGTATTAACTAGTCCAT
4481 GGGCTGAGACCGGGGCATCTCTTTTCTTCATACTGCAATGTTGCTAGATACATGATCAGACACCAGAGGGTTGGGCATTC
4561 TTGCAATACCTTAACAGTGCTGAAATCTGCAGCATGGTACTAAGGAAGTTAAAGTTTGAATGTAACCACTTTATTTAAAA
4641 GGTTTTTTTCTTTAATTTAAATGAAATGGGGTTGAAGTGAACATGATTTTGTTGACCATGTTCGTGAATTACAGATGCAA
4721 CATGCATTGGTAGAATCGTGTGATGGTCTTTTGTGATACTTAATTTTTACATATCCCAGTCTCTGTATGTATCTGCATAG
4801 ACAAAGAAAAAACAAACTCCTGCTTTGCTTTTATTGAAGGGTTTCCAGGACTGCGTGTCTGCTCCTGAGCTCTGTTTTAA
4881 GTATGTGTATCCTTTGCTTGTATTTTGTATTAAAAAAATAAGAAAAAGAAGCCTTTATTGTTGAGCATGTTGGCATTGTC
4961 CCCTTTATTTTTTTCTCTTTTTGGGACATATGAAGCAAGTTATTCTTTTTCTGTATCTTTTTTTCTTTTGTAAACTTTTT
5041 TTTTGTTTTGTTTAAAAATGGCTTTATAAAAGGGCTTTTATAACCCAGATGTGTGCTCTGTGTACTTCTTGTAATACCTT
5121 AAAGCAAACACACTAACTTACACAGCTTTGTTAATCAGCTCCCAGTTCAGCCTGACTTTGTGGGAACTTATTTCCCTAAT
5201 AAATTATTTAGAAACTTTAACAGTGACCATCCCTGTTGTTGGTAAAAGATAAACATGTCTTGGTTCAAAAGTTAATACCT
5281 CAGGATGGAATCAAGAAGCAGTAGACTTACCAGTTTGATTAATTAAGGGAGCACTGGACTGGGTGCGTAAGGATTCTTAA
5361 TTAGCATTTTTTCTCATGTTTACATCCAAGGTTATGAAGTGTTGTGGAAAGCAAAGTTTAACAATCATATATAATAAAAG
5441 ATAATGTTTATACTCACAGAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||  ::|||  ||||||| 
Target 5' aggAATATGTTAAATGCTGCTc 3'
1289 - 1310 155.00 -8.80
2
miRNA  3' guGUUUGGUAAUAC----ACGACGAu 5'
            :| |:|  |:||    ||||||| 
Target 5' agTACATCCCTGTGATCCTGCTGCTt 3'
1158 - 1183 150.00 -13.90
3
miRNA  3' guguUUGGUAAUAC-----ACGACGAu 5'
              |::| || ||     ||||||| 
Target 5' attcAGTCTTTCTGTAACCTGCTGCTg 3'
2726 - 2752 150.00 -13.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30109552 16 COSMIC
COSN18724988 32 COSMIC
COSN30143924 32 COSMIC
COSN20095871 34 COSMIC
COSN30665386 42 COSMIC
COSN26987182 43 COSMIC
COSN28836121 44 COSMIC
COSN31507662 67 COSMIC
COSN30126553 68 COSMIC
COSN32062347 175 COSMIC
COSN28822116 177 COSMIC
COSN26575205 195 COSMIC
COSN31584678 244 COSMIC
COSN31489859 286 COSMIC
COSN27331871 768 COSMIC
COSN27409896 769 COSMIC
COSN28861527 842 COSMIC
COSN28856537 866 COSMIC
COSN20095869 871 COSMIC
COSN1096627 872 COSMIC
COSN8429777 947 COSMIC
COSN28592623 964 COSMIC
COSN28592709 966 COSMIC
COSN31785727 979 COSMIC
COSN27356455 1116 COSMIC
COSN16712869 1122 COSMIC
COSN20073561 1205 COSMIC
COSN2526014 1241 COSMIC
COSN9057400 1330 COSMIC
COSN19210934 1475 COSMIC
COSN31663209 1755 COSMIC
COSN8429776 1833 COSMIC
COSN1427650 2114 COSMIC
COSN18963943 2181 COSMIC
COSN7199307 2283 COSMIC
COSN26164272 2717 COSMIC
COSN26268407 3012 COSMIC
COSN25630954 3038 COSMIC
COSN15865604 3484 COSMIC
COSN31778090 3531 COSMIC
COSM9421608 3760 COSMIC
COSM6859895 3771 COSMIC
COSM6859684 3772 COSMIC
COSN142813 3789 COSMIC
COSM5784631 3808 COSMIC
COSM5788859 3927 COSMIC
COSN5736798 3946 COSMIC
COSN25935518 4044 COSMIC
COSN21071550 4379 COSMIC
COSN7199306 4438 COSMIC
COSN32065317 4730 COSMIC
COSN21481671 4975 COSMIC
COSN26314150 5112 COSMIC
COSN27598230 5113 COSMIC
COSN25168495 5371 COSMIC
rs34305872 884 GWAS
rs386369425 884 GWAS
rs10900522 3341 GWAS
rs3805 4053 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs910922290 2 dbSNP
rs778672041 4 dbSNP
rs200431602 8 dbSNP
rs1293022409 9 dbSNP
rs372252283 11 dbSNP
rs756681882 12 dbSNP
rs1300579964 18 dbSNP
rs751021729 19 dbSNP
rs781384648 23 dbSNP
rs1376678343 29 dbSNP
rs1174578686 30 dbSNP
rs1479223837 31 dbSNP
rs80115536 32 dbSNP
rs751691818 37 dbSNP
rs926300877 38 dbSNP
rs979103535 42 dbSNP
rs372638732 43 dbSNP
rs758227848 43 dbSNP
rs766184224 43 dbSNP
rs766954183 43 dbSNP
rs1185914744 44 dbSNP
rs764397737 44 dbSNP
rs547268839 46 dbSNP
rs752780508 51 dbSNP
rs1457095506 52 dbSNP
rs1207522936 53 dbSNP
rs1217800820 53 dbSNP
rs1258577970 53 dbSNP
rs1315906043 53 dbSNP
rs1459061667 53 dbSNP
rs869070095 53 dbSNP
rs1200633254 60 dbSNP
rs71709139 60 dbSNP
rs772688268 60 dbSNP
rs776851995 60 dbSNP
rs967770307 60 dbSNP
rs1370985075 63 dbSNP
rs1477669210 63 dbSNP
rs1171862472 65 dbSNP
rs527616532 66 dbSNP
rs564505381 67 dbSNP
rs1020684176 68 dbSNP
rs1292994588 68 dbSNP
rs1244245706 69 dbSNP
rs987979507 76 dbSNP
rs1340147386 79 dbSNP
rs918731146 79 dbSNP
rs955398287 83 dbSNP
rs1178529208 85 dbSNP
rs1029558463 86 dbSNP
rs1242587503 95 dbSNP
rs368821161 104 dbSNP
rs1264342677 115 dbSNP
rs568198338 119 dbSNP
rs910896443 139 dbSNP
rs1456860470 141 dbSNP
rs181170367 145 dbSNP
