miRTarBase - #MIRT549076 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CACUL1   
Synonyms C10orf46, CAC1
Description CDK2 associated cullin domain 1
Transcript NM_153810   
Expression
Putative miRNA Targets on CACUL1
3'UTR of CACUL1
(miRNA target sites are highlighted)
>CACUL1|NM_153810|3'UTR
   1 TGAATGTATTGAATATGCTTTCCTTCCTGAAAAGAGGACACACTGGAGCTGCAGAGACTGTATTCAGAGCACAGTGGGGG
  81 CTGCACACACTCAGGAGCTCTGTCACAAAGCTGTTCATGGAAGAGGATGTTGGACTTCTTACTTGGTTTGTAATTTTAAA
 161 ACAAAAACTAAAAAAAAAAAAAACGTTGCTGCTAGACTTGGGGGTGATTTTGAAATGGGACAATCTTTTAATGAGTTTAT
 241 CTACAGATTCTGTGAGGAAAAAGCATCTCAGAAAGTGACCATTTCTAAGTGAAATCTGACAGCCAAAATCAGCAGCTTCC
 321 TCCAAAAATATAAGAGCAGAAGAATTTTTTTTTTAAGCACTTGTTTTGTTCATTTGTGGACTTGGCATTTTGGTGTATTG
 401 GTTTCACATGTCAGGATCTCTTTTGCTTTAAAACCAAGCAGATCATTACAGTACAGTATTTTTCACCCACAACCAAAACA
 481 ACCCCTTTTAAAAGAGTTGGTCTTTGTTTAGCATTAGAAAGTCTTGTTAAAGGAAAATGCTAACTCTGCTTTTGCTAGAA
 561 CTTTCCCCCATCAGTTCACAACTTTCTTCTACTCTGTGCCTTGAGCTTTGTGCACTTTGCAACTGTGTGACCATGTTGTC
 641 AAACTCCTCCTGGAGAAGTGTATGGTATCTAAACTCACCCACCAAGATGGCAGGTGTGGCCCTGTAGCAGGATGCTAATT
 721 AAGTGGGAAAATAGAAACCTTTTGCACATGGGTCGGATTTTCCCCTGGTTCACCAGAGCATATTCATATTAATGTTGGGG
 801 ACCAACTCTCCTAGAGCATTTCCATTCCCTGTGCCACTTAACACGATGTCTGTCACCAGCTGCTATAGTATTGGCAGTAC
 881 TCTAGTTTAGGGATGGGCGGTACTTTAGCACGGAAGCTTCCCTTAGTATTATTGAGAGCTACTTCCTGCGATGCTCTAGG
 961 AAGCAGATACAGTTATTAAGTCCAAATACACAGTGGTGTGGGGTTCCTGATCACTTCATTTTAAATGAATGAGATAATTA
1041 CTTAAAAAAAGTCTGTCATTTGAACATTATATTTGAGTGTGATAGGGAAGAAGTAGCACTGCTGTCCTAAGGCTCCCTTC
1121 CAGCTGTGGCAAAGCTATATTTCTGTTTCTCCACATCCACAGTGCTTTTTAGTCCATCATAAAAGTTTCTGAAGCTTATT
1201 CTAGCTGTTGTTGAAAGCCCAAGAAAAATAGATGTGGCAAGAGAAAAATACTTTTCTTCTCAATTTTGCTTGAATCTTAA
1281 TTGAGCATAGGCTTCTCTACTAGGCAACATCAGACTAATAGTATTTACCTCTTCAGAGAACTTGAGGGGAAAAGAAACAT
1361 CCCAGGGATGCTGTCGCATGTCTGCTCTGCAGGTTCTTCATACAGCTGCCTCTGCCAATTCAGTTTATTTTTTGGGGGGA
1441 GTGGTGTGGGTGGGAGAGTTAGAAGTGGGATATTGGGAGCAAGTAAGTCACCCAATAATTGAAGTCCTTGATTTGTAAAA
1521 CTGTTATACAGAGAAGTAAAGATAAAGGTTGTCAGATTTATTTTTTAAAGTACTTAACCAGAGTTCGTGGATTTTGTGGA
1601 CTTTAATTGGACTCAATTCACTCTGTGAGCATCCTGGATTGCATCGATGAACACTGAATTACTGTAAGAACATAGACAGG
1681 CTCTCACTATGACCTGGACAGTTTAAGTTGCTACACTGGTAACATTCTAGTATCAAGGAGAATTCCATTCATCATGACAT
1761 TCACATTTTACTTTTCTCAATGGAATGCTTGCTTCAGGCTTACCAATCACACCTAGAACTGAAGTCTGAGTGAGTGGTAT
1841 TAATAATTTTTCTGAAAGGAATAAAATTGGAATGTTTCTAAATGTGGAGAAATTCTTCAGTATCCTAATAATATACCCAA
1921 ATGCTTTTTCTGGGAGAGAGCATTCTTTTACAAAAGAACTTTCCCTATAAAAGCATCACAGTATAATGTGAATTGGCATT
2001 AAAATCTTTGGATGCTTTTGCATTATTAAGTTCATGGAGAAATATATTCTTTTTACTATGTATGTATTAATAAAAAGTGG
2081 GCAAAGTAAAGTTTGCAAAATTTAGTTTCTCTAAATTTTTGCACAGTGACTGCAGCTGGCTATGGGTCAGCTCTTAATAC
2161 AACAAAACCTTGACTGGAAGTCACTATAGAAAGGTTGTACATAGTCTCCCAGTCTACATGTCCTGGCTGTTAATCATCTT
2241 GGCCCCTTGAGGCACATCACAGTTTGAAGGACCTGTTTAAGTTGAAATAGACTTTGCTTATTTATTGGGATTCTAAAAAA
2321 TTCTGAGTGAGTTTGCAGTATGAGAGGAAATAAGATTTCCTCCTCCTTCCTCTCATTTTATATTGACTGTTTGCCAGAAA
2401 CTGTTTTCTTCTGTTTTCTTATATTTTGTTTTTGAGATGGAGTCTCACTCTCTCACCCAGGCTGGAGTGCAGTGGTGCAA
2481 TCTCAGCTCACTGCAACCTCTGCCTCCTGGGTTCAAGTGATTCTCCTGCCTCGGCCTCCTGAGTAGCTGGAATTACAGGC
2561 ACGTGCCACTACGCCCGGCTACTTTTTGTATTTTGTTTTTAGTAGAGACGGGGTTTCACCATGTTGGTCAGGCTGGTCTT
2641 GAACTCCTGACCTCAAGTGATCCACCCACCTCGGCCTCCCAAAGTGCTGGGATTATAGGTGTGAGCCACTGCACCTGGCC
2721 TTTTTTTTTTTTTTTTTTGTATTCTTGCCAGTACAGTATATGGTTTTTCTACCCCAATTACATACTGGGTTTTGTACCAC
2801 ATCACTAAAGGCCCAAATCATTGAAGATACAAAACCGTACATGCAGGCTGGTTGTCTGGTTAGTCAATGGCTGATTTGCT
2881 TCAACTGTCTAGTATGTATGTGCAGCCTGAAACTGGCTCCTTAAAAGGAAAGCCGGGTCAGTCATCTTGAAAAAATGACA
2961 TGTAAAAGTAAATCGATAATTGTTTTGAGAGACGGTACATGTTTTAAAGGTTGGCCTTAAGCTTCAGTAACATTGTCATT
3041 TTGTGACCTTTTGTTGTCACACCTGTACCCTAACCTGACAGGAATTAACTACTGTTTTTTTGTGGGGCAGAAAGCAAAAC
3121 CTGGTGTTGTGACTTTTATCCTAATGGTTCTTAGGCAAGGTTAGTGAGAAGAAACACAAACCCAGATGCATGCATTGTGC
3201 ATTATTTTGTAGACAAGCTACTTTTTCTTCTGTCCCTTTAACAAATTTGCAGCAATTACCCTCCCTTTGGGGTCTAGAGT
3281 GAAAGCTAATTTGTGGGTAGATGAGATTGCAGAAGAATGGATGTCCATGGCTGTGAACACTGCACACTGCACATCCATCT
3361 CCAGTGCTCACACTGTGCAGCTACCACTCCCTGGCTGCGTGCCATGCTGTCGGGTTGCAGATTTGCACACATAAATTCCT
3441 CAGGAAGAGTTTGCATGAGCATCACCTCGCAATATTCTGTACTGACCAAACAAGGGATTTGAACGTTTTTCAGCACAAAA
3521 GGATAACTTCCGAGTGGTGGTCTGTACGCATACTAGCAAAGGTAATGGTGATCTAGCAAACAAAATTGGTTTCTGCAGTT
3601 AGAAGTGAGCAGGAGCACTTGTATTATAGTATTTAAATAATCCTGGTTAATCTCTTTTTAAGCCGAGTAACCCCTCCAGA
3681 TTTTGCCTTTTTATTATTGAGGCTGGCTTTATTTTCTTCTACTTTTTTTCCCGTTTTATAGCAGTTAATTATTTTTGTGA
3761 TTATTATGCAAGAAGCATTGCCCTTGAGTTAAACTGTTATTGTTTCATAAGCAGCTATTAAAATAACTGAGCATTGTTTT
3841 ATGAACATACACTAATCTGAGATACTGAAAAGCTTTGCAACTAAAAAGCAAAACAACCTACATTAGTCATCTAGCCATTG
3921 TTTGGATGTTTTGAGTTGATTTTTTATGGTGCCTCTTTTAGCTTGGAATATTACGTTTACTTTAATCCAAGTCTAGGCCT
4001 TTTAAAGGGTCCTTAAAATTAAAGTTCAGAATGTGAATCCCTTTGACATCTATTACAGGTTTATAGGACCTTTTTGGTTG
4081 TGATTACTGTTTTCAATACGATTGTATAAATGAAGTTAACTTTGTCAGAAGTTAAAATGGAGGTCATAGGAGTTCCTGGA
4161 GAAATGGCTCTCCTGTTTCTTTCATTACCCCACTGAAGTTCACCCCAGTTTCTGGCCACAAGAATATGAGAAAGGAACCC
4241 TGTTGTTTTCCAAGGGAAATCATTCCTCTCTGTCCCCACTGTTGATTAACTAAAGTCCTGGACACCTTCCTTCCTCCACT
4321 GGCCAAGACCCACCTTGACCCACCTTGAACCTCTTTTCAGAGCCGAGTGGCATGAATATGTGTACTGTTTCTGCTTCTGT
4401 TGATGGAGTGGCTGTGGGAGAATTAAAGGAAATGCTAATTTGAGCTTCATTCATAGGGGAACCTACTATATATTGCATCC
4481 CTGCTGGTTGGAAATTATCTTCATCTCTGGACTGCATTGTTTAGAAAAATGTTAATGGCTTACAATTCTGAGAACTTTAT
4561 TGTGTGGCTCTGGGGTTAAGAATTCTGTGGTTTGAAAAAAAATAAATATTTTGTATTGATTCTCACGTCATTTCAATGTT
4641 GTGACTATGTACTAAATGCACTAAGACTGGGTATTCTCTTAGAAGAGTGCGTTTTGTTAAACAGATGGCAGTTCACTCTC
4721 ATTAGTTCTATTTGTCAATATTACAGCCACACACTTCAGGATAACTTACTCAAATGTGAAGTCATGGGAAGCTATGGCTA
4801 GTAACAGGAATGCTTATGAAAAATTTGGAGGGCAAGCACGAGCAAGAGGCTTTTGCCACTCACTAGCACAGCCAGAGCAA
4881 GGATGAAGCAATGAAGTCTTGTTCCTAGTGGTGCTTGTATGTCAGAAGCCATAGTGAGCTCAGCACAGGGCGTTCTGCAC
4961 ATCATCTCTTTAATCCAAGAAAAACAAAATGGCGGATGAAACTCCTATTGACCTGGGATACAAAGCCACTGACTTTGGCT
