miRTarBase - #MIRT548219 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FKBP1A   
Synonyms FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE
Description FK506 binding protein 1A
Transcript NM_000801   
Other Transcripts NM_054014   
Expression
Putative miRNA Targets on FKBP1A
3'UTR of FKBP1A
(miRNA target sites are highlighted)
>FKBP1A|NM_000801|3'UTR
   1 CAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGA
  81 ATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGC
 161 TTTGCTTCCGACACCTCTGTTTCCTCTTCCCCTTTCTCCTCGTATGTGTGTTTACCTAAACTATATGCCATAAACCTCAA
 241 GTTATTCATTTTATTTTGTTTTCATTTTGGGGTGAAGATTCAGTTTCAGTCTTTTGGATATAGGTTTCCAATTAAGTACA
 321 TGGTCAAGTATTAACAGCACAAGTGGTAGGTTAACATTAGAATAGGAATTGGTGTTGGGGGGGGGGTTTGCAAGAATATT
 401 TTATTTTAATTTTTTGGATGAAATTTTTATCTATTATATATTAAACATTCTTGCTGCTGCGCTGCAAAGCCATAGCAGAT
 481 TTGAGGCGCTGTTGAGGACTGAATTACTCTCCAAGTTGAGAGATGTCTTTGGGTTAAATTAAAAGCCCTACCTAAAACTG
 561 AGGTGGGGATGGGGAGAGCCTTTGCCTCCACCATTCCCACCCACCCTCCCCTTAAACCCTCTGCCTTTGAAAGTAGATCA
 641 TGTTCACTGCAATGCTGGACACTACAGGTATCTGTCCCTGGGCCAGCAGGGACCTCTGAAGCCTTCTTTGTGGCCTTTTT
 721 TTTTTTTCATCCTGTGGTTTTTCTAATGGACTTTCAGGAATTTTGTAATCTCATAACTTTCCAAGCTCCACCACTTCCTA
 801 AATCTTAAGAACTTTAATTGACAGTTTCAATTGAAGGTGCTGTTTGTAGACTTAACACCCAGTGAAAGCCCAGCCATCAT
 881 GACAAATCCTTGAATGTTCTCTTAAGAAAATGATGCTGGTCATCGCAGCTTCAGCATCTCCTGTTTTTTGATGCTTGGCT
 961 CCCTCTGCTGATCTCAGTTTCCTGGCTTTTCCTCCCTCAGCCCCTTCTCACCCCTTTGCTGTCCTGTGTAGTGATTTGGT
1041 GAGAAATCGTTGCTGCACCCTTCCCCCAGCACCATTTATGAGTCTCAAGTTTTATTATTGCAATAAAAGTGCTTTATGCC
1121 GGCTTTTCTCAGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :||| |||| | ||||||| 
Target 5' atTAAA-CATTCT-TGCTGCTg 3'
440 - 459 162.00 -12.20
2
miRNA  3' guguuuGGUAA--UACACGACGAu 5'
                | |||  | ||||||:| 
Target 5' cagtttCAATTGAAGGTGCTGTTt 3'
822 - 845 138.00 -11.30
3
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             |||:|:|    ||||||  
Target 5' gagAAATCGT----TGCTGCac 3'
1041 - 1058 133.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN508282 6 COSMIC
COSN21101391 53 COSMIC
COSN31597900 61 COSMIC
COSN30455431 72 COSMIC
COSN30506581 81 COSMIC
COSN30146274 82 COSMIC
COSN30504794 88 COSMIC
COSN30539994 98 COSMIC
COSN20079712 137 COSMIC
COSN30144162 138 COSMIC
COSN30604181 141 COSMIC
COSN7996695 335 COSMIC
COSN1864999 1391 COSMIC
COSN15791127 1662 COSMIC
COSN9395785 1800 COSMIC
COSN24522373 1851 COSMIC
COSN24522372 1896 COSMIC
COSN30700599 1980 COSMIC
COSN15632046 2047 COSMIC
COSN22584121 2072 COSMIC
COSN29461856 2082 COSMIC
COSN28671098 2084 COSMIC
COSN18716634 2136 COSMIC
COSN30128734 2172 COSMIC
COSN26669012 2226 COSMIC
COSN23015465 2248 COSMIC
COSN16670532 2286 COSMIC
COSN22179274 2299 COSMIC
COSN26668131 2303 COSMIC
COSN20116199 2380 COSMIC
COSN16130673 2430 COSMIC
COSN31529437 2434 COSMIC
COSN31540379 2464 COSMIC
COSN19596901 2554 COSMIC
COSN31567830 2557 COSMIC
COSN31540386 2579 COSMIC
COSN30543520 2582 COSMIC
COSN30536300 2589 COSMIC