rs576043639 151 dbSNP
rs1260533687 159 dbSNP
rs900469791 161 dbSNP
rs866111298 173 dbSNP
rs75472296 175 dbSNP
rs1224556983 176 dbSNP
rs1369554249 176 dbSNP
rs1474506321 176 dbSNP
rs71692915 176 dbSNP
rs1006263492 177 dbSNP
rs1156928392 177 dbSNP
rs1459463476 177 dbSNP
rs1491058244 177 dbSNP
rs74143844 177 dbSNP
rs887841960 178 dbSNP
rs1311842540 179 dbSNP
rs1341021479 179 dbSNP
rs1355825245 180 dbSNP
rs1048304781 181 dbSNP
rs1263913525 181 dbSNP
rs1247848209 188 dbSNP
rs1359849436 189 dbSNP
rs1216963735 190 dbSNP
rs1308325174 193 dbSNP
rs1444462023 194 dbSNP
rs1181661871 195 dbSNP
rs1257431415 195 dbSNP
rs1288599329 195 dbSNP
rs1426115752 195 dbSNP
rs1461788349 195 dbSNP
rs1482443368 195 dbSNP
rs377270480 195 dbSNP
rs78311899 195 dbSNP
rs879112726 195 dbSNP
rs1402789219 198 dbSNP
rs929460810 199 dbSNP
rs542750308 200 dbSNP
rs1375604602 202 dbSNP
rs1240247519 210 dbSNP
rs1310922561 216 dbSNP
rs1328871610 220 dbSNP
rs1310106468 223 dbSNP
rs1385750910 224 dbSNP
rs1056686379 225 dbSNP
rs574282931 231 dbSNP
rs1257004023 233 dbSNP
rs980414033 236 dbSNP
rs1197374426 238 dbSNP
rs938259973 239 dbSNP
rs970461679 241 dbSNP
rs1024262670 243 dbSNP
rs190293774 245 dbSNP
rs1432864737 265 dbSNP
rs1175068084 268 dbSNP
rs561814167 273 dbSNP
rs1359589009 278 dbSNP
rs926920271 282 dbSNP
rs1329143202 286 dbSNP
rs1399474838 297 dbSNP
rs146090781 309 dbSNP
rs781213212 313 dbSNP
rs1332837817 343 dbSNP
rs1014259395 344 dbSNP
rs756139640 348 dbSNP
rs1302403603 349 dbSNP
rs1424941010 356 dbSNP
rs1217194133 375 dbSNP
rs946414622 376 dbSNP
rs1458633769 378 dbSNP
rs141913446 380 dbSNP
rs1030767572 384 dbSNP
rs1192064089 387 dbSNP
rs988315157 388 dbSNP
rs955194508 389 dbSNP
rs34468640 395 dbSNP
rs1168300132 404 dbSNP
rs1422792859 410 dbSNP
rs999746253 416 dbSNP
rs1466120337 418 dbSNP
rs1029917244 429 dbSNP
rs1347676731 430 dbSNP
rs903711864 445 dbSNP
rs1469047885 448 dbSNP
rs1044024952 450 dbSNP
rs1293692174 454 dbSNP
rs543098606 456 dbSNP
rs1369307334 457 dbSNP
rs975306696 458 dbSNP
rs985741151 461 dbSNP
rs1278011647 465 dbSNP
rs1451130673 466 dbSNP
rs1319188489 468 dbSNP
rs1016881733 469 dbSNP
rs374167912 475 dbSNP
rs1248622489 481 dbSNP
rs879500803 491 dbSNP
rs1191208378 495 dbSNP
rs918323391 501 dbSNP
rs547007000 503 dbSNP
rs1006211075 505 dbSNP
rs1490592065 516 dbSNP
rs1285041729 520 dbSNP
rs1411550704 522 dbSNP
rs1237696934 526 dbSNP
rs1164898037 530 dbSNP
rs1036812260 531 dbSNP
rs1417538246 532 dbSNP
rs941518223 534 dbSNP
rs910090178 540 dbSNP
rs770148444 550 dbSNP
rs1433332793 555 dbSNP
rs980723427 559 dbSNP
rs970343209 567 dbSNP
rs1304479459 571 dbSNP
rs1405163394 572 dbSNP
rs1292178151 578 dbSNP
rs917219017 579 dbSNP
rs1216246184 585 dbSNP
rs992805513 593 dbSNP
rs1287013440 594 dbSNP
rs1488459766 612 dbSNP
rs1195083268 636 dbSNP
rs575036456 640 dbSNP
rs1031702781 643 dbSNP
rs1410737270 649 dbSNP
rs747164939 652 dbSNP
rs148660292 657 dbSNP
rs778681707 664 dbSNP
rs938207704 672 dbSNP
rs1360783395 682 dbSNP
rs1402755599 684 dbSNP
rs1478016365 688 dbSNP
rs202133516 689 dbSNP
rs1359064614 693 dbSNP
rs1022129709 700 dbSNP
rs1007192903 718 dbSNP
rs1374672075 720 dbSNP
rs946362374 721 dbSNP
rs753557079 722 dbSNP
rs1262763157 725 dbSNP
rs569274061 726 dbSNP
rs987873275 737 dbSNP
rs1213331428 743 dbSNP
rs889727250 745 dbSNP
rs1210818596 755 dbSNP
rs1284738245 762 dbSNP
rs1199781599 764 dbSNP
rs1321397052 767 dbSNP
rs1284638163 768 dbSNP
rs1380488435 769 dbSNP
rs1470981679 769 dbSNP
rs1171170722 784 dbSNP
rs1339200732 784 dbSNP
rs1424989708 784 dbSNP
rs752476044 784 dbSNP
rs796993307 784 dbSNP
rs1231418121 811 dbSNP
rs1272859382 827 dbSNP
rs1223596016 830 dbSNP
rs1298518008 831 dbSNP
rs185483323 833 dbSNP
rs1264874655 838 dbSNP
rs776706096 840 dbSNP
rs1456412411 843 dbSNP
rs1197423940 849 dbSNP
rs1275936662 849 dbSNP
rs1429010834 857 dbSNP
rs1347297694 862 dbSNP
rs1319461898 863 dbSNP
rs1021384471 866 dbSNP
rs1245783481 868 dbSNP
rs1404545867 870 dbSNP
rs1471088535 871 dbSNP
rs1179068427 883 dbSNP
rs922415038 884 dbSNP
rs1465602534 885 dbSNP
rs201808052 885 dbSNP
rs34305872 885 dbSNP
rs386369425 885 dbSNP
rs975225112 887 dbSNP
rs963899136 903 dbSNP
rs1423138918 905 dbSNP
rs1315963267 906 dbSNP
rs780004757 910 dbSNP
rs997839062 912 dbSNP
rs909770522 914 dbSNP
rs1184972907 918 dbSNP