5041 CTTGATCTTTTGGTGGGTTCTGAATCACTCCTTCTGTATTAGGGCATATACTTTCACTCTAAAACATTGTGGTAAATGAA
5121 ATAAATCTTGTACAGATGTCGTTGGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ||| |:|    ||||||| 
Target 5' aaaAAAACGT----TGCTGCTa 3'
177 - 194 149.00 -10.70
2
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ||::|| | |||| || 
Target 5' tgtgtACTGTT-TCTGCTTCTg 3'
4379 - 4399 124.00 -7.70
3
miRNA  3' gugUUUG-GUAAUA-C-ACGACGAu 5'
             ||:| :||| | | ||:||:| 
Target 5' ctgAAGCTTATTCTAGCTGTTGTTg 3'
1189 - 1213 123.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30172494 22 COSMIC
COSN30477711 26 COSMIC
COSN26649342 39 COSMIC
COSN20076965 60 COSMIC
COSN10060793 84 COSMIC
COSN31528352 84 COSMIC
COSN30145931 86 COSMIC
COSN28813649 168 COSMIC
COSN32061965 169 COSMIC
COSN1113215 170 COSMIC
COSN31514865 170 COSMIC
COSN28890157 264 COSMIC
COSN29101371 345 COSMIC
COSN8919401 483 COSMIC
COSN28650629 760 COSMIC
COSN6475876 1048 COSMIC
COSN17076151 1716 COSMIC
COSN30160506 1808 COSMIC
COSN505899 2015 COSMIC
COSN10060792 2369 COSMIC
COSN5816557 2448 COSMIC
COSN27390488 2739 COSMIC
COSN17475631 2758 COSMIC
COSN29101392 2974 COSMIC
COSN26590877 3270 COSMIC
COSN31563262 3366 COSMIC
COSN31541496 3391 COSMIC
COSN31531657 3394 COSMIC
COSN31522791 3427 COSMIC
COSN31546786 3521 COSMIC
COSN31479825 3529 COSMIC
COSN26504595 3544 COSMIC
COSN31544480 3547 COSMIC
COSN17681915 4292 COSMIC
COSN10060791 4579 COSMIC
COSN32063706 4678 COSMIC
COSN29653090 6050 COSMIC
COSN18824055 6071 COSMIC
COSN1113214 6519 COSMIC
COSN14825168 6762 COSMIC
COSN5247669 7397 COSMIC
COSN25659908 7755 COSMIC
COSN2515324 7892 COSMIC
COSN15551370 8043 COSMIC
COSN6058506 8201 COSMIC
COSN16460761 8303 COSMIC
COSN7064324 8345 COSMIC
COSN16607738 8493 COSMIC
COSN15436807 8628 COSMIC
COSN6943403 9217 COSMIC
COSN6943402 9709 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756869387 5 dbSNP
rs749094929 9 dbSNP
rs775198098 10 dbSNP
rs567892031 13 dbSNP
rs1484176149 15 dbSNP
rs896579147 17 dbSNP
rs1231010098 23 dbSNP
rs746674867 46 dbSNP
rs1429570681 69 dbSNP
rs1241268624 71 dbSNP
rs548028402 77 dbSNP
rs1464593375 78 dbSNP
rs1207098510 79 dbSNP
rs1245232389 81 dbSNP
rs1483425174 83 dbSNP
rs1181084226 85 dbSNP
rs527355151 89 dbSNP
rs1480331218 90 dbSNP
rs1159183560 91 dbSNP
rs1410649161 122 dbSNP
rs1455289295 125 dbSNP
rs1245382506 129 dbSNP
rs1338251049 145 dbSNP
rs1184412871 156 dbSNP
rs1438968992 157 dbSNP
rs902331962 158 dbSNP
rs1272841665 162 dbSNP
rs1302698903 163 dbSNP
rs1377604482 168 dbSNP
rs1196851089 169 dbSNP
rs1289028953 170 dbSNP
rs1325700860 171 dbSNP
rs1226672351 172 dbSNP
rs1313005215 174 dbSNP
rs571259848 179 dbSNP
rs996814780 181 dbSNP
rs964878380 182 dbSNP
rs1021740024 184 dbSNP
rs1043672646 184 dbSNP
rs1177972217 184 dbSNP
rs1182860969 184 dbSNP
rs572173441 184 dbSNP
rs1010649614 185 dbSNP
rs1175768639 185 dbSNP
rs1357823212 186 dbSNP
rs551319421 189 dbSNP
rs781393007 189 dbSNP
rs1309113662 191 dbSNP
rs946641609 192 dbSNP
rs911110400 194 dbSNP
rs985130968 195 dbSNP
rs1052580349 200 dbSNP
rs1223177368 202 dbSNP
rs1218914887 204 dbSNP
rs1044109180 205 dbSNP
rs1276206708 205 dbSNP
rs1343847594 212 dbSNP
rs1205639220 225 dbSNP
rs1281125004 229 dbSNP
rs1442654338 232 dbSNP
rs1482070827 232 dbSNP
rs1246834992 236 dbSNP
rs531248935 240 dbSNP
rs1335097562 241 dbSNP
rs763692114 242 dbSNP
rs1433182365 257 dbSNP
rs143022682 263 dbSNP
rs1326703162 265 dbSNP
rs922382382 271 dbSNP
rs972465846 275 dbSNP
rs1454138252 279 dbSNP
rs372821653 280 dbSNP
rs1431949004 288 dbSNP
rs1406123538 290 dbSNP
rs755159581 300 dbSNP
rs577313624 302 dbSNP
rs1467962633 304 dbSNP
rs542542851 313 dbSNP
rs759920622 330 dbSNP
rs1305013539 339 dbSNP
rs529040139 341 dbSNP
rs867320865 342 dbSNP
rs879462851 354 dbSNP
rs1037543535 355 dbSNP
rs566718256 355 dbSNP
rs752027096 363 dbSNP
rs141989475 365 dbSNP
rs1224681235 368 dbSNP
rs540040909 368 dbSNP
rs952406070 374 dbSNP
rs1218755657 384 dbSNP
rs1177275934 385 dbSNP
rs572461642 387 dbSNP
rs1243880048 392 dbSNP
rs565275934 393 dbSNP
rs954757070 394 dbSNP
rs1448175097 407 dbSNP
rs762489601 412 dbSNP
rs923253276 415 dbSNP
rs796356942 416 dbSNP
rs1035095903 428 dbSNP
rs999999581 429 dbSNP
rs147568321 434 dbSNP
rs1404782145 442 dbSNP
rs964928316 455 dbSNP
rs1347168718 458 dbSNP
rs775402042 461 dbSNP
rs1349620474 466 dbSNP
rs1021792324 468 dbSNP
rs1247922804 472 dbSNP
rs1043962199 485 dbSNP
rs1355559407 487 dbSNP
rs1383408826 489 dbSNP
rs1335580977 493 dbSNP
rs1226109448 502 dbSNP
rs765215313 511 dbSNP
rs889707761 512 dbSNP
rs1207763062 516 dbSNP
rs529999102 521 dbSNP
rs1049669129 524 dbSNP
rs1011707878 526 dbSNP
rs75064628 532 dbSNP
rs1463787638 537 dbSNP
rs933674435 540 dbSNP
rs1190067602 544 dbSNP
rs559228458 550 dbSNP
rs147001392 560 dbSNP
rs1036677727 564 dbSNP
rs1161511193 566 dbSNP
rs369347908 573 dbSNP
rs1157211556 575 dbSNP
rs759482273 577 dbSNP
rs1158638928 592 dbSNP
rs985367970 594 dbSNP
rs1386740590 622 dbSNP
rs1397489211 640 dbSNP
rs556877728 642 dbSNP
rs1339792999 652 dbSNP
rs536910293 659 dbSNP
rs952244252 664 dbSNP
rs1280759198 665 dbSNP
rs916862867 666 dbSNP
rs1227269441 678 dbSNP
rs61863911 682 dbSNP
rs960718367 687 dbSNP
rs1011882220 694 dbSNP
rs1035001646 696 dbSNP
rs895073620 701 dbSNP
rs999501251 702 dbSNP
rs1185995769 705 dbSNP
rs1254623954 717 dbSNP
rs1448848225 718 dbSNP
rs1244080336 721 dbSNP
rs1037596921 725 dbSNP
rs1410024028 728 dbSNP
rs1467824429 728 dbSNP
rs554362824 729 dbSNP
rs907683079 734 dbSNP
rs1412579951 736 dbSNP
rs1309727008 738 dbSNP
rs1022337725 739 dbSNP
rs1446605421 743 dbSNP
rs747242435 744 dbSNP
rs1047837362 747 dbSNP
rs181576021 754 dbSNP
rs189601726 755 dbSNP
rs4443992 760 dbSNP
rs748266813 764 dbSNP
rs1199104309 766 dbSNP
rs1314223258 771 dbSNP
rs1226140634 775 dbSNP
rs1483705144 776 dbSNP
rs1363404822 782 dbSNP
rs1204504490 788 dbSNP
rs774686893 789 dbSNP
rs964647865 797 dbSNP