COSN20632018 2654 COSMIC
COSN31536866 2658 COSMIC
COSN20116197 2718 COSMIC
COSN31487025 2758 COSMIC
COSN30132178 2808 COSMIC
COSN30132181 2830 COSMIC
COSN30143875 2887 COSMIC
COSN8610482 2924 COSMIC
COSN28634282 2928 COSMIC
COSN31542939 2941 COSMIC
COSN20771054 3069 COSMIC
COSN26666739 3079 COSMIC
COSN30119695 3117 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747088929 3 dbSNP
rs1396215201 4 dbSNP
rs777836202 7 dbSNP
rs758493076 14 dbSNP
rs1382484572 16 dbSNP
rs758438227 18 dbSNP
rs1189943572 22 dbSNP
rs748425374 28 dbSNP
rs1310979517 31 dbSNP
rs1247635454 33 dbSNP
rs779111159 34 dbSNP
rs755342056 36 dbSNP
rs754306267 44 dbSNP
rs766982049 46 dbSNP
rs756749310 50 dbSNP
rs749882555 61 dbSNP
rs752771984 64 dbSNP
rs767064187 69 dbSNP
rs1387724053 70 dbSNP
rs931978249 76 dbSNP
rs552945753 77 dbSNP
rs966865292 79 dbSNP
rs1362781248 82 dbSNP
rs1322058027 85 dbSNP
rs761318984 91 dbSNP
rs1242837438 95 dbSNP
rs762834082 98 dbSNP
rs763693915 99 dbSNP
rs184089222 106 dbSNP
rs879187230 107 dbSNP
rs966506788 108 dbSNP
rs569192484 112 dbSNP
rs1001917033 118 dbSNP
rs552505934 127 dbSNP
rs1301897423 128 dbSNP
rs968297361 130 dbSNP
rs1450840887 138 dbSNP
rs1185672494 139 dbSNP
rs1366509769 140 dbSNP
rs1024899647 142 dbSNP
rs1294121180 145 dbSNP
rs538660594 149 dbSNP
rs1234061364 152 dbSNP
rs1461892278 154 dbSNP
rs993384931 157 dbSNP
rs897678969 158 dbSNP
rs1262945430 170 dbSNP
rs1037561019 180 dbSNP
rs1248374170 185 dbSNP
rs941827386 186 dbSNP
rs1184690633 187 dbSNP
rs1427271925 195 dbSNP
rs1319307327 196 dbSNP
rs1174764707 197 dbSNP
rs1285541005 206 dbSNP
rs112411527 213 dbSNP
rs775406393 215 dbSNP
rs536546656 221 dbSNP
rs1034415625 222 dbSNP
rs1287562876 226 dbSNP
rs1002666610 229 dbSNP
rs922568228 230 dbSNP
rs530238590 242 dbSNP
rs1282762747 243 dbSNP
rs573596162 247 dbSNP
rs36059165 253 dbSNP
rs1328894738 260 dbSNP
rs1230432970 264 dbSNP
rs1269070774 267 dbSNP
rs1004636542 294 dbSNP
rs914143656 296 dbSNP
rs2296039 297 dbSNP
rs1213393989 299 dbSNP
rs550775930 307 dbSNP
rs1488781474 311 dbSNP
rs887714819 319 dbSNP
rs1198022789 325 dbSNP
rs958444603 333 dbSNP
rs531068081 334 dbSNP
rs1159429969 335 dbSNP
rs6105016 339 dbSNP
rs1048937882 343 dbSNP
rs565239729 344 dbSNP
rs980895202 358 dbSNP
rs1352083158 359 dbSNP
rs1458835287 382 dbSNP
rs931880189 385 dbSNP
rs1303127526 389 dbSNP
rs1343702275 393 dbSNP
rs760850676 397 dbSNP
rs970431476 400 dbSNP
rs2296038 422 dbSNP
rs1289152332 424 dbSNP
rs1372891968 424 dbSNP
rs1221813532 430 dbSNP
rs1291806821 434 dbSNP
rs6041759 434 dbSNP
rs993143353 435 dbSNP
rs1289581682 436 dbSNP
rs897773655 437 dbSNP
rs1040773366 439 dbSNP
rs576754673 441 dbSNP
rs560128655 442 dbSNP
rs1183277470 443 dbSNP
rs1397594898 443 dbSNP
rs878863207 443 dbSNP
rs1425747360 447 dbSNP
rs944843515 454 dbSNP
rs1378553568 463 dbSNP
rs923988121 468 dbSNP
rs1165502428 469 dbSNP
rs888916003 477 dbSNP
rs775688506 478 dbSNP
rs1286224893 484 dbSNP
rs539929733 485 dbSNP