rs1288647404 923 dbSNP
rs1476538516 926 dbSNP
rs1490421875 941 dbSNP
rs1242469818 945 dbSNP
rs896859769 947 dbSNP
rs535971636 951 dbSNP
rs755760278 955 dbSNP
rs1264940916 959 dbSNP
rs1203691095 960 dbSNP
rs1198773647 963 dbSNP
rs941122672 964 dbSNP
rs750131632 974 dbSNP
rs567110058 978 dbSNP
rs1215949227 999 dbSNP
rs767084373 1012 dbSNP
rs370223775 1020 dbSNP
rs1162771680 1025 dbSNP
rs993554526 1029 dbSNP
rs1044582393 1039 dbSNP
rs771094229 1044 dbSNP
rs1271070232 1046 dbSNP
rs1426848156 1049 dbSNP
rs1447782812 1052 dbSNP
rs1304719334 1053 dbSNP
rs1381167073 1057 dbSNP
rs1035140458 1063 dbSNP
rs554941743 1066 dbSNP
rs1002300232 1069 dbSNP
rs547206389 1070 dbSNP
rs905389256 1075 dbSNP
rs527554678 1076 dbSNP
rs1470614500 1078 dbSNP
rs1043918162 1082 dbSNP
rs993067257 1092 dbSNP
rs571212490 1104 dbSNP
rs534671294 1117 dbSNP
rs892751435 1121 dbSNP
rs551319176 1123 dbSNP
rs557724040 1124 dbSNP
rs77992859 1125 dbSNP
rs979213855 1127 dbSNP
rs933694993 1131 dbSNP
rs968846514 1132 dbSNP
rs1411860866 1140 dbSNP
rs149515685 1143 dbSNP
rs542339789 1146 dbSNP
rs1157019218 1151 dbSNP
rs953890385 1152 dbSNP
rs1418820654 1154 dbSNP
rs1289268713 1156 dbSNP
rs1387013355 1176 dbSNP
rs375245253 1178 dbSNP
rs909718378 1182 dbSNP
rs74143155 1183 dbSNP
rs1184096943 1184 dbSNP
rs896785979 1185 dbSNP
rs1230675805 1189 dbSNP
rs1015268142 1192 dbSNP
rs1005685124 1200 dbSNP
rs1288733933 1202 dbSNP
rs763529248 1203 dbSNP
rs1262917886 1204 dbSNP
rs1357708422 1211 dbSNP
rs560638038 1212 dbSNP
rs540830520 1214 dbSNP
rs888221201 1225 dbSNP
rs1462669905 1239 dbSNP
rs1044560699 1242 dbSNP
rs201680861 1242 dbSNP
rs11541417 1244 dbSNP
rs1002247952 1249 dbSNP
rs1022410870 1256 dbSNP
rs1011112971 1258 dbSNP
rs892692690 1263 dbSNP
rs1302136562 1267 dbSNP
rs1406767787 1271 dbSNP
rs1454084538 1271 dbSNP
rs578239614 1281 dbSNP
rs1375666374 1291 dbSNP
rs948875270 1291 dbSNP
rs1309600907 1292 dbSNP
rs377565514 1295 dbSNP
rs558157313 1297 dbSNP
rs775766018 1298 dbSNP
rs549611966 1301 dbSNP
rs900853124 1307 dbSNP
rs1423018460 1314 dbSNP
rs1057312344 1316 dbSNP
rs942420586 1317 dbSNP
rs535932466 1328 dbSNP
rs1265555475 1330 dbSNP
rs1164047317 1333 dbSNP
rs1431185866 1340 dbSNP
rs1438937771 1341 dbSNP
rs1405722784 1355 dbSNP
rs1178384270 1364 dbSNP
rs888238180 1370 dbSNP
rs1429875313 1374 dbSNP
rs1470944467 1378 dbSNP
rs1480693258 1385 dbSNP
rs924571134 1389 dbSNP
rs138173121 1390 dbSNP
rs1442308009 1393 dbSNP
rs1299476157 1396 dbSNP
rs373064510 1401 dbSNP
rs77146670 1404 dbSNP
rs1284384664 1408 dbSNP
rs1347922185 1418 dbSNP
rs1490753859 1424 dbSNP
rs910626516 1429 dbSNP
rs986249443 1435 dbSNP
rs1308095697 1436 dbSNP
rs1206744747 1439 dbSNP
rs1263867185 1444 dbSNP
rs1294391106 1445 dbSNP
rs1198394673 1446 dbSNP
rs374052869 1447 dbSNP
rs927978037 1448 dbSNP
rs1191334205 1450 dbSNP
rs1418737360 1460 dbSNP
rs1409998567 1467 dbSNP
rs980771824 1472 dbSNP
rs535524126 1477 dbSNP
rs1305520556 1478 dbSNP
rs976632082 1479 dbSNP
rs1225499929 1487 dbSNP
rs1374107787 1489 dbSNP
rs961297184 1491 dbSNP
rs1302684032 1495 dbSNP
rs1403331774 1499 dbSNP
rs1015651306 1504 dbSNP
rs1005200092 1508 dbSNP
rs759709515 1509 dbSNP
rs776814088 1510 dbSNP
rs1343325296 1518 dbSNP
rs181641472 1528 dbSNP
rs990041544 1546 dbSNP
rs1310734508 1550 dbSNP
rs1022702661 1555 dbSNP
rs956905060 1562 dbSNP
rs1012657368 1566 dbSNP
rs771227448 1572 dbSNP
rs1294224966 1575 dbSNP
rs1161166385 1576 dbSNP
rs895948313 1579 dbSNP
rs1214216639 1581 dbSNP
rs1241414916 1591 dbSNP
rs1419655245 1591 dbSNP
rs190060027 1592 dbSNP
rs1196734587 1594 dbSNP
rs1481173321 1595 dbSNP
rs1269167810 1596 dbSNP
rs998449473 1600 dbSNP
rs1443480357 1601 dbSNP
rs989034992 1601 dbSNP
rs1163759422 1607 dbSNP
rs1367079797 1608 dbSNP
rs750136265 1614 dbSNP
rs1017953022 1619 dbSNP
rs1318124197 1621 dbSNP
rs1346288467 1632 dbSNP
rs747052763 1634 dbSNP
rs1301163388 1640 dbSNP
rs533749359 1650 dbSNP
rs1382042143 1658 dbSNP
rs1223618060 1660 dbSNP
rs903419182 1670 dbSNP
rs888185829 1671 dbSNP
rs1048185415 1672 dbSNP
rs1259377061 1681 dbSNP
rs147012101 1685 dbSNP
rs896991795 1687 dbSNP
rs879618995 1688 dbSNP
rs1235674125 1692 dbSNP
rs947404211 1692 dbSNP
rs1282650738 1701 dbSNP
rs1221779505 1702 dbSNP
rs1347562948 1705 dbSNP
rs551384435 1720 dbSNP
rs1284199173 1730 dbSNP