rs537827350 799 dbSNP
rs768592005 800 dbSNP
rs1476885816 802 dbSNP
rs1343062990 805 dbSNP
rs568795932 829 dbSNP
rs564612578 831 dbSNP
rs939664781 844 dbSNP
rs909663204 845 dbSNP
rs1048136279 846 dbSNP
rs990336018 848 dbSNP
rs548589905 850 dbSNP
rs1386865058 863 dbSNP
rs1300094792 867 dbSNP
rs1426870822 868 dbSNP
rs1232543799 869 dbSNP
rs749448073 873 dbSNP
rs1343467320 886 dbSNP
rs1205128374 889 dbSNP
rs1032241380 891 dbSNP
rs555475477 891 dbSNP
rs977900434 893 dbSNP
rs916728509 896 dbSNP
rs970887919 898 dbSNP
rs145542096 899 dbSNP
rs1421791022 906 dbSNP
rs1011934714 911 dbSNP
rs1475241362 912 dbSNP
rs894792228 916 dbSNP
rs868770373 918 dbSNP
rs928184187 925 dbSNP
rs184830722 927 dbSNP
rs149732075 928 dbSNP
rs978499227 932 dbSNP
rs1219337868 941 dbSNP
rs1006539113 945 dbSNP
rs1322936180 948 dbSNP
rs181839954 949 dbSNP
rs966732022 950 dbSNP
rs565356357 955 dbSNP
rs139302985 962 dbSNP
rs151282501 967 dbSNP
rs1245606722 971 dbSNP
rs1264999549 972 dbSNP
rs746383251 972 dbSNP
rs954089044 976 dbSNP
rs781372116 981 dbSNP
rs1332934159 982 dbSNP
rs1210776670 990 dbSNP
rs1028175740 995 dbSNP
rs76461536 998 dbSNP
rs543048029 1003 dbSNP
rs1284738097 1017 dbSNP
rs901931476 1018 dbSNP
rs1163433735 1019 dbSNP
rs1366244602 1025 dbSNP
rs574185824 1029 dbSNP
rs1458388736 1033 dbSNP
rs1159381519 1036 dbSNP
rs1387470615 1038 dbSNP
rs535461033 1041 dbSNP
rs574346040 1046 dbSNP
rs1287559376 1048 dbSNP
rs943391997 1051 dbSNP
rs1407168145 1053 dbSNP
rs901092972 1062 dbSNP
rs1346498022 1064 dbSNP
rs879602774 1066 dbSNP
rs1230314715 1079 dbSNP
rs1236224002 1081 dbSNP
rs1456881804 1085 dbSNP
rs1268925492 1093 dbSNP
rs1328825566 1106 dbSNP
rs1345220005 1109 dbSNP
rs11198561 1120 dbSNP
rs1171230565 1121 dbSNP
rs1254024602 1122 dbSNP
rs542302841 1143 dbSNP
rs1182275012 1145 dbSNP
rs1409393527 1145 dbSNP
rs1421788108 1149 dbSNP
rs534400380 1156 dbSNP
rs1455372682 1161 dbSNP
rs1157350834 1164 dbSNP
rs189245713 1169 dbSNP
rs1048640988 1170 dbSNP
rs1302716850 1177 dbSNP
rs948490690 1194 dbSNP
rs1411731309 1205 dbSNP
rs1289128479 1207 dbSNP
rs752394399 1233 dbSNP
rs1222320053 1234 dbSNP
rs557819361 1235 dbSNP
rs766997978 1240 dbSNP
rs774304284 1241 dbSNP
rs939482305 1244 dbSNP
rs1278017518 1245 dbSNP
rs777783234 1245 dbSNP
rs1205242652 1251 dbSNP
rs1484034030 1251 dbSNP
rs1250498117 1252 dbSNP
rs1468257840 1255 dbSNP
rs34468297 1256 dbSNP
rs971562424 1260 dbSNP
rs373349945 1272 dbSNP
rs1425445145 1274 dbSNP
rs1203223304 1281 dbSNP
rs1434055947 1282 dbSNP
rs928243981 1291 dbSNP
rs978358466 1296 dbSNP
rs537510325 1297 dbSNP
rs868701228 1299 dbSNP
rs1308681160 1307 dbSNP
rs1369979476 1308 dbSNP
rs373476175 1309 dbSNP
rs759110532 1313 dbSNP
rs548528049 1315 dbSNP
rs1264648055 1316 dbSNP
rs1440141946 1325 dbSNP
rs915265037 1331 dbSNP
rs1322374396 1337 dbSNP
rs1276773919 1339 dbSNP
rs989859634 1348 dbSNP
rs369864912 1349 dbSNP
rs1344203401 1358 dbSNP
rs752143189 1360 dbSNP
rs1299196273 1363 dbSNP
rs140008813 1376 dbSNP
rs1223130134 1377 dbSNP
rs965200953 1390 dbSNP
rs886356793 1391 dbSNP
rs1487984972 1393 dbSNP
rs1178654982 1413 dbSNP
rs1393699662 1414 dbSNP
rs1026196477 1415 dbSNP
rs1470460442 1416 dbSNP
rs1169728074 1418 dbSNP
rs146064277 1422 dbSNP
rs1408214994 1427 dbSNP
rs1325690270 1433 dbSNP
rs184288147 1434 dbSNP
rs775284880 1434 dbSNP
rs1323612146 1435 dbSNP
rs1039116436 1439 dbSNP
rs943441359 1440 dbSNP
rs1296693426 1441 dbSNP
rs1420591189 1442 dbSNP
rs1229521040 1444 dbSNP
rs888336064 1450 dbSNP
rs1251177264 1466 dbSNP
rs1176507978 1473 dbSNP
rs570517763 1475 dbSNP
rs1211390543 1477 dbSNP
rs1026662763 1482 dbSNP
rs1012500654 1483 dbSNP
rs1189617367 1491 dbSNP
rs369487189 1493 dbSNP
rs1056806076 1495 dbSNP
rs764729218 1504 dbSNP
rs1165058447 1518 dbSNP
rs1414680529 1523 dbSNP
rs147423773 1525 dbSNP
rs3839936 1525 dbSNP
rs1054381653 1527 dbSNP
rs939554878 1529 dbSNP
rs17097962 1550 dbSNP
rs1319705753 1552 dbSNP
rs1324592966 1562 dbSNP
rs981695817 1566 dbSNP
rs1284740582 1570 dbSNP
rs1377746298 1570 dbSNP
rs192718243 1573 dbSNP
rs950290945 1576 dbSNP
rs188241494 1583 dbSNP
rs1327645299 1586 dbSNP
rs372592747 1587 dbSNP
rs908923669 1590 dbSNP
rs1190178259 1591 dbSNP
rs1238581963 1592 dbSNP
rs543037396 1595 dbSNP
rs984869979 1606 dbSNP
rs1185979346 1607 dbSNP
rs139759560 1616 dbSNP
rs1458007386 1619 dbSNP
rs1026668139 1621 dbSNP
rs1382461610 1623 dbSNP
rs1415982351 1629 dbSNP
rs1334670225 1631 dbSNP
rs1374779680 1633 dbSNP
rs1412382176 1634 dbSNP
rs932638737 1641 dbSNP
rs560745848 1645 dbSNP
rs976821665 1646 dbSNP
rs965230114 1647 dbSNP
rs997424258 1664 dbSNP
rs1348928476 1672 dbSNP
rs766061810 1674 dbSNP
rs1279943366 1680 dbSNP
rs1485662919 1680 dbSNP
rs866587356 1685 dbSNP
rs1208785073 1687 dbSNP
rs1254117188 1694 dbSNP
rs982991431 1700 dbSNP
rs1301262409 1704 dbSNP
rs1455179410 1708 dbSNP
rs1017381475 1713 dbSNP
rs540604474 1715 dbSNP
rs565835065 1716 dbSNP
rs1364202258 1719 dbSNP
rs1309283863 1725 dbSNP
rs1007635464 1727 dbSNP
rs572730214 1730 dbSNP
rs1332470371 1732 dbSNP
rs952665041 1734 dbSNP
rs1054518457 1741 dbSNP
rs1347746987 1743 dbSNP
rs1232691005 1748 dbSNP
rs1277423447 1753 dbSNP
rs999281659 1754 dbSNP
rs1157802294 1757 dbSNP
rs1453600781 1780 dbSNP
rs760562261 1781 dbSNP
rs554513967 1783 dbSNP
rs1394294657 1786 dbSNP
rs1012576360 1793 dbSNP
rs1452380072 1794 dbSNP
rs1387009666 1795 dbSNP
rs1390728520 1796 dbSNP
rs1315668804 1801 dbSNP
rs1460987271 1802 dbSNP
rs958356574 1806 dbSNP
rs752643804 1810 dbSNP
rs1443429190 1811 dbSNP
rs1035431652 1814 dbSNP
rs1002598046 1819 dbSNP
rs1392402653 1822 dbSNP
rs1387030126 1824 dbSNP
rs117768487 1828 dbSNP
rs768983852 1830 dbSNP
rs1485978861 1837 dbSNP
rs774769981 1837 dbSNP
rs138358354 1848 dbSNP
rs916121604 1867 dbSNP
rs1226768588 1871 dbSNP
rs1055976449 1884 dbSNP
rs1358699209 1890 dbSNP
rs144784285 1906 dbSNP
rs908974381 1914 dbSNP
