miRTarBase - #MIRT551383 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EPM2AIP1   
Synonyms -
Description EPM2A interacting protein 1
Transcript NM_014805   
Expression
Putative miRNA Targets on EPM2AIP1
3'UTR of EPM2AIP1
(miRNA target sites are highlighted)
>EPM2AIP1|NM_014805|3'UTR
   1 GGCTTTGTAGTACAAGATTGAAAAACTCAACAAGAATTTAATTCTAAAAGCAAAAATTGGTTTGAGTTTTCAAGTTTACT
  81 AATTTGGATTGTGAGAAAGTACCAAGTACCAGCCGTCCAAACTGATCACAATTAAAATTCTGACAGTTGCCTTTTTTTTC
 161 ATCTCAAATGGCAGCATGGGACTGAAACATGAGAATGCCACCTTTTTTAAAACTTAGTTTAGTGACAAAGTCATTGTCTT
 241 TTATGATATAGTTAATTTTAAAGAGATTTAGTATTAATGTGAGTTGAATTTGCAGTCTGTTTTTTAGGTGTTCTGAAGAT
 321 AAATGCCAAAAATTTCAGCTCTTATTTTAATGGAGTGTTAAAATTCTGATTCATATAGTCTTAAATTATCAACTCCTTAA
 401 ATGTGCTTTTGAACCAATTTGCAGAAGCTCACATAGCAAGTTCATAAGTTTCCAAAAAGGAAGCCCATACATAACAGTGG
 481 AGGTGTTTTGTCTAACCATCAAAATGTTTGAGACTTTTTTTTAAACATTTCTGAGTTCGAAGGTAATACTGACAGATTTC
 561 TTCCCTCTTCCCTCCCCATCACCCACCTCAGTGATAACACATTACTGATAGAGGAAGTCATTAGAATCATTTTTAAGTTT
 641 CAGATATAGGAGACTTCATGCAATTTGGAGATAAGACTAATTATTGGGGGTTTTCCTTGGATTTTTTTTTTAATAACTGG
 721 GGGCTATTTTATCAGCTTGCCTATTAAAGGACTATGGTAAGTATAGAATCTTAATGGTTGCCAGTTAGTAATTCTTTTTT
 801 TTTTTTTTTTTACTGTAGACACAAGTTTGGCCCTATCAAAAACGATGAGGAAAAAAGATTGCACTCCAGGATTAGGAGGT
 881 GTGAGATATTTTAGCTTTTTTGTCTTATCTGCGTGGGTATTGCTGCTTTATTTTAAAAAATCCTGCCTAAAGTAAACACT
 961 TTGTTTTAAAATGATACAGTATCAGATTTTGTTAGATGCTAGAAATGGATTTATTCTAAAATTTGGAACTGTCGTACACA
1041 TTCTATATGTAAGATAGCACACAAGTAGAAATATTTAAAAGCAGTCTTATTCACAGATTGCAGTAATTCTGTATTTCTAC
1121 TAAGATAATCTGCTTTGTGCCAAAACAGTAATTTCCAAACTTCTGTTCACCATGAAAAGGCAATCTTAAAGTTCATTATG
1201 TAAAACTAATTATAAACAGGACCCAATTTATATTCATAGATCCTCTCAAGTATTATACAATTTAAAAACTCTTGTTCCAA
1281 AGTCCTGTCTTAACTATTGAAACACCTTAATCTGTGGTTACTAATCCAGCAAATTCAAGGAACCAGGCTATGACTAAGAA
1361 TTTAGGTGGAATTGATGTCTGGGCAATTAAAATAAATGGCATAAGAGCTTAAAAACCAAAGTTGTGCCAGTGGCTTTCAA
1441 CTAGAGGCAGTAACCTGTCATTCCAGAGGATGCTGAGAAATGTGTAGGGGCACTTTTTTGGTTGTCATATTTACTAGGGG
1521 CTTCTGTTGGCATTTAAGCCTAAAGACACTCACCCCTGCAGTGCATGGGACAGCCTGGCACAATGAAGAATTAGCCCTCC
1601 CAAAATGTAGATTATTTTATTTCAAGGGATAGGGCAGATTACCATTAGAAGCAAAATTAAAAGTACAAGCTGGGCAAACT
1681 GACAGAATACTAGATAGGAGAGACTAATTCCAACCTTCTAAATTTGGCTAGTAAAGTGCAATAAAGGCATTGATAAGTTC