rs986175773 1741 dbSNP
rs773396962 1748 dbSNP
rs768416215 1763 dbSNP
rs1359572958 1770 dbSNP
rs1290469015 1777 dbSNP
rs780674392 1781 dbSNP
rs933401276 1784 dbSNP
rs922402081 1787 dbSNP
rs927250637 1791 dbSNP
rs535209504 1793 dbSNP
rs976599215 1802 dbSNP
rs185582137 1803 dbSNP
rs1280359948 1806 dbSNP
rs1351048558 1815 dbSNP
rs1225275558 1816 dbSNP
rs1276371636 1817 dbSNP
rs527262681 1818 dbSNP
rs1203730997 1835 dbSNP
rs1244512057 1839 dbSNP
rs762026553 1845 dbSNP
rs1233115027 1852 dbSNP
rs78874940 1854 dbSNP
rs1192443514 1855 dbSNP
rs1470621654 1857 dbSNP
rs952408372 1859 dbSNP
rs957051817 1875 dbSNP
rs1398115882 1876 dbSNP
rs1409462967 1878 dbSNP
rs1031176102 1894 dbSNP
rs1022587094 1899 dbSNP
rs1337783995 1899 dbSNP
rs1426420576 1903 dbSNP
rs1012584427 1908 dbSNP
rs965601731 1909 dbSNP
rs182236160 1912 dbSNP
rs1260071022 1914 dbSNP
rs1224122720 1925 dbSNP
rs1264934474 1928 dbSNP
rs1035428570 1931 dbSNP
rs998967722 1934 dbSNP
rs903386857 1939 dbSNP
rs1336814423 1950 dbSNP
rs1018567487 1958 dbSNP
rs1273222934 1961 dbSNP
rs1043312436 1967 dbSNP
rs1439243342 1977 dbSNP
rs1197181384 1981 dbSNP
rs1268706319 1981 dbSNP
rs1480970768 1992 dbSNP
rs560296641 2006 dbSNP
rs888133472 2009 dbSNP
rs1475101031 2013 dbSNP
rs1168606826 2015 dbSNP
rs1012245591 2016 dbSNP
rs889089350 2020 dbSNP
rs1050430753 2021 dbSNP
rs116707653 2032 dbSNP
rs923330760 2042 dbSNP
rs1285063794 2052 dbSNP
rs1056962003 2055 dbSNP
rs951366 2056 dbSNP
rs1325715710 2062 dbSNP
rs905772831 2076 dbSNP
rs1219709032 2082 dbSNP
rs939862242 2091 dbSNP
rs564729168 2098 dbSNP
rs1263882981 2102 dbSNP
rs1044301104 2103 dbSNP
rs956768299 2109 dbSNP
rs1324970410 2115 dbSNP
rs142670727 2116 dbSNP
rs1428495209 2119 dbSNP
rs984013255 2122 dbSNP
rs1374928183 2137 dbSNP
rs1471853804 2143 dbSNP
rs575910364 2152 dbSNP
rs1381891247 2157 dbSNP
rs555449636 2158 dbSNP
rs1054245426 2159 dbSNP
rs1334648876 2161 dbSNP
rs1304775357 2162 dbSNP
rs1425021238 2162 dbSNP
rs915547620 2169 dbSNP
rs935420668 2171 dbSNP
rs924046199 2173 dbSNP
rs1406147906 2175 dbSNP
rs763491751 2177 dbSNP
rs541824592 2178 dbSNP
rs911452951 2187 dbSNP
rs959729220 2195 dbSNP
rs1374448263 2204 dbSNP
rs1172924109 2205 dbSNP
rs80002556 2213 dbSNP
rs1485825282 2219 dbSNP
rs138692413 2222 dbSNP
rs1242959868 2231 dbSNP
rs1460000883 2233 dbSNP
rs141010096 2247 dbSNP
rs188242457 2250 dbSNP
rs1446730545 2253 dbSNP
rs1165231908 2258 dbSNP
rs1361776855 2259 dbSNP
rs1452801026 2260 dbSNP
rs967533387 2262 dbSNP
rs1022218670 2268 dbSNP
rs544072665 2269 dbSNP
rs1011803248 2275 dbSNP
rs994279512 2277 dbSNP
rs961134167 2279 dbSNP
rs1035874139 2286 dbSNP
rs1195310285 2291 dbSNP
rs71825109 2292 dbSNP
rs1383057084 2293 dbSNP
rs546496786 2298 dbSNP
rs1304421983 2301 dbSNP
rs150111028 2302 dbSNP
rs1240241373 2305 dbSNP
rs1262978731 2307 dbSNP
rs1044253782 2310 dbSNP
rs1203092926 2311 dbSNP
rs1243893380 2313 dbSNP
rs1227842014 2325 dbSNP
rs1175639392 2329 dbSNP
rs1250101927 2331 dbSNP
rs1011455713 2333 dbSNP
rs1182307193 2342 dbSNP
rs1414061531 2348 dbSNP
rs1468218946 2353 dbSNP
rs1050689409 2359 dbSNP
rs1312712527 2362 dbSNP
rs559370286 2367 dbSNP
rs1406096302 2371 dbSNP
rs557969015 2375 dbSNP
rs1053775128 2376 dbSNP
rs759800093 2378 dbSNP
rs935359382 2381 dbSNP
rs924021337 2383 dbSNP
rs997503913 2384 dbSNP
rs1041544252 2391 dbSNP
rs1327533791 2404 dbSNP
rs1223356955 2405 dbSNP
rs1264315900 2409 dbSNP
rs944150791 2411 dbSNP
rs1389200914 2414 dbSNP
rs911403681 2415 dbSNP
rs1250939292 2419 dbSNP
rs901878235 2420 dbSNP
rs1036445326 2429 dbSNP
rs1196144479 2430 dbSNP
rs561179663 2446 dbSNP
rs1423658699 2449 dbSNP
rs886910640 2451 dbSNP
rs920193589 2452 dbSNP
rs1384985661 2455 dbSNP
rs1162133304 2456 dbSNP
rs1446898571 2460 dbSNP
rs1369568574 2468 dbSNP
rs1181120248 2471 dbSNP
rs537720444 2475 dbSNP
rs765786289 2497 dbSNP
rs1252804656 2504 dbSNP
rs1364036724 2507 dbSNP
rs1196583249 2509 dbSNP
rs961345677 2510 dbSNP
rs1284437928 2518 dbSNP
rs1347979325 2519 dbSNP
rs1289319170 2524 dbSNP
rs1247906114 2529 dbSNP
rs1360004568 2536 dbSNP
rs1397288135 2538 dbSNP
rs1035419426 2539 dbSNP
rs1308294325 2555 dbSNP
rs1206812344 2556 dbSNP
rs931220655 2564 dbSNP
rs915817684 2566 dbSNP
rs991400980 2567 dbSNP
rs1269479927 2571 dbSNP
rs1489453565 2577 dbSNP
rs1184248524 2583 dbSNP