rs1245064840 489 dbSNP
rs932706905 493 dbSNP
rs537173605 520 dbSNP
rs6105015 528 dbSNP
rs1041054005 532 dbSNP
rs1435618315 541 dbSNP
rs112781253 545 dbSNP
rs1237758625 547 dbSNP
rs959870980 551 dbSNP
rs1352066292 561 dbSNP
rs1283301778 567 dbSNP
rs1445543338 569 dbSNP
rs1183384155 571 dbSNP
rs914195107 576 dbSNP
rs1359776052 580 dbSNP
rs6105014 583 dbSNP
rs1169043153 585 dbSNP
rs563775262 585 dbSNP
rs1313885525 586 dbSNP
rs1336398371 591 dbSNP
rs1407120235 591 dbSNP
rs771740738 592 dbSNP
rs926754889 612 dbSNP
rs980564471 613 dbSNP
rs970905942 622 dbSNP
rs1269580649 627 dbSNP
rs1002919698 630 dbSNP
rs1220454797 636 dbSNP
rs917658546 638 dbSNP
rs191687971 644 dbSNP
rs1460616372 648 dbSNP
rs1203393980 658 dbSNP
rs1241655768 659 dbSNP
rs961701324 666 dbSNP
rs1016200159 668 dbSNP
rs1006524439 670 dbSNP
rs1014603928 671 dbSNP
rs1430196189 675 dbSNP
rs953257756 685 dbSNP
rs878915385 692 dbSNP
rs77324343 701 dbSNP
rs1289163038 702 dbSNP
rs997347330 706 dbSNP
rs1358490898 719 dbSNP
rs1317468857 725 dbSNP
rs1305083602 731 dbSNP
rs527979609 738 dbSNP
rs1425342664 745 dbSNP
rs1048864417 749 dbSNP
rs1283405269 756 dbSNP
rs1221284678 769 dbSNP
rs1269693971 773 dbSNP
rs901300365 777 dbSNP
rs77748693 781 dbSNP
rs1430468781 782 dbSNP
rs1261575208 788 dbSNP
rs900408933 791 dbSNP
rs1445803532 793 dbSNP
rs1040383406 794 dbSNP
rs1201695204 796 dbSNP
rs1269668684 799 dbSNP
rs1420680638 799 dbSNP
rs1480183865 803 dbSNP
rs1009526191 806 dbSNP
rs759252617 807 dbSNP
rs892433029 811 dbSNP
rs1487608720 815 dbSNP
rs1271657597 822 dbSNP
rs1406988639 823 dbSNP
rs1303742225 827 dbSNP
rs1344312349 829 dbSNP
rs944665126 845 dbSNP
rs924038821 851 dbSNP
rs538954934 853 dbSNP
rs7271475 854 dbSNP
rs150388711 860 dbSNP
rs367707629 863 dbSNP
rs991389229 864 dbSNP
rs1212140030 866 dbSNP
rs1293224179 870 dbSNP
rs949569695 874 dbSNP
rs1197375911 875 dbSNP
rs1296053485 877 dbSNP
rs917710771 882 dbSNP
rs1181413281 884 dbSNP
rs1338387251 884 dbSNP
rs959658862 890 dbSNP
rs928170187 895 dbSNP
rs981152058 900 dbSNP
rs62187547 910 dbSNP
rs1309343223 911 dbSNP
rs138330484 934 dbSNP
rs1004613695 937 dbSNP
rs908857601 938 dbSNP
rs1304492202 941 dbSNP
rs1291796037 949 dbSNP
rs984456535 952 dbSNP
rs1218567893 954 dbSNP
rs953450131 961 dbSNP
rs1316271164 963 dbSNP
rs1028902930 968 dbSNP
rs531004820 977 dbSNP
rs1220295142 978 dbSNP
rs1253122255 980 dbSNP
rs1463754472 984 dbSNP
rs997799445 992 dbSNP
rs951796395 994 dbSNP
rs1248771748 1003 dbSNP
rs565514899 1006 dbSNP
rs1355287815 1007 dbSNP
rs1384484316 1036 dbSNP
rs746257682 1048 dbSNP
rs1170251614 1050 dbSNP
rs965812242 1052 dbSNP
rs770491539 1059 dbSNP
rs996378319 1064 dbSNP
rs1296019655 1068 dbSNP
rs1432170656 1069 dbSNP
rs892485363 1070 dbSNP
rs1337835994 1073 dbSNP
rs900418243 1076 dbSNP
rs1200766588 1084 dbSNP
rs1054219589 1086 dbSNP
rs1019254320 1099 dbSNP
rs778899872 1100 dbSNP
rs1226791598 1102 dbSNP
rs1008913716 1103 dbSNP
rs1045316315 1104 dbSNP
rs949532052 1117 dbSNP