1761 TGTTAGCTCACCATAGCACTTGTAAATCAGGAATTAATAATTGAATCAGATTTAAGGGCTCTGTCCTGTTATACATATTT
1841 AAGGCAGAAAAAAAGTTACATGTCGATTAGGTACTTATCAAGAATGGTCAAGCTGAGATTTTGGTTAATAGAGTAAGCTT
1921 ACATATCTAGAGAAACAACATAGTGGAAAACCGAAAAAAAAAAACAGAAAAATCTACCGGTAATTTCCCAATAGCTTTGA
2001 ATATTCACAGCAGAGCTTTATTACTTGAGAGAAAGACTGGAAGACCTGAAAGCCACTTCTGCTTTCTAACCCCAGTTCCT
2081 TAAATATTGAAATCTTGTACATTTTGTGAAATTCCAGTATGTTTTGCTTAAGGTGTTAATAAAATTAGTTTGCATCATGT
2161 AGTCATTGAGTGAGGGGGAGATATAAGCCAAGGATTTTAAATTGACCCTTAGCTATAGAGAATTTGCTATAAGCTAGTCT
2241 TGTTTGTAAAAAAAAAAAAAAAAAAAGAAAAAGAAAAAAGTGTATTTTACTGTTTTCTGTATTAAGTAATTCTGTAACTG
2321 CATGGCAGTCTTTTTTTTTTTAAATAAATATAGTTGTTACTGGTCCTGTTGTAGCAGTGAATATAGTTAAAATACGTACA
2401 TTAAAAAAAAAATTATTAGGTCCTTACCAGTTACTGTCCTATAGCTCATTCCTACTAGTTTTCTTGACAGATTTGTATTC
2481 CCAGTGTCCCGTATTGCCACTCAAATTGCTCTACTATGCTAAGTCCTTGTTAATAGTCTTACCCTCCTTGAAACACTTGA
2561 ACACTTGATGACTTTAGCTTTGAGGAGATACCATCTCCAGGTGTGCTTTCTTAGTCTTTGCAGGCACCTCTTCCCTTCAA
2641 TATCTGTTCTTCGTATTTTTAAAAAAATTTGTTTTAGACTGCCTTGTTCTGTGTCAGCTCGCTAGCTGATCTCATTTCCT
2721 TCCATGGTTTCCTTACCATTTATATGCAAATGACTGTCAGATTCATATCTCCTTTCTAGATCTTCCCTAATTGATGTATC
2801 TAATTGCTAACAAATGCTCTTTGCTGTCTCAGGCACTACATGTCATTGATCTTGCCCCCAATCCTGCTCCTCCTCTCATG
2881 TTTCCTCTTTGACTAAATGGCATTACCACTACCAACCATTCATTTGTCCTTTTTACCAATTCTCCAATGCTGCCATTTTA
2961 ATTCAGGCCATCAACCTACCTAAATTATAGCAACAGCCTCCTTATTAGTCTCCCTGTTTTTTATTTTTATTCCTTTCTAC
3041 ACTACAACCAAATTGCTCCAAAAGACTTACTGATCATGTCACTGCATTGCTTTCACCATTGCTCTTAGGGTACAATACAA
3121 ATTTATCTTCATCTTTAAGGTCTCAGTATGCCACTTCATCTAGGAAACCTTCATTGATGCCCTCTAGATTAGGTGCCCTT
3201 ACTATCCATTCCCTATACACCCTGTTCTTTCCCAGACATACACTTGGCACACTTTATTGTTACTGCTTATTGATCACTGC
3281 TAGACTGTAAGCTTTGTAAGGGCAGGGACCATATAAGCCTTGTTCACTGTTATATCTCTAGTGCTTAGCACAATGCCTGG
3361 CATTTCAATAAATGTTTGGACAAACGAATATTTGTGTAGTGTTTTACAATTTTTGAAGCTCTTTCACAGTCTTATTTGAC
3441 CTTCACAGTCATTCTGCCTTAGACTGTCCATTGGGTAACTTTTATCCACATATTACTAATTGAAAAATGAAGACAAGTTC
3521 TTTGTAACTAGGGACCTCGTTGTATTCTCAGAATTTAGTGTAGTGCTTAGCATGTGACTTAAATATGTATTATGTGACTG
3601 TTAAACAAATTGTGGTTTTCTCTGTTGTATGAAAGGAGAGAAGGATAACAAATTGCGGTTTTCCCTGGTAAACACAGTAA
3681 GTAGTAAACTCAGGATTCAAAACCAAATATACACACCAAATCCACTATGTAATATTAAGTTTGCATATCCATGTATAGAA