rs769937297 1926 dbSNP
rs374932930 1936 dbSNP
rs1190281118 1941 dbSNP
rs1248568726 1952 dbSNP
rs1427895960 1955 dbSNP
rs1010109910 1960 dbSNP
rs1190355839 1964 dbSNP
rs1352162535 1973 dbSNP
rs894099703 1993 dbSNP
rs984533317 2006 dbSNP
rs1457986509 2007 dbSNP
rs372244114 2032 dbSNP
rs950458770 2033 dbSNP
rs918914541 2045 dbSNP
rs1323038423 2048 dbSNP
rs934574146 2048 dbSNP
rs185322112 2058 dbSNP
rs545584720 2060 dbSNP
rs766919076 2062 dbSNP
rs944147185 2063 dbSNP
rs1385926658 2064 dbSNP
rs1342295924 2068 dbSNP
rs1297425130 2069 dbSNP
rs1233996814 2072 dbSNP
rs578230226 2074 dbSNP
rs1417560752 2076 dbSNP
rs1333056392 2077 dbSNP
rs574984023 2078 dbSNP
rs555089926 2086 dbSNP
rs866274314 2088 dbSNP
rs1017433917 2095 dbSNP
rs1007362116 2098 dbSNP
rs1184655274 2104 dbSNP
rs749537889 2108 dbSNP
rs535057496 2121 dbSNP
rs1367397737 2133 dbSNP
rs149414840 2142 dbSNP
rs952650757 2145 dbSNP
rs998938901 2147 dbSNP
rs775646798 2157 dbSNP
rs1473397621 2158 dbSNP
rs200780815 2165 dbSNP
rs991351903 2185 dbSNP
rs1045729337 2186 dbSNP
rs1014224937 2192 dbSNP
rs1287576487 2198 dbSNP
rs1428819790 2201 dbSNP
rs552948751 2202 dbSNP
rs1261940296 2214 dbSNP
rs1404993679 2216 dbSNP
rs1415474893 2220 dbSNP
rs79331901 2229 dbSNP
rs1056028175 2233 dbSNP
rs1487482132 2236 dbSNP
rs941527159 2238 dbSNP
rs770027049 2244 dbSNP
rs1316052786 2246 dbSNP
rs1213388620 2247 dbSNP
rs1257684341 2252 dbSNP
rs556514779 2253 dbSNP
rs1356230551 2257 dbSNP
rs368014260 2271 dbSNP
rs1020451022 2278 dbSNP
rs538327794 2279 dbSNP
rs1182391615 2287 dbSNP
rs1406813894 2288 dbSNP
rs929060051 2296 dbSNP
rs1157469722 2298 dbSNP
rs1327253654 2301 dbSNP
rs567701678 2307 dbSNP
rs975721483 2326 dbSNP
rs1312833223 2327 dbSNP
rs570729544 2330 dbSNP
rs1347207092 2332 dbSNP
rs1303511595 2333 dbSNP
rs910489312 2333 dbSNP
rs1298893499 2335 dbSNP
rs1372956386 2342 dbSNP
rs1221845726 2350 dbSNP
rs985994738 2354 dbSNP
rs1388487062 2360 dbSNP
rs748361450 2366 dbSNP
rs1233424326 2368 dbSNP
rs570080705 2372 dbSNP
rs1422495482 2375 dbSNP
rs757556766 2376 dbSNP
rs1481194348 2378 dbSNP
rs967492279 2384 dbSNP
rs1271557226 2387 dbSNP
rs1200008293 2394 dbSNP
rs1479490043 2395 dbSNP
rs1451603675 2396 dbSNP
rs572977683 2401 dbSNP
rs1454995940 2405 dbSNP
rs1173496548 2406 dbSNP
rs1197642937 2413 dbSNP
rs533943673 2421 dbSNP
rs997117659 2421 dbSNP
rs894455759 2423 dbSNP
rs1034622450 2428 dbSNP
rs1005792221 2433 dbSNP
rs565606827 2433 dbSNP
rs1295537289 2436 dbSNP
rs138431467 2440 dbSNP
rs1047224153 2442 dbSNP
rs192015350 2446 dbSNP
rs1344318633 2448 dbSNP
rs930095558 2451 dbSNP
rs1041071993 2452 dbSNP
rs1305285925 2456 dbSNP
rs1223241768 2465 dbSNP
rs943995584 2469 dbSNP
rs1169436313 2470 dbSNP
rs1330757793 2471 dbSNP
rs1391491222 2472 dbSNP
rs1398965291 2480 dbSNP
rs1251664520 2482 dbSNP
rs1476701973 2489 dbSNP
rs569371001 2496 dbSNP
rs1418845014 2504 dbSNP
rs897579759 2506 dbSNP
rs1167297672 2516 dbSNP
rs150107095 2532 dbSNP
rs1460727965 2533 dbSNP
rs1323716673 2539 dbSNP
rs1367246747 2540 dbSNP
rs1431448632 2542 dbSNP
rs944400650 2550 dbSNP
rs910206272 2553 dbSNP
rs1229540175 2558 dbSNP
rs1173531165 2559 dbSNP
rs1333775280 2562 dbSNP
rs1047581626 2563 dbSNP
rs931189624 2571 dbSNP
rs1376454264 2572 dbSNP
rs919741185 2573 dbSNP
rs1474430050 2575 dbSNP
rs1190240001 2576 dbSNP
rs187856807 2577 dbSNP
rs967589211 2578 dbSNP
rs1162495189 2583 dbSNP
rs1458590051 2587 dbSNP
rs1024410741 2592 dbSNP
rs958623436 2609 dbSNP
rs1196826438 2610 dbSNP
rs1462831807 2613 dbSNP
rs1343429062 2620 dbSNP
rs1279529997 2621 dbSNP
rs1293425228 2628 dbSNP
rs928516577 2629 dbSNP
rs981170233 2630 dbSNP
rs1218456075 2637 dbSNP
rs1289858234 2644 dbSNP
rs992892772 2648 dbSNP
rs1224691565 2655 dbSNP
rs1342568146 2659 dbSNP
rs1284177839 2661 dbSNP
rs967443544 2665 dbSNP
rs1445834942 2667 dbSNP
rs1239738702 2669 dbSNP
rs1258372432 2670 dbSNP
rs183355801 2672 dbSNP
rs1186000009 2673 dbSNP
rs1365760284 2684 dbSNP
rs1157837278 2691 dbSNP
rs200891061 2696 dbSNP
rs990289996 2699 dbSNP
rs1405670408 2703 dbSNP
rs1328770182 2711 dbSNP
rs1313440404 2712 dbSNP
rs1043484598 2713 dbSNP
rs1424686605 2719 dbSNP
rs867263860 2720 dbSNP
rs1032523201 2721 dbSNP
rs1412400065 2721 dbSNP
rs397814851 2721 dbSNP
rs1240195576 2723 dbSNP
rs1336051665 2723 dbSNP
rs1333035379 2726 dbSNP
rs1412370808 2738 dbSNP
rs1237097408 2739 dbSNP
rs1279392809 2739 dbSNP
rs1281677223 2739 dbSNP
rs1349127753 2739 dbSNP
rs200313317 2739 dbSNP
rs34473974 2739 dbSNP
rs1432324450 2740 dbSNP
rs1169204143 2741 dbSNP
rs1489112178 2741 dbSNP
rs943379565 2744 dbSNP
rs1326485331 2747 dbSNP
rs1375088299 2748 dbSNP
rs1400579481 2748 dbSNP
rs1443567249 2749 dbSNP
rs1160645670 2754 dbSNP
rs1440922441 2755 dbSNP
rs17662895 2758 dbSNP
rs996981771 2762 dbSNP
rs1176876464 2768 dbSNP
rs1195394682 2769 dbSNP
rs1271163094 2773 dbSNP
rs958721772 2782 dbSNP
rs1194103006 2788 dbSNP
rs900085633 2789 dbSNP
rs1238304743 2791 dbSNP
rs1194662502 2794 dbSNP
rs190756817 2800 dbSNP
rs1165723606 2801 dbSNP
rs1396303588 2810 dbSNP
rs1463328247 2813 dbSNP
rs1327050138 2815 dbSNP
rs888706494 2817 dbSNP
rs116131031 2820 dbSNP
rs1298401327 2822 dbSNP
rs1327039289 2828 dbSNP
rs887094751 2830 dbSNP
rs1047165952 2836 dbSNP
rs1352901567 2837 dbSNP
rs1306915528 2842 dbSNP
rs901319671 2851 dbSNP
rs1247563137 2852 dbSNP
rs1040129434 2865 dbSNP
rs1379211909 2867 dbSNP
rs1283064960 2876 dbSNP
rs1262365289 2877 dbSNP
rs944452870 2882 dbSNP
rs1190467445 2891 dbSNP
rs888820601 2895 dbSNP
rs931405956 2915 dbSNP
rs1050055617 2919 dbSNP
rs1394142124 2920 dbSNP
rs1456725791 2924 dbSNP
rs1291076904 2926 dbSNP
rs898553256 2933 dbSNP
rs935634110 2934 dbSNP
rs41284410 2935 dbSNP
rs937173337 2943 dbSNP
rs1420633240 2944 dbSNP
rs575457642 2947 dbSNP
rs1234091376 2956 dbSNP
rs1292936227 2957 dbSNP
rs1319627270 2959 dbSNP
rs928590994 2960 dbSNP
rs749223420 2962 dbSNP