rs1022745270 2590 dbSNP
rs776952943 2593 dbSNP
rs1170038865 2596 dbSNP
rs938349938 2602 dbSNP
rs777043600 2605 dbSNP
rs1304182434 2616 dbSNP
rs1352107257 2620 dbSNP
rs766493338 2621 dbSNP
rs1307154253 2629 dbSNP
rs1403943513 2632 dbSNP
rs977165107 2637 dbSNP
rs1363332073 2638 dbSNP
rs1359048748 2649 dbSNP
rs999509521 2652 dbSNP
rs1292305656 2653 dbSNP
rs1323431767 2654 dbSNP
rs563989637 2678 dbSNP
rs760963626 2682 dbSNP
rs967546766 2688 dbSNP
rs1241466979 2689 dbSNP
rs902515342 2690 dbSNP
rs1426976156 2692 dbSNP
rs1392034222 2693 dbSNP
rs1041119395 2707 dbSNP
rs944098487 2708 dbSNP
rs1469100326 2711 dbSNP
rs889916359 2714 dbSNP
rs1399337593 2715 dbSNP
rs1021772112 2720 dbSNP
rs920160315 2721 dbSNP
rs990703747 2724 dbSNP
rs1437330064 2727 dbSNP
rs771020242 2729 dbSNP
rs973412489 2730 dbSNP
rs953554114 2734 dbSNP
rs569133753 2743 dbSNP
rs981106860 2747 dbSNP
rs1183074363 2764 dbSNP
rs1480194391 2768 dbSNP
rs997806297 2769 dbSNP
rs901803017 2771 dbSNP
rs1317497698 2774 dbSNP
rs969776361 2777 dbSNP
rs1260777597 2785 dbSNP
rs1460488338 2792 dbSNP
rs541537436 2794 dbSNP
rs1238868044 2805 dbSNP
rs1004938488 2806 dbSNP
rs957451375 2816 dbSNP
rs1203298174 2836 dbSNP
rs1352830676 2842 dbSNP
rs548956077 2844 dbSNP
rs1031548629 2845 dbSNP
rs1260729499 2846 dbSNP
rs1470355577 2849 dbSNP
rs887875945 2855 dbSNP
rs1343206592 2857 dbSNP
rs1284843829 2859 dbSNP
rs901795140 2862 dbSNP
rs1019625364 2865 dbSNP
rs1008257652 2869 dbSNP
rs1332021271 2876 dbSNP
rs1230082039 2880 dbSNP
rs1281311404 2882 dbSNP
rs1322153403 2895 dbSNP
rs889859412 2897 dbSNP
rs1280260929 2904 dbSNP
rs1435770488 2908 dbSNP
rs1049176328 2909 dbSNP
rs1204256596 2918 dbSNP
rs931133539 2928 dbSNP
rs1049851465 2929 dbSNP
rs11547784 2934 dbSNP
rs772222969 2937 dbSNP
rs931472648 2938 dbSNP
rs1387785085 2939 dbSNP
rs894354689 2942 dbSNP
rs572315877 2953 dbSNP
rs1480784849 2955 dbSNP
rs1174435477 2956 dbSNP
rs1394585650 2958 dbSNP
rs1409675060 2963 dbSNP
rs535433818 2969 dbSNP
rs938609191 2984 dbSNP
rs1469382041 2991 dbSNP
rs1370875242 2992 dbSNP
rs1411455944 2995 dbSNP
rs928275662 2998 dbSNP
rs1201827577 3000 dbSNP
rs977511499 3004 dbSNP
rs1037252130 3006 dbSNP
rs1276170619 3010 dbSNP
rs140793132 3011 dbSNP
rs150964031 3012 dbSNP
rs989948647 3014 dbSNP
rs940259025 3015 dbSNP
rs953523165 3021 dbSNP
rs1190757947 3023 dbSNP
rs1220768050 3028 dbSNP
rs1268766999 3030 dbSNP
rs1448600327 3031 dbSNP
rs749187630 3038 dbSNP
rs879479853 3057 dbSNP
rs976295410 3062 dbSNP
rs533093915 3074 dbSNP
rs966294102 3085 dbSNP
rs1168658822 3088 dbSNP
rs564488546 3097 dbSNP
rs1014901701 3098 dbSNP
rs1202445566 3103 dbSNP
rs1431370933 3104 dbSNP
rs915639264 3112 dbSNP
rs1364874637 3114 dbSNP
rs1320762090 3117 dbSNP
rs183956260 3128 dbSNP
rs1387351803 3131 dbSNP
rs1325453194 3153 dbSNP
rs1264515201 3156 dbSNP
rs551177953 3159 dbSNP
rs887820091 3167 dbSNP
rs1297831625 3171 dbSNP
rs775546599 3178 dbSNP
rs1219436973 3179 dbSNP
rs1343915564 3179 dbSNP
rs115080579 3180 dbSNP
rs1357499939 3183 dbSNP
rs1012290344 3185 dbSNP
rs1031916480 3186 dbSNP
rs1194044678 3186 dbSNP
rs977323810 3186 dbSNP
rs1269906548 3188 dbSNP
rs1443075242 3188 dbSNP
rs1429080120 3189 dbSNP
rs1328666756 3190 dbSNP
rs966337972 3191 dbSNP
rs1018903094 3195 dbSNP
rs1452609318 3198 dbSNP
rs1164879766 3199 dbSNP
rs894281051 3228 dbSNP
rs1382746519 3229 dbSNP
rs143746483 3233 dbSNP
rs542159352 3243 dbSNP
rs1002722517 3247 dbSNP
rs191430734 3251 dbSNP
rs1449928456 3252 dbSNP
rs1313938343 3254 dbSNP
rs907097164 3257 dbSNP
rs1341395556 3266 dbSNP
rs1419084738 3277 dbSNP
rs1041663985 3278 dbSNP
rs541277760 3280 dbSNP
rs1259457427 3293 dbSNP
rs551284913 3294 dbSNP
rs376964949 3312 dbSNP
rs945695788 3318 dbSNP
rs1476290546 3328 dbSNP
rs187002192 3329 dbSNP
rs1182891026 3337 dbSNP
rs11547783 3340 dbSNP
rs10900522 3341 dbSNP
rs1257157000 3348 dbSNP
rs1244442399 3351 dbSNP
rs931725680 3353 dbSNP
rs1436807450 3355 dbSNP
rs1270475740 3356 dbSNP
rs1361979892 3367 dbSNP
rs1453048868 3368 dbSNP
rs922064608 3379 dbSNP
rs781147982 3382 dbSNP
rs1159816733 3383 dbSNP
rs6665860 3387 dbSNP
rs1467795138 3389 dbSNP
rs966222519 3395 dbSNP
rs1402522521 3401 dbSNP
rs1398133631 3405 dbSNP
rs78240454 3415 dbSNP
rs1335683851 3418 dbSNP
rs1004407759 3434 dbSNP
rs983762254 3438 dbSNP