3761 TCTTATTTTTTTTTACCCTTTGTAAACAGTGTCATATATATATATATATTTTTTTTTTTTTTTTAAATTTCCAAAGGAAC
3841 CTACATATAGAGGGAAAAGATTAGACAACTACTTAGTGAACTAAAACAATATGTTTTTACTAAATGTTACATTTAGTATT
3921 GGAAAAAGATAATGCCGCCTAAGAGTTAATAATCATTTTTCCTTTTGTAGGCATCAACACTAGGAGAAAATGGCATGCTA
4001 TTTACTTGCTACTTTCCTTTACAGATGATTTTTGGCTCTTCTGGGATTTAAAAGTAAGTAAATTTAACAAAGTAGAAGAC
4081 TGACTCAGCCCTTCTGGTCACTATATATTCAGTTCACTTGTTTTTACACCTGCAGAATGTCCTTATCACCCAAAGGGAGA
4161 TGACCCAAAAGTGACATCTAGTTAATGTATACTTCTAAAGTTTGCTGTATTCCTTTGCCTTCTTGTTCCCATGCCTCTCT
4241 GAACTTAATTTCTGGGTAACTGAGGCTTTTCAGGCTTAGGTGGGAAAGCCACACCCTTAGTCTGTTTCCTTAAGCCATTT
4321 TGACCAATTTATGGGATTAACTAGTATAATCTTAGTTGGAGTTTTAGTCTGAGGCATATTAAGTCATTCAGAGATCTTAA
4401 CAGTAGGTGTCATAGTCATCCAGTGATTTGGTGCTTGCTGCAAAACTGGCTTTTTTTTTTTTTTTTTTTTTTGAGGCGGG
4481 GTCTCACTTTGTCACCCAGGCTGGAGTGCAGAGGTACAATCTCAGCTCAATGCAATCTCTGCCTTCCTGGCTCAAGCAAT
4561 TCTCCCACTGCAGCCTCCTAAGTAGCTGGGAATACAGGTATACACGAGTACACCCAGCTAATTTTTGTATTTTTATGTGG
4641 AGACAGGGTCTTGCTGTATTCCCCAGGCTAGTCTCGAATTCCTGGACTCAAGCAGTCCGCCCGCCTCGGGCTCCCAAAAT
4721 GTTGGTGTTATACGTGTGAGCCTCTGCACCCGGCGGCAAAACTGGCTTTTAATCAACCTTTTGGCTAAAGGATTTCTCTT
4801 TTTATTTATTTGTAAAAGGATTTCCCATTTTTATCTTTCTTTTTGATATTAAAATGTTGCCTCATCCTACCCAGTAAGTA
4881 CTTGAATTTGAATTCTCTTCCTTTTCATTTTTGCCTGCAAACTGACCAGTCTTTTCTGAGTTCATCTCTTCTGTACGTTT
4961 TGTCAAGTGCAGTGAACAGCAACTACAAAATATTTTGTTTTTCTGTCTTTTTCTTTAGTAAAGGGTAGATGATCTGCCTT
5041 TCAGGTTATCTCAAGGGGCAGTTTCACCTTTCCATAATATAAATTACCCTTGTGTAAGTTATTTCTTCCATCTTCTGATA
5121 GCAATTTCCTGAATGCCTGCCAGCTAACCATTAAGCCAGTGTTCAGTATTTTAGCATTTTAAAAAACAAGGGACCAATTT
5201 CTGTGTCAGCATGGGCTAGCTTGCCATTGAATAACAAAGGCAAAATCTCACTGTCTCACACAACTTTTCTATTGCAACTT
5281 GCCTAGGGACTTTGGTTTAGATCATAGGTTGGCCATGATCAAACTATGGTCCATGGGCAAAATCTGTCTAGCTCCTTATT
5361 TATCTAAATAAAGTTTTACTGGAATATA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaAUACACGACGAu 5'
                    ||| ||||||| 
Target 5' tctgcgtgggTAT-TGCTGCTt 3'
908 - 928 147.00 -10.30
2
miRNA  3' guGUUUGGUAA--UAC--ACGACGau 5'
            | |:: |||  :||  ||||||  
Target 5' atCCAGTGATTTGGTGCTTGCTGCaa 3'
4418 - 4443 132.00 -11.90
3
miRNA  3' guguuUGG-UAAUA---CACGACGau 5'
               ||| ||| |    ||||||  