rs1261239833 2968 dbSNP
rs555029552 2972 dbSNP
rs1213801944 2973 dbSNP
rs1258948103 2974 dbSNP
rs945757008 2975 dbSNP
rs912909265 2991 dbSNP
rs1415231373 2992 dbSNP
rs1427080635 2993 dbSNP
rs989801447 2994 dbSNP
rs1364846575 2997 dbSNP
rs531429924 3001 dbSNP
rs1157405091 3003 dbSNP
rs1414682050 3043 dbSNP
rs1377309611 3048 dbSNP
rs1415476471 3053 dbSNP
rs1312436954 3056 dbSNP
rs1377337621 3058 dbSNP
rs1392890776 3059 dbSNP
rs957115542 3065 dbSNP
rs1471969835 3069 dbSNP
rs1316146021 3074 dbSNP
rs1028705757 3094 dbSNP
rs1237822302 3102 dbSNP
rs1282390863 3103 dbSNP
rs1243991491 3105 dbSNP
rs1042003657 3111 dbSNP
rs945922981 3113 dbSNP
rs917071465 3118 dbSNP
rs1194131593 3120 dbSNP
rs541490128 3122 dbSNP
rs975615954 3124 dbSNP
rs41284408 3126 dbSNP
rs958775508 3129 dbSNP
rs927322209 3136 dbSNP
rs1224693609 3137 dbSNP
rs1322242564 3138 dbSNP
rs1418891157 3138 dbSNP
rs1019893672 3148 dbSNP
rs1288612834 3163 dbSNP
rs1397439787 3183 dbSNP
rs1435417001 3189 dbSNP
rs1008877284 3193 dbSNP
rs1173141262 3194 dbSNP
rs887342479 3201 dbSNP
rs1357624152 3211 dbSNP
rs1226054940 3220 dbSNP
rs1026074325 3222 dbSNP
rs995482589 3230 dbSNP
rs374193607 3231 dbSNP
rs1372260679 3233 dbSNP
rs552647226 3235 dbSNP
rs1305521474 3242 dbSNP
rs1371725299 3250 dbSNP
rs1356610216 3252 dbSNP
rs1275950358 3255 dbSNP
rs187621741 3255 dbSNP
rs1204726165 3260 dbSNP
rs750029981 3260 dbSNP
rs1250415261 3261 dbSNP
rs898624858 3264 dbSNP
rs1025920156 3265 dbSNP
rs555990766 3270 dbSNP
rs557270366 3272 dbSNP
rs1255413479 3274 dbSNP
rs1455125468 3276 dbSNP
rs753690908 3277 dbSNP
rs1191149166 3283 dbSNP
rs537221719 3285 dbSNP
rs1423105500 3295 dbSNP
rs1430389309 3299 dbSNP
rs1171329284 3302 dbSNP
rs568298575 3307 dbSNP
rs907029500 3311 dbSNP
rs548422262 3320 dbSNP
rs1019738826 3322 dbSNP
rs755917965 3328 dbSNP
rs1006976176 3330 dbSNP
rs535926977 3342 dbSNP
rs566961096 3343 dbSNP
rs1273036902 3344 dbSNP
rs888874605 3346 dbSNP
rs1294386273 3354 dbSNP
rs1315727169 3357 dbSNP
rs1407357758 3359 dbSNP
rs1275389874 3369 dbSNP
rs1050108025 3372 dbSNP
rs1221394763 3374 dbSNP
rs913112320 3379 dbSNP
rs990224505 3381 dbSNP
rs1187254457 3382 dbSNP
rs935648396 3383 dbSNP
rs904167661 3389 dbSNP
rs1171600513 3392 dbSNP
rs1476991963 3394 dbSNP
rs1167397289 3397 dbSNP
rs546667118 3399 dbSNP
rs766410238 3402 dbSNP
rs945944857 3411 dbSNP
rs760377119 3412 dbSNP
rs750177317 3414 dbSNP
rs1287838534 3427 dbSNP
rs1201313809 3428 dbSNP
rs917124813 3429 dbSNP
rs767425580 3430 dbSNP
rs1234706419 3432 dbSNP
rs1293536629 3434 dbSNP
rs986957823 3434 dbSNP
rs1056990698 3435 dbSNP
rs1288346175 3441 dbSNP
rs1449273226 3450 dbSNP
rs1245998699 3456 dbSNP
rs1262503960 3459 dbSNP
rs1218772395 3465 dbSNP
rs182612279 3468 dbSNP
rs1258112772 3469 dbSNP
rs1045846 3473 dbSNP
rs1258501696 3474 dbSNP
rs1472333741 3482 dbSNP
rs927374429 3488 dbSNP
rs775877840 3489 dbSNP
rs995500450 3492 dbSNP
rs191350118 3494 dbSNP
rs571328170 3494 dbSNP
rs116961384 3503 dbSNP
rs143541675 3504 dbSNP
rs907257913 3505 dbSNP
rs1447723490 3509 dbSNP
rs1045981116 3511 dbSNP
rs531124791 3521 dbSNP
rs1293405852 3523 dbSNP
rs1224784507 3525 dbSNP
rs1285934547 3530 dbSNP
rs561917902 3531 dbSNP
rs954189999 3532 dbSNP
rs542020697 3540 dbSNP
rs1434439906 3547 dbSNP
rs115102629 3548 dbSNP
rs904220822 3550 dbSNP
rs1470394094 3552 dbSNP
rs1332111978 3555 dbSNP
rs559440736 3565 dbSNP
rs1177872659 3575 dbSNP
rs1378468939 3581 dbSNP
rs1436039453 3586 dbSNP
rs1465363164 3592 dbSNP
rs1401026726 3601 dbSNP
rs1412351312 3610 dbSNP
rs935681200 3612 dbSNP
rs921579778 3614 dbSNP
rs1038695271 3617 dbSNP
rs543727028 3625 dbSNP
rs370879100 3626 dbSNP
rs776990716 3627 dbSNP
rs895742831 3647 dbSNP
rs1375414421 3659 dbSNP
rs1236543565 3660 dbSNP
rs1424414436 3664 dbSNP
rs868297760 3667 dbSNP
rs987415319 3673 dbSNP
rs1275405349 3675 dbSNP
rs771409275 3675 dbSNP
rs1057043588 3679 dbSNP
rs918863312 3682 dbSNP
rs1236255422 3684 dbSNP
rs905682975 3685 dbSNP
rs937175236 3685 dbSNP
rs73423915 3686 dbSNP
rs556963756 3688 dbSNP
rs1238313817 3692 dbSNP
rs778156855 3693 dbSNP
rs1396837760 3696 dbSNP
rs1456172276 3699 dbSNP
rs962913049 3705 dbSNP
rs1398705407 3715 dbSNP
rs1443708043 3716 dbSNP
rs11198559 3719 dbSNP
rs1302598072 3719 dbSNP
rs367863306 3723 dbSNP
rs1272141756 3729 dbSNP
rs560956699 3730 dbSNP
rs1001457957 3732 dbSNP
rs1469674730 3733 dbSNP
rs574810020 3733 dbSNP
rs186455383 3736 dbSNP
rs1379758397 3737 dbSNP
rs534853866 3757 dbSNP
rs1449363286 3760 dbSNP
rs1032914695 3768 dbSNP
rs1024389664 3772 dbSNP
rs1477317313 3775 dbSNP
rs1168139154 3777 dbSNP
rs968872568 3781 dbSNP
rs1010517481 3799 dbSNP
rs1019998127 3800 dbSNP
rs1009919534 3802 dbSNP
rs1294621054 3802 dbSNP
rs1398406632 3804 dbSNP
rs1385124708 3806 dbSNP
rs181688955 3808 dbSNP
rs190724189 3813 dbSNP
rs751087400 3826 dbSNP
rs1276545911 3827 dbSNP
rs754484293 3834 dbSNP
rs1245316159 3837 dbSNP
rs767153416 3842 dbSNP
rs1000132911 3847 dbSNP
rs1206357096 3850 dbSNP
rs900389977 3853 dbSNP
rs1358417286 3858 dbSNP
rs1190988073 3868 dbSNP
rs1038726052 3876 dbSNP
rs944386628 3880 dbSNP
rs1048706616 3881 dbSNP
rs1173684426 3888 dbSNP
rs1476390562 3889 dbSNP
rs1165979660 3898 dbSNP
rs931127726 3899 dbSNP
rs1456796726 3908 dbSNP
rs911665862 3916 dbSNP
rs1047460553 3918 dbSNP
rs12782493 3921 dbSNP
rs185969709 3922 dbSNP
rs1399492421 3933 dbSNP
rs930160798 3935 dbSNP
rs1177478517 3943 dbSNP
rs1311798904 3974 dbSNP
rs1338506401 3975 dbSNP
rs1241043927 3979 dbSNP
rs570791384 3982 dbSNP
rs545701326 3985 dbSNP
rs918784071 3985 dbSNP
rs550583392 3990 dbSNP
rs974185444 3991 dbSNP
rs1213913622 4006 dbSNP
rs1281984252 4023 dbSNP
rs1483401434 4024 dbSNP
rs1180949271 4045 dbSNP
rs753450534 4050 dbSNP
rs1255860971 4052 dbSNP
rs927508578 4055 dbSNP
rs1200713624 4057 dbSNP
rs12783781 4068 dbSNP
rs980109791 4071 dbSNP
rs1422438358 4075 dbSNP