rs952103406 3440 dbSNP
rs948351654 3445 dbSNP
rs915586835 3450 dbSNP
rs1054164731 3454 dbSNP
rs1338711449 3458 dbSNP
rs1248069800 3460 dbSNP
rs756794804 3462 dbSNP
rs1472149389 3464 dbSNP
rs1027665499 3467 dbSNP
rs557619104 3468 dbSNP
rs796701256 3473 dbSNP
rs1479151995 3478 dbSNP
rs184835566 3483 dbSNP
rs1174804640 3490 dbSNP
rs924410610 3501 dbSNP
rs1467322843 3515 dbSNP
rs1296101478 3516 dbSNP
rs1354122120 3519 dbSNP
rs1410855661 3519 dbSNP
rs1310351786 3525 dbSNP
rs959467386 3531 dbSNP
rs1035092570 3532 dbSNP
rs1222963347 3532 dbSNP
rs1002650345 3534 dbSNP
rs1225442848 3545 dbSNP
rs61824664 3549 dbSNP
rs1205656375 3559 dbSNP
rs1482582599 3559 dbSNP
rs1162769764 3561 dbSNP
rs1489855969 3570 dbSNP
rs1425179280 3577 dbSNP
rs911786775 3586 dbSNP
rs369031111 3589 dbSNP
rs555695778 3599 dbSNP
rs986046652 3600 dbSNP
rs1010156741 3604 dbSNP
rs892759736 3611 dbSNP
rs1054133985 3617 dbSNP
rs931694536 3618 dbSNP
rs1404803516 3625 dbSNP
rs953991084 3633 dbSNP
rs1369755671 3635 dbSNP
rs1380634532 3642 dbSNP
rs1227390279 3644 dbSNP
rs1279563193 3648 dbSNP
rs1295086654 3650 dbSNP
rs1362649165 3654 dbSNP
rs35216122 3662 dbSNP
rs1276594846 3666 dbSNP
rs1357017172 3670 dbSNP
rs757906441 3672 dbSNP
rs1434455152 3673 dbSNP
rs1349337042 3675 dbSNP
rs565549478 3694 dbSNP
rs779391202 3695 dbSNP
rs1388707222 3699 dbSNP
rs908040079 3712 dbSNP
rs1247012475 3718 dbSNP
rs780259746 3718 dbSNP
rs755533763 3720 dbSNP
rs995559760 3723 dbSNP
rs984077708 3727 dbSNP
rs952345233 3728 dbSNP
rs1189951070 3729 dbSNP
rs754139115 3731 dbSNP
rs990762905 3733 dbSNP
rs959395799 3752 dbSNP
rs1451694360 3757 dbSNP
rs1320041773 3763 dbSNP
rs376662004 3767 dbSNP
rs1004766640 3770 dbSNP
rs183987375 3771 dbSNP
rs1045928283 3772 dbSNP
rs1013114383 3775 dbSNP
rs1323485144 3782 dbSNP
rs144482900 3782 dbSNP
rs764354058 3782 dbSNP
rs1935662 3785 dbSNP
rs1272028734 3790 dbSNP
rs971598735 3791 dbSNP
rs1266859381 3792 dbSNP
rs1345671635 3795 dbSNP
rs935710343 3797 dbSNP
rs1307831192 3799 dbSNP
rs1020124223 3806 dbSNP
rs1217361761 3809 dbSNP
rs1010538727 3813 dbSNP
rs148123511 3817 dbSNP
rs374402548 3817 dbSNP
rs539132775 3817 dbSNP
rs1032951067 3822 dbSNP
rs1416573283 3824 dbSNP
rs1417924274 3827 dbSNP
rs995828321 3828 dbSNP
rs570531535 3830 dbSNP
rs1159080993 3832 dbSNP
rs1389397291 3841 dbSNP
rs1458908336 3842 dbSNP
rs1334924645 3844 dbSNP
rs1283928048 3848 dbSNP
rs745606138 3852 dbSNP
rs750678629 3859 dbSNP
rs1041484445 3860 dbSNP
rs1446992798 3869 dbSNP
rs1355335362 3886 dbSNP
rs1284629768 3890 dbSNP
rs1406837104 3897 dbSNP
rs767679835 3898 dbSNP
rs1369007289 3900 dbSNP
rs1226433525 3901 dbSNP
rs1307626808 3903 dbSNP
rs1287670626 3904 dbSNP
rs1462849606 3907 dbSNP
rs761953121 3923 dbSNP
rs1356600171 3927 dbSNP
rs944482683 3928 dbSNP
rs900209901 3929 dbSNP
rs780915968 3933 dbSNP
rs1211258354 3935 dbSNP
rs774638758 3940 dbSNP
rs1239510149 3948 dbSNP
rs985993987 3949 dbSNP
rs764894816 3953 dbSNP
rs1182029267 3954 dbSNP
rs1413387841 3963 dbSNP
rs117180865 3973 dbSNP
rs1174435883 3975 dbSNP
rs1424714930 3978 dbSNP
rs1415183866 3981 dbSNP
rs886580729 3983 dbSNP
rs1336411771 3986 dbSNP
rs1407797175 3990 dbSNP
rs1047910704 3997 dbSNP
rs531126009 4001 dbSNP
rs1229683256 4005 dbSNP
rs141444520 4009 dbSNP
rs751123387 4012 dbSNP
rs974466192 4015 dbSNP
rs1282918085 4016 dbSNP
rs962754208 4021 dbSNP
rs1369448212 4024 dbSNP
rs1253141926 4033 dbSNP
rs930830214 4035 dbSNP
rs561994097 4037 dbSNP
rs1197362202 4038 dbSNP
rs146864482 4042 dbSNP
rs938009370 4046 dbSNP
rs1478408140 4047 dbSNP
rs1174491387 4050 dbSNP
rs3805 4053 dbSNP
rs1427555808 4058 dbSNP
rs982126997 4079 dbSNP
rs966832998 4087 dbSNP
rs1457336069 4089 dbSNP
rs1371082862 4096 dbSNP
rs559290183 4098 dbSNP
rs1173790408 4106 dbSNP
rs1013064128 4113 dbSNP
rs1329955663 4127 dbSNP
rs6593965 4128 dbSNP
rs1276221142 4133 dbSNP
rs1339698196 4136 dbSNP
rs1228112992 4142 dbSNP
rs577226353 4151 dbSNP
rs1033281636 4152 dbSNP
rs1269910665 4161 dbSNP
rs746832095 4169 dbSNP
rs1208521809 4176 dbSNP
rs1289827165 4178 dbSNP
rs1452218305 4179 dbSNP
rs1201152691 4184 dbSNP
rs957459635 4187 dbSNP
rs1032920386 4191 dbSNP
rs1449163911 4192 dbSNP
rs1189460693 4220 dbSNP
rs1000244953 4221 dbSNP
rs902849631 4222 dbSNP
rs1161431542 4223 dbSNP
rs1389874703 4226 dbSNP
rs1405464563 4239 dbSNP