rs565675117 1119 dbSNP
rs902542804 1123 dbSNP
rs1042392026 1131 dbSNP
rs1188198122 1136 dbSNP
rs1262349951 1140 dbSNP
rs541866079 1141 dbSNP
rs147053895 1149 dbSNP
rs946821825 1158 dbSNP
rs559866903 1159 dbSNP
rs1315819087 1166 dbSNP
rs1264706274 1168 dbSNP
rs1405796157 1170 dbSNP
rs940446901 1172 dbSNP
rs1055302052 1175 dbSNP
rs938154160 1186 dbSNP
rs1224048836 1189 dbSNP
rs112206153 1196 dbSNP
rs982803199 1202 dbSNP
rs1381671009 1210 dbSNP
rs1299314980 1211 dbSNP
rs1293563931 1216 dbSNP
rs1325806242 1228 dbSNP
rs540240322 1230 dbSNP
rs1224340974 1239 dbSNP
rs1262825903 1240 dbSNP
rs940260555 1244 dbSNP
rs781452743 1246 dbSNP
rs141671591 1248 dbSNP
rs1261185595 1253 dbSNP
rs34621638 1253 dbSNP
rs1485519189 1254 dbSNP
rs1184748272 1257 dbSNP
rs983069715 1272 dbSNP
rs757422077 1280 dbSNP
rs1464445953 1284 dbSNP
rs1027775525 1291 dbSNP
rs974618981 1295 dbSNP
rs1346269974 1299 dbSNP
rs187583080 1310 dbSNP
rs560971035 1311 dbSNP
rs1405631403 1314 dbSNP
rs1282816257 1318 dbSNP
rs975991516 1334 dbSNP
rs1225218243 1338 dbSNP
rs7353834 1347 dbSNP
rs1018767023 1348 dbSNP
rs544371451 1359 dbSNP
rs182894805 1370 dbSNP
rs1177551965 1385 dbSNP
rs1008841776 1393 dbSNP
rs902427531 1397 dbSNP
rs1469758259 1402 dbSNP
rs1376404768 1403 dbSNP
rs1020975830 1410 dbSNP
rs1221110027 1412 dbSNP
rs1266270830 1413 dbSNP
rs1020051385 1423 dbSNP
rs558741344 1433 dbSNP
rs1409149377 1446 dbSNP
rs6131418 1448 dbSNP
rs1418926663 1453 dbSNP
rs751809554 1456 dbSNP
rs893909905 1458 dbSNP
rs1032418542 1464 dbSNP
rs1001312018 1465 dbSNP
rs1444607057 1471 dbSNP
rs1280419397 1479 dbSNP
rs905150308 1485 dbSNP
rs1456121309 1488 dbSNP
rs1055590827 1490 dbSNP
rs1317004318 1501 dbSNP
rs1244783264 1502 dbSNP
rs1024313135 1509 dbSNP
rs938098490 1514 dbSNP
rs1439098780 1521 dbSNP
rs772611152 1521 dbSNP
rs1204768720 1523 dbSNP
rs1438068652 1524 dbSNP
rs567049924 1541 dbSNP
rs1204012656 1542 dbSNP
rs1231957376 1544 dbSNP
rs1480476080 1546 dbSNP
rs906720667 1548 dbSNP
rs1387587926 1552 dbSNP
rs1254143308 1561 dbSNP
rs1445733521 1562 dbSNP
rs538526097 1568 dbSNP
rs896724007 1574 dbSNP
rs1046558180 1576 dbSNP
rs1329712043 1577 dbSNP
rs1354178891 1587 dbSNP
rs1439691118 1588 dbSNP
rs1338498922 1592 dbSNP
rs1383313694 1605 dbSNP
rs940312807 1608 dbSNP
rs940833643 1619 dbSNP
rs908763313 1620 dbSNP
rs887563545 1621 dbSNP
rs1237870841 1627 dbSNP
rs983079521 1628 dbSNP
rs1205220157 1636 dbSNP
rs1245330951 1642 dbSNP
rs1183515814 1645 dbSNP
rs34390288 1645 dbSNP
rs1308551724 1646 dbSNP
rs573106037 1654 dbSNP
rs930286475 1657 dbSNP
rs553050231 1661 dbSNP
rs536248586 1663 dbSNP
rs920368115 1667 dbSNP
rs931648225 1675 dbSNP
rs1464238956 1679 dbSNP
rs1178918136 1685 dbSNP
rs764089904 1687 dbSNP
rs147918373 1688 dbSNP
rs1332040006 1692 dbSNP
rs976422508 1694 dbSNP
rs944649326 1698 dbSNP
rs547016737 1699 dbSNP
rs1363877126 1700 dbSNP
rs964474155 1705 dbSNP
rs748632557 1713 dbSNP
rs372842740 1714 dbSNP
rs913137026 1716 dbSNP
rs1449263290 1732 dbSNP