rs181955245 4079 dbSNP
rs779445445 4096 dbSNP
rs1024837688 4099 dbSNP
rs1419166949 4106 dbSNP
rs1156969591 4111 dbSNP
rs1255841307 4115 dbSNP
rs1466698615 4118 dbSNP
rs1208375240 4120 dbSNP
rs190454186 4124 dbSNP
rs988892218 4143 dbSNP
rs1392981600 4146 dbSNP
rs956294910 4147 dbSNP
rs1309885858 4148 dbSNP
rs1037097436 4150 dbSNP
rs1239553680 4156 dbSNP
rs1374813420 4157 dbSNP
rs944068058 4165 dbSNP
rs912551486 4169 dbSNP
rs985708788 4170 dbSNP
rs578260293 4174 dbSNP
rs925516869 4175 dbSNP
rs1396883901 4179 dbSNP
rs1378718606 4195 dbSNP
rs1439670785 4205 dbSNP
rs1177333158 4208 dbSNP
rs1396922490 4208 dbSNP
rs556715442 4217 dbSNP
rs12766509 4218 dbSNP
rs1361117578 4222 dbSNP
rs966874159 4226 dbSNP
rs186131464 4233 dbSNP
rs1463307476 4239 dbSNP
rs1331848228 4240 dbSNP
rs776174329 4241 dbSNP
rs1399302153 4252 dbSNP
rs1327848025 4257 dbSNP
rs1444431696 4257 dbSNP
rs900460158 4258 dbSNP
rs1167344444 4262 dbSNP
rs1017527230 4273 dbSNP
rs988541136 4285 dbSNP
rs1308932565 4294 dbSNP
rs1220821727 4297 dbSNP
rs1417755091 4301 dbSNP
rs1009008466 4309 dbSNP
rs1457622737 4316 dbSNP
rs1197224220 4326 dbSNP
rs1187624974 4334 dbSNP
rs1422884186 4335 dbSNP
rs1035354437 4346 dbSNP
rs1423305384 4349 dbSNP
rs543786019 4349 dbSNP
rs544484183 4350 dbSNP
rs1180500469 4353 dbSNP
rs1001162868 4364 dbSNP
rs78075947 4365 dbSNP
rs1463881141 4370 dbSNP
rs1287149754 4372 dbSNP
rs1350465111 4374 dbSNP
rs1435088352 4375 dbSNP
rs1291334534 4380 dbSNP
rs1047828062 4381 dbSNP
rs1352126707 4384 dbSNP
rs1400183924 4384 dbSNP
rs369158128 4384 dbSNP
rs180849476 4387 dbSNP
rs1245531374 4389 dbSNP
rs1292610196 4390 dbSNP
rs1322907631 4395 dbSNP
rs1221508558 4398 dbSNP
rs1245014926 4399 dbSNP
rs995767809 4406 dbSNP
rs199609134 4415 dbSNP
rs1321368644 4418 dbSNP
rs201789798 4419 dbSNP
rs898886744 4421 dbSNP
rs1310789428 4441 dbSNP
rs1401651241 4449 dbSNP
rs896970458 4451 dbSNP
rs545918524 4453 dbSNP
rs1404643749 4454 dbSNP
rs1297332342 4461 dbSNP
rs1008257309 4465 dbSNP
rs1398135369 4479 dbSNP
rs891164039 4483 dbSNP
rs1049718110 4484 dbSNP
rs1297201933 4488 dbSNP
rs1456923781 4488 dbSNP
rs1338022898 4489 dbSNP
rs189717980 4490 dbSNP
rs1038506024 4491 dbSNP
rs1286274568 4494 dbSNP
rs932617984 4496 dbSNP
rs1418433416 4497 dbSNP
rs1172420753 4505 dbSNP
rs11550771 4513 dbSNP
rs1043959654 4514 dbSNP
rs752936795 4522 dbSNP
rs945558218 4523 dbSNP
rs1487458356 4526 dbSNP
rs1189906668 4530 dbSNP
rs1237794065 4535 dbSNP
rs1472343667 4542 dbSNP
rs980307461 4545 dbSNP
rs1179984333 4548 dbSNP
rs1382156143 4557 dbSNP
rs1419743521 4558 dbSNP
rs1193384679 4561 dbSNP
rs1358102698 4563 dbSNP
rs914060444 4564 dbSNP
rs988599949 4573 dbSNP
rs950116280 4596 dbSNP
rs368564720 4601 dbSNP
rs1282936911 4603 dbSNP
rs199708518 4603 dbSNP
rs566509430 4603 dbSNP
rs979778018 4607 dbSNP
rs1351633476 4609 dbSNP
rs765612853 4613 dbSNP
rs989190083 4617 dbSNP
rs1279614610 4624 dbSNP
rs543447092 4626 dbSNP
rs575982405 4627 dbSNP
rs1239915120 4636 dbSNP
rs1488177076 4638 dbSNP
rs554948828 4641 dbSNP
rs1172788210 4644 dbSNP
rs1220746723 4645 dbSNP
rs1027342237 4647 dbSNP
rs1033054389 4648 dbSNP
rs765623618 4649 dbSNP
rs759690577 4654 dbSNP
rs961540416 4658 dbSNP
rs1015377174 4662 dbSNP
rs776705157 4666 dbSNP
rs978625986 4667 dbSNP
rs183893514 4671 dbSNP
rs1324080780 4673 dbSNP
rs1386112567 4678 dbSNP
rs1235581883 4679 dbSNP
rs1275654239 4687 dbSNP
rs891216258 4690 dbSNP
rs17097960 4691 dbSNP
rs1439135031 4693 dbSNP
rs997272228 4699 dbSNP
rs1197871712 4701 dbSNP
rs1236346336 4707 dbSNP
rs146932305 4708 dbSNP
rs760797628 4728 dbSNP
rs1376692780 4730 dbSNP
rs772392737 4736 dbSNP
rs1476808945 4738 dbSNP
rs748581557 4740 dbSNP
rs1426136548 4743 dbSNP
rs1025990450 4744 dbSNP
rs1379915983 4752 dbSNP
rs1395046560 4753 dbSNP
rs112050425 4765 dbSNP
rs1388572093 4771 dbSNP
rs1200251143 4776 dbSNP
rs1324232827 4777 dbSNP
rs1330634158 4779 dbSNP
rs1451518401 4803 dbSNP
rs993532998 4813 dbSNP
rs914101657 4824 dbSNP
rs141437706 4839 dbSNP
rs191562482 4840 dbSNP
rs1458395013 4844 dbSNP
rs928389816 4849 dbSNP
rs1210382420 4855 dbSNP
rs1266008129 4855 dbSNP
rs571495335 4857 dbSNP
rs906020657 4859 dbSNP
rs1263523578 4865 dbSNP
rs970158980 4867 dbSNP
rs1196560076 4869 dbSNP
rs1193442826 4884 dbSNP
rs1044933831 4888 dbSNP
rs1371726313 4896 dbSNP
rs1045891 4907 dbSNP
rs77741903 4919 dbSNP
rs1232511639 4929 dbSNP
rs572639869 4933 dbSNP
rs961319119 4940 dbSNP
rs1310813680 4947 dbSNP
rs557741030 4951 dbSNP
rs1053128230 4952 dbSNP
rs779577604 4959 dbSNP
rs926055547 4961 dbSNP
rs1293114878 4974 dbSNP
rs1342073759 4984 dbSNP
rs1245337754 4989 dbSNP
rs188998509 4993 dbSNP
rs151233284 4994 dbSNP
rs910401858 4999 dbSNP
rs987678538 5001 dbSNP
rs375692162 5002 dbSNP
rs1404866398 5003 dbSNP
rs745798735 5007 dbSNP
rs1487731129 5008 dbSNP
rs1191107363 5018 dbSNP
rs954654907 5031 dbSNP
rs560322165 5032 dbSNP
rs376879498 5033 dbSNP
rs143125065 5050 dbSNP
rs1442826947 5052 dbSNP
rs1440352326 5053 dbSNP
rs1419283465 5065 dbSNP
rs962999827 5067 dbSNP
rs892735893 5068 dbSNP
rs1015989606 5071 dbSNP
rs1179985798 5073 dbSNP
rs1001925826 5076 dbSNP
rs1311914413 5076 dbSNP
rs1444327659 5077 dbSNP
rs781321353 5089 dbSNP
rs939526094 5091 dbSNP
rs1352339733 5095 dbSNP
rs552521230 5099 dbSNP
rs1044574113 5107 dbSNP
rs1201431379 5114 dbSNP
rs1484442288 5114 dbSNP
rs948496597 5127 dbSNP
rs531413946 5128 dbSNP
rs1181085511 5132 dbSNP
rs973772065 5140 dbSNP
rs74439958 5141 dbSNP
rs1053767588 5142 dbSNP
rs1449853979 5160 dbSNP
rs535864940 5165 dbSNP
rs986662076 5165 dbSNP
rs1302095098 5169 dbSNP
rs934672593 5172 dbSNP
rs184194651 5181 dbSNP
rs549119773 5182 dbSNP
rs1375503055 5183 dbSNP
rs943443940 5186 dbSNP
rs975613241 5187 dbSNP
rs968168916 5188 dbSNP
rs1312463543 5192 dbSNP
rs1414214009 5193 dbSNP
rs1232107692 5194 dbSNP
rs1262864256 5195 dbSNP
rs1321856003 5196 dbSNP
rs539489145 5197 dbSNP