rs1485795029 4240 dbSNP
rs1324878764 4246 dbSNP
rs1362582561 4254 dbSNP
rs996098841 4263 dbSNP
rs1433987260 4264 dbSNP
rs900136373 4265 dbSNP
rs1297854894 4267 dbSNP
rs1367849794 4275 dbSNP
rs1240890722 4283 dbSNP
rs1210626474 4299 dbSNP
rs1041822738 4303 dbSNP
rs551405408 4307 dbSNP
rs1018637738 4310 dbSNP
rs1266388003 4311 dbSNP
rs1464489662 4312 dbSNP
rs1009042681 4324 dbSNP
rs886172386 4334 dbSNP
rs1451131455 4344 dbSNP
rs1185077384 4345 dbSNP
rs944428885 4346 dbSNP
rs890248932 4349 dbSNP
rs1164920873 4360 dbSNP
rs1314169039 4365 dbSNP
rs1301645637 4374 dbSNP
rs563791947 4390 dbSNP
rs930820661 4408 dbSNP
rs1359725136 4415 dbSNP
rs920478166 4420 dbSNP
rs973348294 4432 dbSNP
rs1322422128 4447 dbSNP
rs1435790274 4457 dbSNP
rs1404710321 4471 dbSNP
rs372031016 4483 dbSNP
rs1247700486 4484 dbSNP
rs368701250 4484 dbSNP
rs941325135 4490 dbSNP
rs543598742 4491 dbSNP
rs777452931 4492 dbSNP
rs186644378 4497 dbSNP
rs1177181130 4506 dbSNP
rs763118257 4506 dbSNP
rs1428328786 4510 dbSNP
rs938273066 4511 dbSNP
rs927940309 4512 dbSNP
rs747640880 4518 dbSNP
rs991590691 4520 dbSNP
rs1159186603 4526 dbSNP
rs1413722288 4534 dbSNP
rs1464291235 4538 dbSNP
rs1191041223 4549 dbSNP
rs958923348 4550 dbSNP
rs1403416240 4554 dbSNP
rs1398122931 4561 dbSNP
rs1465798291 4566 dbSNP
rs1350353392 4569 dbSNP
rs555634799 4574 dbSNP
rs1410529847 4586 dbSNP
rs1242541367 4590 dbSNP
rs753306665 4593 dbSNP
rs182054129 4596 dbSNP
rs189761947 4600 dbSNP
rs3747971 4604 dbSNP
rs552958513 4636 dbSNP
rs1232877756 4641 dbSNP
rs532848015 4643 dbSNP
rs1345495996 4647 dbSNP
rs11547786 4650 dbSNP
rs1412955154 4650 dbSNP
rs1256839218 4661 dbSNP
rs1377811093 4661 dbSNP
rs945391480 4662 dbSNP
rs1305524690 4669 dbSNP
rs903464962 4671 dbSNP
rs1182808379 4687 dbSNP
rs1019957014 4699 dbSNP
rs755409586 4703 dbSNP
rs990003749 4704 dbSNP
rs957154506 4721 dbSNP
rs1032855114 4725 dbSNP
rs868741825 4728 dbSNP
rs1229049841 4735 dbSNP
rs539430222 4738 dbSNP
rs964643902 4744 dbSNP
rs1370488200 4755 dbSNP
rs1018896527 4759 dbSNP
rs899007303 4762 dbSNP
rs1008551013 4774 dbSNP
rs570326141 4784 dbSNP
rs1037973513 4787 dbSNP
rs570394904 4788 dbSNP
rs950470169 4789 dbSNP
rs1334054947 4797 dbSNP
rs1332996169 4810 dbSNP
rs1026062446 4812 dbSNP
rs1236230512 4815 dbSNP
rs994997509 4833 dbSNP
rs907808731 4840 dbSNP
rs1402423325 4854 dbSNP
rs754371728 4855 dbSNP
rs982735839 4863 dbSNP
rs899304770 4864 dbSNP
rs1055232818 4868 dbSNP
rs1455250294 4870 dbSNP
rs11547787 4873 dbSNP
rs144349470 4879 dbSNP
rs950070076 4884 dbSNP
rs557018497 4885 dbSNP
rs1297221764 4891 dbSNP
rs1390005354 4896 dbSNP
rs1002387092 4900 dbSNP
rs1430776523 4908 dbSNP
rs917310791 4909 dbSNP
rs11547785 4911 dbSNP
rs1348602620 4912 dbSNP
rs1065677 4918 dbSNP
rs1457483738 4919 dbSNP
rs1460197891 4919 dbSNP
rs906772872 4920 dbSNP
rs1392967197 4922 dbSNP
rs1047113229 4929 dbSNP
rs1065678 4931 dbSNP
rs1297113253 4931 dbSNP
rs765632559 4932 dbSNP
rs1450575562 4933 dbSNP
rs796369166 4947 dbSNP
rs1364243981 4955 dbSNP
rs945387858 4961 dbSNP
rs1065680 4963 dbSNP
rs59075987 4975 dbSNP
rs186378275 4977 dbSNP
rs1228815746 4988 dbSNP
rs1297666354 4995 dbSNP
rs959090525 5002 dbSNP
rs143951662 5003 dbSNP
rs1265582976 5005 dbSNP
rs1469405967 5009 dbSNP
rs979376429 5022 dbSNP
rs541444877 5025 dbSNP
rs530288823 5026 dbSNP
rs936753433 5028 dbSNP
rs1412271497 5029 dbSNP
rs954378565 5036 dbSNP
rs531226333 5040 dbSNP
rs1389591490 5045 dbSNP
rs1396847198 5045 dbSNP
rs1431216445 5045 dbSNP
rs1455682112 5045 dbSNP
rs995932158 5045 dbSNP
rs1479820553 5050 dbSNP
rs1376692076 5053 dbSNP
rs1227727809 5058 dbSNP
rs974555431 5063 dbSNP
rs1276432161 5073 dbSNP
rs548392796 5080 dbSNP
rs1313311746 5082 dbSNP
rs1156495521 5091 dbSNP
rs1336355357 5095 dbSNP
rs1205630094 5096 dbSNP
rs865880449 5106 dbSNP
rs1312874744 5107 dbSNP
rs1246956232 5115 dbSNP
rs898949917 5118 dbSNP
rs868625903 5131 dbSNP
rs987835518 5133 dbSNP
rs1182993555 5140 dbSNP
rs750793403 5141 dbSNP
rs528711178 5143 dbSNP
rs1305753860 5164 dbSNP
rs1158446182 5175 dbSNP
rs566039294 5176 dbSNP
rs754103349 5178 dbSNP
rs1310185072 5180 dbSNP
rs994566035 5182 dbSNP
rs1430831971 5184 dbSNP
rs1174199909 5186 dbSNP
rs1046319617 5187 dbSNP
rs1365384120 5196 dbSNP
rs963114160 5212 dbSNP
rs1446971604 5226 dbSNP