rs1019232892 1738 dbSNP
rs1441630086 1745 dbSNP
rs987293473 1748 dbSNP
rs1254071049 1751 dbSNP
rs966620998 1752 dbSNP
rs1206838558 1761 dbSNP
rs111626666 1765 dbSNP
rs1430258309 1766 dbSNP
rs1020861016 1767 dbSNP
rs572967039 1768 dbSNP
rs771374028 1772 dbSNP
rs1032842670 1775 dbSNP
rs537183856 1779 dbSNP
rs571726416 1780 dbSNP
rs1317624946 1781 dbSNP
rs866527061 1789 dbSNP
rs1361912138 1799 dbSNP
rs1358069055 1804 dbSNP
rs1033670474 1805 dbSNP
rs551973588 1809 dbSNP
rs1344499565 1811 dbSNP
rs193254270 1817 dbSNP
rs1232939439 1818 dbSNP
rs1273416748 1821 dbSNP
rs1339088531 1826 dbSNP
rs1353357542 1830 dbSNP
rs1320611849 1832 dbSNP
rs1206229473 1841 dbSNP
rs969814434 1842 dbSNP
rs1023662702 1845 dbSNP
rs188751457 1864 dbSNP
rs1013580342 1876 dbSNP
rs1480212617 1879 dbSNP
rs143348361 1880 dbSNP
rs758482043 1894 dbSNP
rs1365310639 1896 dbSNP
rs752615152 1902 dbSNP
rs887376922 1906 dbSNP
rs1048596572 1914 dbSNP
rs1015182406 1916 dbSNP
rs1358564847 1918 dbSNP
rs1425954423 1918 dbSNP
rs1303265911 1923 dbSNP
rs1163815790 1927 dbSNP
rs765152315 1932 dbSNP
rs931568629 1939 dbSNP
rs1330546391 1940 dbSNP
rs1366501176 1955 dbSNP
rs1195013461 1956 dbSNP
rs1309103545 1958 dbSNP
rs887918095 1960 dbSNP
rs1248848488 1963 dbSNP
rs1292556733 1967 dbSNP
rs529713198 1970 dbSNP
rs1038693829 1971 dbSNP
rs149201864 1975 dbSNP
rs943145785 1979 dbSNP
rs911607525 1980 dbSNP
rs1180852571 1981 dbSNP
rs1378361949 1982 dbSNP
rs931726108 1984 dbSNP
rs987321301 1985 dbSNP
rs1490856781 1987 dbSNP
rs544299004 1991 dbSNP
rs530641430 1995 dbSNP
rs112687529 1998 dbSNP
rs1389530505 1998 dbSNP
rs762713394 2001 dbSNP
rs1426566132 2002 dbSNP
rs1188503100 2005 dbSNP
rs1447975505 2015 dbSNP
rs1250326748 2016 dbSNP
rs1384065755 2019 dbSNP
rs1189403421 2021 dbSNP
rs564894185 2026 dbSNP
rs1235779918 2027 dbSNP
rs1169224368 2036 dbSNP
rs900231969 2041 dbSNP
rs1468225547 2044 dbSNP
rs1392287813 2046 dbSNP
rs8392 2047 dbSNP
rs1280881535 2054 dbSNP
rs1227576613 2055 dbSNP
rs769654835 2057 dbSNP
rs1299570459 2060 dbSNP
rs1455038718 2062 dbSNP
rs944368233 2066 dbSNP
rs1378043002 2067 dbSNP
rs1259197422 2072 dbSNP
rs1300561995 2074 dbSNP
rs1253243541 2075 dbSNP
rs1449512650 2076 dbSNP
rs1187951436 2079 dbSNP
rs1198299009 2080 dbSNP
rs1375526444 2081 dbSNP
rs755407950 2082 dbSNP
rs6041749 2084 dbSNP
rs1392394986 2091 dbSNP
rs1171613169 2092 dbSNP
rs1242463543 2093 dbSNP
rs773117898 2098 dbSNP
rs1411973906 2099 dbSNP
rs1183826761 2101 dbSNP
rs1052927128 2102 dbSNP
rs935838301 2104 dbSNP
rs375283376 2106 dbSNP
rs772224870 2107 dbSNP
rs1482060322 2110 dbSNP
rs1276474108 2111 dbSNP
rs1337897400 2114 dbSNP
rs1471163358 2114 dbSNP
rs980327524 2115 dbSNP
rs1320729143 2116 dbSNP
rs1310054649 2119 dbSNP
rs1297775159 2120 dbSNP
rs553228856 2122 dbSNP
rs550532523 2124 dbSNP
rs1306929453 2128 dbSNP
rs755260902 2134 dbSNP
rs1256480911 2138 dbSNP
rs916646224 2141 dbSNP
rs1204079017 2142 dbSNP
rs1255296080 2155 dbSNP
rs1422899920 2159 dbSNP