rs1201006582 5199 dbSNP
rs1355461737 5200 dbSNP
rs1239375855 5204 dbSNP
rs1480346331 5205 dbSNP
rs1374204492 5214 dbSNP
rs1161014623 5218 dbSNP
rs910589722 5218 dbSNP
rs1433935054 5219 dbSNP
rs1420817707 5224 dbSNP
rs1426873164 5224 dbSNP
rs527411015 5226 dbSNP
rs1022772578 5228 dbSNP
rs1171294186 5231 dbSNP
rs1009589168 5247 dbSNP
rs754025575 5249 dbSNP
rs1294727899 5258 dbSNP
rs1379823026 5258 dbSNP
rs892455703 5258 dbSNP
rs1367729334 5265 dbSNP
rs954696007 5269 dbSNP
rs1385804551 5273 dbSNP
rs1280986526 5282 dbSNP
rs1321832206 5288 dbSNP
rs149092341 5289 dbSNP
rs1259231027 5303 dbSNP
rs879201940 5307 dbSNP
rs192500147 5308 dbSNP
rs963239330 5316 dbSNP
rs1267232229 5331 dbSNP
rs1015894457 5338 dbSNP
rs560181244 5344 dbSNP
rs969112571 5347 dbSNP
rs1478664821 5348 dbSNP
rs1025142408 5354 dbSNP
rs1418559434 5359 dbSNP
rs1352885191 5361 dbSNP
rs558671992 5361 dbSNP
rs1045237406 5363 dbSNP
rs1166835437 5363 dbSNP
rs1014453516 5376 dbSNP
rs1457019200 5380 dbSNP
rs895954259 5389 dbSNP
rs1300895207 5397 dbSNP
rs1229469915 5407 dbSNP
rs537791754 5412 dbSNP
rs1402213329 5416 dbSNP
rs189021389 5420 dbSNP
rs145011426 5421 dbSNP
rs898255311 5425 dbSNP
rs1315507297 5431 dbSNP
rs1322402000 5449 dbSNP
rs1221895165 5450 dbSNP
rs143657163 5460 dbSNP
rs1038503299 5469 dbSNP
rs1217666741 5473 dbSNP
rs1241239999 5474 dbSNP
rs73423912 5477 dbSNP
rs760707177 5480 dbSNP
rs1183508182 5489 dbSNP
rs568150816 5490 dbSNP
rs1354007069 5501 dbSNP
rs1052265896 5505 dbSNP
rs908204241 5514 dbSNP
rs1361922508 5518 dbSNP
rs1419883175 5547 dbSNP
rs1401212984 5549 dbSNP
rs1360370830 5551 dbSNP
rs1157025194 5553 dbSNP
rs1297216387 5553 dbSNP
rs866574740 5566 dbSNP
rs919101328 5573 dbSNP
rs971841611 5575 dbSNP
rs933905933 5578 dbSNP
rs773701929 5584 dbSNP
rs909093035 5587 dbSNP
rs1162933040 5591 dbSNP
rs1312966630 5592 dbSNP
rs980444515 5594 dbSNP
rs1241067915 5602 dbSNP
rs1444827525 5624 dbSNP
rs968262864 5627 dbSNP
rs554560008 5630 dbSNP
rs1212019797 5632 dbSNP
rs1237961823 5634 dbSNP
rs1425584778 5642 dbSNP
rs988620301 5646 dbSNP
rs1194112865 5661 dbSNP
rs1487925617 5671 dbSNP
rs1240226827 5687 dbSNP
rs1157630299 5697 dbSNP
rs956727705 5705 dbSNP
rs535302046 5710 dbSNP
rs17097958 5719 dbSNP
rs1024751011 5721 dbSNP
rs1407343395 5724 dbSNP
rs768073434 5730 dbSNP
rs1288499474 5737 dbSNP
rs1379187370 5744 dbSNP
rs12246502 5755 dbSNP
rs1447694475 5763 dbSNP
rs1231134798 5772 dbSNP
rs762324068 5778 dbSNP
rs1280492877 5793 dbSNP
rs1491264504 5820 dbSNP
rs1491345035 5821 dbSNP
rs552699776 5822 dbSNP
rs1201677946 5824 dbSNP
rs532639149 5825 dbSNP
rs1240023431 5832 dbSNP
rs143558770 5832 dbSNP
rs1024275596 5833 dbSNP
rs1230704272 5835 dbSNP
rs112258352 5839 dbSNP
rs1478786169 5846 dbSNP
rs182714223 5846 dbSNP
rs998986666 5854 dbSNP
rs549934964 5858 dbSNP
rs899309213 5860 dbSNP
rs1287594105 5865 dbSNP
rs1038151055 5871 dbSNP
rs1174894945 5875 dbSNP
rs116075622 5879 dbSNP
rs1021879289 5885 dbSNP
rs1322960891 5893 dbSNP
rs1334090708 5895 dbSNP
rs533620543 5895 dbSNP
rs757906151 5895 dbSNP
rs1344634394 5896 dbSNP
rs1221506453 5898 dbSNP
rs192646449 5904 dbSNP
rs1318449926 5909 dbSNP
rs1195193686 5910 dbSNP
rs527539851 5912 dbSNP
rs1051742833 5914 dbSNP
rs187511044 5917 dbSNP
rs1199119704 5918 dbSNP
rs545186743 5925 dbSNP
rs1267814944 5933 dbSNP
rs1171142146 5935 dbSNP
rs575862096 5939 dbSNP
rs557019707 5942 dbSNP
rs866274059 5955 dbSNP
rs765669007 5960 dbSNP
rs1474147300 5968 dbSNP
rs1036155200 5983 dbSNP
rs1426262131 5989 dbSNP
rs941865678 6001 dbSNP
rs1167846830 6009 dbSNP
rs1192901436 6011 dbSNP
rs1478306869 6019 dbSNP
rs915052935 6020 dbSNP
rs748922298 6030 dbSNP
rs1303954364 6047 dbSNP
rs1365242259 6050 dbSNP
rs1403362167 6055 dbSNP
rs909166682 6060 dbSNP
rs927998888 6061 dbSNP
rs956780849 6061 dbSNP
rs1458822791 6062 dbSNP
rs1258243556 6064 dbSNP
rs1199692585 6066 dbSNP
rs144237627 6082 dbSNP
rs1290549217 6083 dbSNP
rs1293860204 6096 dbSNP
rs1218376946 6099 dbSNP
rs1221492126 6108 dbSNP
rs1265710931 6109 dbSNP
rs574617343 6122 dbSNP
rs139405934 6128 dbSNP
rs1193083522 6140 dbSNP
rs182739647 6140 dbSNP
rs1473806497 6141 dbSNP
rs991804971 6142 dbSNP
rs1302775067 6147 dbSNP
rs1438733948 6152 dbSNP
rs111469789 6153 dbSNP
rs1422907574 6155 dbSNP
rs769318991 6159 dbSNP
rs572692319 6160 dbSNP
rs190094537 6169 dbSNP
rs544758753 6175 dbSNP
rs1316093881 6180 dbSNP
rs1342242564 6201 dbSNP
rs539206439 6212 dbSNP
rs968863640 6214 dbSNP
rs1352601929 6219 dbSNP
rs1313683824 6220 dbSNP
rs570225558 6228 dbSNP
rs1004967063 6239 dbSNP
rs550416130 6267 dbSNP
rs1021906849 6269 dbSNP
rs1261006378 6278 dbSNP
rs1177960767 6280 dbSNP
rs150914082 6281 dbSNP
rs771323154 6284 dbSNP
rs377679937 6285 dbSNP
rs1260110933 6287 dbSNP
rs1444596414 6293 dbSNP
rs1008240821 6296 dbSNP
rs1050778053 6297 dbSNP
rs1384627420 6297 dbSNP
rs1442923274 6297 dbSNP
rs1364637387 6298 dbSNP
rs574175563 6300 dbSNP
rs953624232 6308 dbSNP
rs780861663 6309 dbSNP
rs1404119841 6312 dbSNP
rs567377751 6314 dbSNP
rs899484321 6314 dbSNP
rs1379925662 6316 dbSNP
rs897942527 6319 dbSNP
rs547359006 6326 dbSNP
rs527341864 6329 dbSNP
rs565166330 6330 dbSNP
rs1259264401 6339 dbSNP
rs887631320 6341 dbSNP
rs1204853414 6347 dbSNP
rs1243144575 6355 dbSNP
rs1044848891 6365 dbSNP
rs746973866 6366 dbSNP
rs551422933 6367 dbSNP
rs531517599 6369 dbSNP
rs1379094121 6370 dbSNP
rs1313312422 6385 dbSNP
rs935120907 6388 dbSNP
rs935006111 6390 dbSNP
rs923716855 6399 dbSNP
rs979159707 6408 dbSNP
rs967764649 6411 dbSNP
rs914755415 6418 dbSNP
rs982172962 6421 dbSNP
rs1224557209 6436 dbSNP
rs566162364 6445 dbSNP
rs554005096 6452 dbSNP
rs542420070 6455 dbSNP
rs1175685459 6459 dbSNP
rs963967333 6464 dbSNP
rs1030579159 6467 dbSNP
rs574554236 6469 dbSNP
rs997959507 6470 dbSNP
rs562338020 6473 dbSNP
rs561267572 6474 dbSNP
rs962005633 6482 dbSNP
rs754055767 6484 dbSNP