rs1313437581 5231 dbSNP
rs1357228040 5232 dbSNP
rs1407464690 5233 dbSNP
rs1033413056 5235 dbSNP
rs1287241191 5239 dbSNP
rs1329224992 5242 dbSNP
rs1002314962 5249 dbSNP
rs917253832 5251 dbSNP
rs1055753899 5254 dbSNP
rs937437485 5255 dbSNP
rs1211202021 5257 dbSNP
rs767773708 5259 dbSNP
rs906744806 5262 dbSNP
rs762140976 5263 dbSNP
rs1482321096 5271 dbSNP
rs796886603 5276 dbSNP
rs978938060 5283 dbSNP
rs967961969 5287 dbSNP
rs796448769 5292 dbSNP
rs1161951376 5310 dbSNP
rs552633251 5310 dbSNP
rs1459947369 5332 dbSNP
rs913462623 5337 dbSNP
rs1424671929 5343 dbSNP
rs564045889 5347 dbSNP
rs1173964554 5351 dbSNP
rs954975948 5356 dbSNP
rs1028661451 5359 dbSNP
rs1307313670 5363 dbSNP
rs561548931 5365 dbSNP
rs1471702787 5366 dbSNP
rs181358537 5372 dbSNP
rs373712174 5373 dbSNP
rs574031399 5373 dbSNP
rs892438869 5379 dbSNP
rs1054216269 5384 dbSNP
rs1235485791 5393 dbSNP
rs1282994344 5397 dbSNP
rs1182583374 5401 dbSNP
rs1205133471 5403 dbSNP
rs1490116389 5406 dbSNP
rs1016441947 5408 dbSNP
rs1439661372 5413 dbSNP
rs1004698964 5416 dbSNP
rs1246355257 5419 dbSNP
rs1289388770 5434 dbSNP
rs1478520255 5438 dbSNP
rs936679904 5443 dbSNP
rs1211554300 5448 dbSNP
rs921339185 5455 dbSNP
rs1039847437 5457 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaAUACACGACGAu 5'
                    ||  ||||||| 
Target 5' ----------UAAAUGCUGCUc 3'
1 - 12
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000367142.4 | 3UTR | UAAAUGCUGCUCCCAUACAAUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease 0.513 4.4e-3 0.341 4.8e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.302 7.6e-3 0.287 1.1e-2 64 Click to see details
GSE19783 ER- ER- breast cancer 0.264 9.4e-3 0.263 9.6e-3 79 Click to see details
GSE42095 Differentiated embryonic stem cells -0.414 2.5e-2 -0.260 1.2e-1 23 Click to see details
GSE19536 Breast cancer 0.194 2.7e-2 0.200 2.3e-2 100 Click to see details
GSE38226 Liver fibrosis 0.391 4.0e-2 0.420 2.9e-2 21 Click to see details
GSE17498 Multiple myeloma 0.257 5.5e-2 0.421 3.4e-3 40 Click to see details
GSE17306 Multiple myeloma 0.199 8.5e-2 0.241 4.8e-2 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.304 9.6e-2 0.553 5.7e-3 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.165 2.2e-1 0.208 1.6e-1 24 Click to see details
GSE21849 B cell lymphoma -0.145 2.3e-1 0.168 1.9e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.124 2.5e-1 0.261 7.5e-2 32 Click to see details
GSE28544 Breast cancer 0.125 2.8e-1 0.459 1.2e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.077 3.6e-1 -0.035 4.3e-1 25 Click to see details
GSE21032 Prostate cancer 0.034 3.8e-1 0.016 4.4e-1 83 Click to see details
GSE27834 Pluripotent stem cells -0.082 3.8e-1 -0.265 1.6e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.016 4.4e-1 -0.022 4.2e-1 90 Click to see details
GSE28260 Renal cortex and medulla 0.039 4.5e-1 0.066 4.2e-1 13 Click to see details
GSE19350 CNS germ cell tumors -0.031 4.6e-1 0.035 4.6e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.002 5.0e-1 0.020 4.7e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.002 5.0e-1 0.020 4.7e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.624 0 -0.618 0 32 Click to see details
BLCA -0.685 0 -0.581 0.01 18 Click to see details
KICH -0.325 0.06 -0.228 0.14 25 Click to see details
KIRC -0.193 0.06 -0.150 0.11 68 Click to see details
PAAD 0.885 0.06 0.800 0.1 4 Click to see details
KIRP -0.281 0.06 -0.266 0.07 32 Click to see details
CESC 0.936 0.11 1.000 0.5 3 Click to see details
BRCA -0.128 0.12 -0.084 0.22 84 Click to see details
PCPG -0.779 0.22 -1.000 0.5 3 Click to see details
COAD -0.284 0.25 -0.452 0.13 8 Click to see details
LIHC 0.081 0.29 0.044 0.38 49 Click to see details
LUAD -0.17 0.3 -0.182 0.29 12 Click to see details
LUSC 0.088 0.3 0.076 0.33 38 Click to see details
THCA -0.059 0.33 -0.015 0.46 59 Click to see details
UCEC 0.094 0.35 0.075 0.38 19 Click to see details
HNSC 0.051 0.37 -0.005 0.49 42 Click to see details
ESCA 0.086 0.4 0.309 0.18 11 Click to see details
CHOL 0.098 0.4 0.200 0.3 9 Click to see details
PRAD 0.014 0.46 -0.009 0.48 50 Click to see details
PRAD 0.014 0.46 -0.009 0.48 50 Click to see details
PRAD 0.014 0.46 -0.009 0.48 50 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C p