rs1191432672 2172 dbSNP
rs992201376 2173 dbSNP
rs1261795152 2179 dbSNP
rs960658819 2180 dbSNP
rs145404495 2182 dbSNP
rs530800255 2182 dbSNP
rs1481594611 2187 dbSNP
rs1027846356 2192 dbSNP
rs756496309 2192 dbSNP
rs73581254 2193 dbSNP
rs1291206264 2194 dbSNP
rs776938605 2202 dbSNP
rs1275345816 2204 dbSNP
rs1196813428 2205 dbSNP
rs900283691 2207 dbSNP
rs752454371 2208 dbSNP
rs1300303227 2211 dbSNP
rs1256497160 2214 dbSNP
rs1040097127 2217 dbSNP
rs564998081 2224 dbSNP
rs1346652334 2227 dbSNP
rs537120656 2229 dbSNP
rs11712 2248 dbSNP
rs1435086993 2250 dbSNP
rs1329062398 2252 dbSNP
rs1330457373 2261 dbSNP
rs1190320929 2266 dbSNP
rs1052976810 2272 dbSNP
rs11550413 2275 dbSNP
rs1161832687 2286 dbSNP
rs1364897048 2290 dbSNP
rs529373359 2292 dbSNP
rs1296382519 2294 dbSNP
rs935958291 2297 dbSNP
rs1405763595 2300 dbSNP
rs558030239 2304 dbSNP
rs760809823 2313 dbSNP
rs1470926458 2314 dbSNP
rs573002082 2315 dbSNP
rs1172110894 2322 dbSNP
rs916670187 2323 dbSNP
rs1477081608 2327 dbSNP
rs1234875186 2328 dbSNP
rs1490387796 2330 dbSNP
rs1220373484 2332 dbSNP
rs1244629349 2334 dbSNP
rs773496036 2343 dbSNP
rs1179346765 2349 dbSNP
rs960709715 2351 dbSNP
rs183005812 2356 dbSNP
rs1157439463 2363 dbSNP
rs1387156350 2369 dbSNP
rs770618418 2379 dbSNP
rs397795937 2380 dbSNP
rs983838887 2380 dbSNP
rs566192347 2381 dbSNP
rs559491604 2382 dbSNP
rs1240647312 2383 dbSNP
rs529651885 2384 dbSNP
rs1278531291 2385 dbSNP
rs1018655649 2386 dbSNP
rs1308928924 2386 dbSNP
rs1008569706 2387 dbSNP
rs1280717298 2388 dbSNP
rs1245525023 2389 dbSNP
rs34401063 2390 dbSNP
rs756346750 2390 dbSNP
rs758498752 2390 dbSNP
rs879138498 2390 dbSNP
rs891478235 2390 dbSNP
rs77001193 2392 dbSNP
rs1052750099 2393 dbSNP
rs1463873569 2396 dbSNP
rs1338563749 2402 dbSNP
rs1375628824 2405 dbSNP
rs1000263220 2411 dbSNP
rs376131801 2411 dbSNP
rs575859500 2412 dbSNP
rs1363525530 2413 dbSNP
rs146670225 2414 dbSNP
rs1317613404 2422 dbSNP
rs948589309 2423 dbSNP
rs45473597 2424 dbSNP
rs895623307 2427 dbSNP
rs1443465773 2428 dbSNP
rs1210091172 2431 dbSNP
rs1056580937 2438 dbSNP
rs939441093 2441 dbSNP
rs1333417666 2443 dbSNP
rs1476470534 2444 dbSNP
rs1194575964 2445 dbSNP
rs1423199509 2447 dbSNP
rs45553532 2456 dbSNP
rs1412630427 2460 dbSNP
rs907945653 2462 dbSNP
rs550608954 2463 dbSNP
rs530480273 2464 dbSNP
rs190714238 2470 dbSNP
rs1346385271 2472 dbSNP
rs187106305 2474 dbSNP
rs1277124538 2475 dbSNP
rs369976663 2481 dbSNP
rs1378676132 2482 dbSNP
rs1185881613 2483 dbSNP
rs559156579 2491 dbSNP
rs1346223535 2493 dbSNP
rs1219154771 2494 dbSNP
rs542491861 2501 dbSNP
rs1483775402 2510 dbSNP
rs1448753937 2512 dbSNP
rs1217469515 2513 dbSNP
rs1262698572 2514 dbSNP
rs1019045637 2519 dbSNP
rs1487415653 2526 dbSNP
rs116729337 2527 dbSNP
rs955824951 2536 dbSNP
rs1441142647 2541 dbSNP
rs1449195702 2570 dbSNP
rs1170680104 2578 dbSNP
rs1477574810 2578 dbSNP
rs1410095606 2579 dbSNP
rs1031382497 2581 dbSNP
rs999869931 2582 dbSNP
rs904153091 2586 dbSNP