rs1171726915 6485 dbSNP
rs1294896196 6499 dbSNP
rs1421424390 6506 dbSNP
rs4752188 6514 dbSNP
rs997885515 6517 dbSNP
rs1157730927 6519 dbSNP
rs1296992293 6525 dbSNP
rs370029843 6527 dbSNP
rs1416949401 6547 dbSNP
rs899537633 6548 dbSNP
rs1257764929 6552 dbSNP
rs1222032697 6560 dbSNP
rs887829557 6561 dbSNP
rs1044880780 6564 dbSNP
rs1486760051 6566 dbSNP
rs12217661 6570 dbSNP
rs1012079716 6571 dbSNP
rs1164878497 6572 dbSNP
rs896429917 6573 dbSNP
rs1385343770 6575 dbSNP
rs1010539359 6576 dbSNP
rs1300916981 6583 dbSNP
rs1056373551 6586 dbSNP
rs573038102 6595 dbSNP
rs1289931216 6608 dbSNP
rs1361926629 6609 dbSNP
rs61863910 6613 dbSNP
rs1286831272 6614 dbSNP
rs754277495 6616 dbSNP
rs1238343137 6618 dbSNP
rs1213358638 6628 dbSNP
rs1317167935 6630 dbSNP
rs923617131 6633 dbSNP
rs1052325242 6637 dbSNP
rs1043381541 6646 dbSNP
rs764593426 6665 dbSNP
rs572380437 6671 dbSNP
rs1315057443 6677 dbSNP
rs1216301989 6678 dbSNP
rs1241332752 6682 dbSNP
rs946454870 6689 dbSNP
rs756202072 6690 dbSNP
rs558924441 6692 dbSNP
rs1310836149 6693 dbSNP
rs1402781106 6700 dbSNP
rs539308632 6720 dbSNP
rs535624781 6724 dbSNP
rs976343421 6731 dbSNP
rs916629772 6737 dbSNP
rs1383614709 6738 dbSNP
rs1452062605 6740 dbSNP
rs1313167007 6741 dbSNP
rs1450936468 6745 dbSNP
rs1224568853 6749 dbSNP
rs1283209471 6751 dbSNP
rs138442749 6751 dbSNP
rs962240811 6756 dbSNP
rs556754787 6757 dbSNP
rs1474667792 6760 dbSNP
rs536886295 6760 dbSNP
rs942018978 6763 dbSNP
rs908158336 6766 dbSNP
rs983656791 6766 dbSNP
rs1186174224 6767 dbSNP
rs984717235 6772 dbSNP
rs952170538 6773 dbSNP
rs1407699845 6775 dbSNP
rs1456043162 6777 dbSNP
rs1489563911 6778 dbSNP
rs1023713646 6793 dbSNP
rs567365293 6810 dbSNP
rs547205199 6814 dbSNP
rs1469763186 6816 dbSNP
rs896304268 6818 dbSNP
rs533768468 6825 dbSNP
rs964145472 6833 dbSNP
rs1267274673 6837 dbSNP
rs571122172 6843 dbSNP
rs551378751 6849 dbSNP
rs1245879389 6850 dbSNP
rs1334439026 6851 dbSNP
rs902396233 6852 dbSNP
rs1201695898 6857 dbSNP
rs1017996704 6861 dbSNP
rs1437966248 6862 dbSNP
rs531458674 6864 dbSNP
rs1203371258 6872 dbSNP
rs1230864049 6873 dbSNP
rs1043413456 6877 dbSNP
rs946361365 6894 dbSNP
rs1430472338 6895 dbSNP
rs1480355596 6904 dbSNP
rs764497896 6907 dbSNP
rs1220182127 6909 dbSNP
rs1398705861 6914 dbSNP
rs1410668143 6915 dbSNP
rs775631933 6915 dbSNP
rs1369000472 6916 dbSNP
rs1407017714 6917 dbSNP
rs1283640158 6919 dbSNP
rs1344652259 6924 dbSNP
rs1221599196 6925 dbSNP
rs1271928299 6925 dbSNP
rs1011005026 6926 dbSNP
rs889573312 6931 dbSNP
rs539448589 6932 dbSNP
rs1030950705 6935 dbSNP
rs1392321181 6946 dbSNP
rs1222781060 6951 dbSNP
rs1269972283 6953 dbSNP
rs562455915 6958 dbSNP
rs546427580 6961 dbSNP
rs1375325310 6972 dbSNP
rs1475769252 6973 dbSNP
rs923477407 6974 dbSNP
rs7079716 6975 dbSNP
rs1391756005 6977 dbSNP
rs529102042 6981 dbSNP
rs1163248195 6983 dbSNP
rs1478981857 6984 dbSNP
rs1046265671 6987 dbSNP
rs940950057 6991 dbSNP
rs1193153879 6992 dbSNP
rs895239814 7004 dbSNP
rs1037772266 7009 dbSNP
rs1427247672 7019 dbSNP
rs1320184438 7022 dbSNP
rs908133639 7029 dbSNP
rs67317758 7033 dbSNP
rs1226647767 7036 dbSNP
rs1294687446 7040 dbSNP
rs1360986170 7046 dbSNP
rs1214332337 7051 dbSNP
rs907874093 7055 dbSNP
rs769270906 7057 dbSNP
rs1048007066 7059 dbSNP
rs1359128683 7064 dbSNP
rs745519157 7068 dbSNP
rs1468218033 7069 dbSNP
rs923493181 7071 dbSNP
rs1246251071 7072 dbSNP
rs1024165752 7074 dbSNP
rs1164419200 7075 dbSNP
rs1384903081 7084 dbSNP
rs1456606572 7093 dbSNP
rs1160048214 7100 dbSNP
rs541993521 7105 dbSNP
rs1200341997 7107 dbSNP
rs1318390766 7108 dbSNP
rs35120406 7116 dbSNP
rs1452778254 7119 dbSNP
rs990941445 7125 dbSNP
rs1313893564 7131 dbSNP
rs1269357161 7138 dbSNP
rs964882061 7141 dbSNP
rs910984068 7143 dbSNP
rs1351864873 7154 dbSNP
rs961044157 7155 dbSNP
rs957723212 7159 dbSNP
rs1462692371 7184 dbSNP
rs1184232283 7186 dbSNP
rs1242640422 7187 dbSNP
rs1368368259 7190 dbSNP
rs1184261662 7191 dbSNP
rs1452879591 7196 dbSNP
rs1332994705 7202 dbSNP
rs538015683 7205 dbSNP
rs1156824504 7207 dbSNP
rs1408276732 7211 dbSNP
rs1470276336 7214 dbSNP
rs1335447278 7220 dbSNP
rs541130176 7229 dbSNP
rs572522097 7243 dbSNP
rs1167698165 7244 dbSNP
rs1307345639 7261 dbSNP
rs999318382 7266 dbSNP
rs902469834 7283 dbSNP
rs1228215824 7284 dbSNP
rs1022212435 7291 dbSNP
rs1030669725 7292 dbSNP
rs999151737 7295 dbSNP
rs1379825174 7296 dbSNP
rs1194365935 7299 dbSNP
rs183924956 7301 dbSNP
rs1010604996 7309 dbSNP
rs1255424694 7309 dbSNP
rs186114310 7313 dbSNP
rs1012518112 7320 dbSNP
rs1049837947 7326 dbSNP
rs183036346 7334 dbSNP
rs900879944 7339 dbSNP
rs1438597665 7344 dbSNP
rs1431206174 7345 dbSNP
rs1480684973 7348 dbSNP
rs778930674 7352 dbSNP
rs1356917400 7355 dbSNP
rs1463105198 7360 dbSNP
rs1298369737 7361 dbSNP
rs1038226819 7367 dbSNP
rs1006304710 7378 dbSNP
rs1040587566 7379 dbSNP
rs1347792517 7382 dbSNP
rs1224644862 7383 dbSNP
rs1301269894 7387 dbSNP
rs1334701377 7389 dbSNP
rs1229770768 7393 dbSNP
rs1251991063 7396 dbSNP
rs1482830246 7403 dbSNP
rs776240434 7405 dbSNP
rs886488027 7431 dbSNP
rs1270705765 7442 dbSNP
rs1490468964 7450 dbSNP
rs35621816 7454 dbSNP
rs1190520521 7458 dbSNP
rs940856213 7459 dbSNP
rs1430258457 7465 dbSNP
rs1170484223 7483 dbSNP
rs933296407 7485 dbSNP
rs576800242 7486 dbSNP
rs1427354038 7492 dbSNP
rs1165142751 7495 dbSNP
rs1193799567 7496 dbSNP
rs1347066223 7497 dbSNP
rs908164847 7498 dbSNP
rs1233429351 7499 dbSNP
rs80279626 7499 dbSNP
rs984992130 7506 dbSNP
rs1366052043 7508 dbSNP
rs1225789553 7509 dbSNP
rs1491078133 7509 dbSNP
rs398075580 7509 dbSNP
rs533757557 7509 dbSNP
rs567327362 7509 dbSNP
rs71942578 7509 dbSNP
rs943559870 7511 dbSNP
rs914736725 7512 dbSNP
rs1447155169 7518 dbSNP
rs1246862429 7519 dbSNP
rs989672543 7524 dbSNP
rs777190750 7531 dbSNP
rs549240100 7538 dbSNP
rs916601306 7551 dbSNP
rs991192616 7555 dbSNP
rs1404423351 7559 dbSNP
rs1164471792 7564