rs1406379786 2587 dbSNP
rs1323881646 2588 dbSNP
rs1344414829 2602 dbSNP
rs1233002976 2606 dbSNP
rs917790935 2610 dbSNP
rs991990932 2615 dbSNP
rs1306627466 2622 dbSNP
rs1285376442 2623 dbSNP
rs1351680599 2627 dbSNP
rs1224914166 2628 dbSNP
rs1450771175 2629 dbSNP
rs1803585 2633 dbSNP
rs116279343 2646 dbSNP
rs1158033961 2648 dbSNP
rs879207230 2654 dbSNP
rs1301978639 2661 dbSNP
rs1377943292 2664 dbSNP
rs578000764 2665 dbSNP
rs1445775446 2670 dbSNP
rs866378749 2672 dbSNP
rs1163421745 2675 dbSNP
rs1389597580 2677 dbSNP
rs895718244 2680 dbSNP
rs1321956679 2689 dbSNP
rs1379644523 2693 dbSNP
rs1448156884 2697 dbSNP
rs1057017409 2699 dbSNP
rs1346846351 2707 dbSNP
rs1298936662 2708 dbSNP
rs1266216999 2712 dbSNP
rs1355866925 2717 dbSNP
rs1274841667 2718 dbSNP
rs939826179 2720 dbSNP
rs748541864 2721 dbSNP
rs886562360 2722 dbSNP
rs1048236027 2723 dbSNP
rs930666919 2724 dbSNP
rs1413560545 2725 dbSNP
rs920560246 2726 dbSNP
rs79119937 2730 dbSNP
rs1313501285 2731 dbSNP
rs1456046502 2731 dbSNP
rs1491012395 2731 dbSNP
rs376816789 2731 dbSNP
rs547041142 2731 dbSNP
rs878978089 2731 dbSNP
rs1340006514 2734 dbSNP
rs1321933997 2738 dbSNP
rs1180427146 2748 dbSNP
rs879249241 2750 dbSNP
rs558231173 2754 dbSNP
rs542591675 2761 dbSNP
rs1280342375 2772 dbSNP
rs1318261182 2776 dbSNP
rs573858832 2780 dbSNP
rs1256036590 2788 dbSNP
rs1484178296 2796 dbSNP
rs1216792508 2797 dbSNP
rs1201018876 2815 dbSNP
rs1254857960 2823 dbSNP
rs943645675 2827 dbSNP
rs534848822 2833 dbSNP
rs912140375 2843 dbSNP
rs750597546 2861 dbSNP
rs956171550 2861 dbSNP
rs1031429403 2864 dbSNP
rs1468017137 2871 dbSNP
rs1304000423 2883 dbSNP
rs978890044 2886 dbSNP
rs6109642 2892 dbSNP
rs968431593 2898 dbSNP
rs1300223368 2904 dbSNP
rs1341397318 2905 dbSNP
rs6134735 2909 dbSNP
rs1218297601 2916 dbSNP
rs761469042 2922 dbSNP
rs1313800997 2927 dbSNP
rs1012576728 2928 dbSNP
rs1255350103 2931 dbSNP
rs895769299 2935 dbSNP
rs1226379197 2938 dbSNP
rs1263320158 2953 dbSNP
rs572575457 2953 dbSNP
rs1487743979 2957 dbSNP
rs1364041023 2964 dbSNP
rs1278748942 2980 dbSNP
rs1177354849 2984 dbSNP
rs1035602080 2986 dbSNP
rs1377580425 2986 dbSNP
rs1300083546 2987 dbSNP
rs1004051018 2988 dbSNP
rs886905685 2995 dbSNP
rs1304990125 2996 dbSNP
rs6109641 2999 dbSNP
rs1047819514 3001 dbSNP
rs776032411 3012 dbSNP
rs1296660006 3020 dbSNP
rs6109639 3027 dbSNP
rs1369383146 3035 dbSNP
rs1387154569 3045 dbSNP
rs1458621211 3051 dbSNP
rs1349490015 3052 dbSNP
rs1163167464 3058 dbSNP
rs1803586 3061 dbSNP
rs6109638 3063 dbSNP
rs899228494 3067 dbSNP
rs1039472485 3071 dbSNP
rs1062369 3074 dbSNP
rs943372503 3081 dbSNP
rs1489658274 3084 dbSNP
rs912151666 3086 dbSNP
rs1453063421 3089 dbSNP
rs112758107 3107 dbSNP
rs536131247 3114 dbSNP
rs1477092359 3115 dbSNP
rs1051933242 3123 dbSNP
rs1260455646 3124 dbSNP
rs112780650 3127 dbSNP
rs1157063901 3132 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1, repB ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACgau 5'
            :||| |||| | |||||   
Target 5' auUAAA-CAUUCU-UGCUG--- 3'
20 - 36
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000400137.4 | 3UTR | AAAUUUUUAUCUAUUAUAUAUUAAACAUUCUUGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.601 2.5e-3 0.707 2.5e-4 20 Click to see details
GSE21032 Prostate cancer 0.24 1.4e-2 0.230 1.8e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.428 3.0e-2 -0.436 2.7e-2 20 Click to see details
GSE19536 Breast cancer -0.167 4.8e-2 -0.087 1.9e-1 100 Click to see details
GSE21849 B cell lymphoma 0.305 5.4e-2 0.223 1.2e-1 29 Click to see details
GSE14794 Lymphoblastoid cells -0.168 5.7e-2 -0.153 7.5e-2 90 Click to see details
GSE28260 Renal cortex and medulla -0.429 7.2e-2 -0.330 1.4e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.366 8.2e-2 -0.379 7.4e-2 16 Click to see details
GSE32688 Pancreatic cancer 0.227 1.1e-1 0.170 1.8e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.223 1.4e-1 0.164 2.2e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.116 1.8e-1 -0.121 1.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.156 2.3e-1 -0.017 4.7e-1 25 Click to see details
GSE17498 Multiple myeloma -0.121 2.3e-1 0.001 5.0e-1 40 Click to see details
GSE28544 Breast cancer 0.153 2.4e-1 0.379 3.4e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.068 2.8e-1 0.015 4.5e-1 79 Click to see details
GSE17306 Multiple myeloma -0.051 3.6e-1 -0.070 3.2e-1 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.056 4.0e-1 -0.027 4.5e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.047 4.2e-1 -0.037 4.3e-1 23 Click to see details
GSE19350 CNS germ cell tumors -0.061 4.3e-1 0.007 4.9e-1 12 Click to see details
GSE38226 Liver fibrosis 0.022 4.6e-1 -0.214 1.8e-1 21 Click to see details
GSE38226 Liver fibrosis 0.022 4.6e-1 -0.214 1.8e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.456 0 0.427 0.01 32 Click to see details
KICH 0.457 0.01 0.514 0 25 Click to see details
KIRC 0.263 0.02 0.198 0.05 68 Click to see details
THCA 0.206 0.06 0.213 0.05 59 Click to see details
CHOL 0.5 0.09 0.417 0.13 9 Click to see details
BRCA 0.146 0.09 0.190 0.04 84 Click to see details
COAD 0.416 0.15 0.000 0.5 8 Click to see details
PCPG 0.879 0.16 1.000 0.5 3 Click to see details
ESCA 0.332 0.16 0.482 0.07 11 Click to see details
PAAD -0.621 0.19 -0.800 0.1 4 Click to see details
LUSC -0.142 0.2 -0.168 0.16 38 Click to see details
KIRP 0.152 0.2 0.195 0.14 32 Click to see details
BLCA 0.184 0.23 0.191 0.22 18 Click to see details
HNSC 0.1 0.26 0.073 0.32 42 Click to see details
LUAD -0.199 0.27 -0.014 0.48 12 Click to see details
CESC -0.615 0.29 -0.500 0.33 3 Click to see details
PRAD 0.061 0.34 0.018 0.45 50 Click to see details
UCEC -0.046 0.43 0.144 0.28 19 Click to see details
LIHC -0.011 0.47 -0.069 0.32 49 Click to see details
LIHC -0.011 0.47 -0.069 0.32 49 Click to see details
LIHC -0.011 0.47 -0.069 0.32 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*