Target 5' tttttACCAATTCTCCAATGCTGCca 3'
2930 - 2955 129.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
89594 2570 ClinVar
COSN30656482 18 COSMIC
COSN30517133 44 COSMIC
COSN31489752 151 COSMIC
COSN28842513 152 COSMIC
COSN21692062 184 COSMIC
COSN23376287 423 COSMIC
COSN31479831 533 COSMIC
COSN31607180 538 COSMIC
COSN1276472 559 COSMIC
COSN31551067 664 COSMIC
COSN31609983 664 COSMIC
COSN31564662 701 COSMIC
COSN26573195 745 COSMIC
COSN31571563 791 COSMIC
COSN17936411 794 COSMIC
COSN18757727 794 COSMIC
COSN20098289 795 COSMIC
COSN26636730 822 COSMIC
COSN28208972 895 COSMIC
COSN31538076 934 COSMIC
COSN31489224 973 COSMIC
COSN15742343 1406 COSMIC
COSN29415020 2021 COSMIC
COSN1948455 2139 COSMIC
COSN21668631 2223 COSMIC
COSN229067 2363 COSMIC
COSN25558885 2667 COSMIC
COSN9003472 2796 COSMIC
COSN1948453 2849 COSMIC
COSN9549915 2910 COSMIC
COSN20679391 3061 COSMIC
COSN19483938 3333 COSMIC
COSN20098288 3635 COSMIC
COSN1948452 3747 COSMIC
COSN24997601 3755 COSMIC
COSN23925783 3812 COSMIC
COSN30539878 3954 COSMIC
COSN26602583 4147 COSMIC
COSN1948451 4771 COSMIC
COSN20646950 4963 COSMIC
COSN5003005 4995 COSMIC
COSN31814024 5164 COSMIC
COSN6767169 5193 COSMIC
COSN22101507 5458 COSMIC
COSN7761716 5691 COSMIC
COSN5535582 6140 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748111963 2 dbSNP
rs781512030 3 dbSNP
rs768716511 8 dbSNP
rs376397364 10 dbSNP
rs764145125 10 dbSNP
rs1445663178 11 dbSNP
rs780437899 15 dbSNP
rs758758873 18 dbSNP
rs750988180 23 dbSNP
rs779323641 25 dbSNP
rs756822039 26 dbSNP
rs760685771 27 dbSNP
rs1420617575 28 dbSNP
rs78425091 30 dbSNP
rs753237511 33 dbSNP
rs1248001182 34 dbSNP
rs780852020 34 dbSNP
rs774280504 36 dbSNP
rs567067589 37 dbSNP
rs1486643894 42 dbSNP
rs1272356156 44 dbSNP
rs1203604337 45 dbSNP
rs1198295072 46 dbSNP
rs1307886106 46 dbSNP
rs767476663 49 dbSNP
rs1243801303 60 dbSNP
rs548836510 81 dbSNP
rs1180583580 82 dbSNP
rs978140368 87 dbSNP
rs1429430170 90 dbSNP
rs556471123 91 dbSNP
rs1422017793 93 dbSNP
rs1464752938 99 dbSNP
rs902427728 103 dbSNP
rs1022402324 105 dbSNP
rs1445174571 109 dbSNP
rs1011045294 114 dbSNP
rs1362556786 122 dbSNP
rs893426471 123 dbSNP
rs1054882326 131 dbSNP
rs1308113712 137 dbSNP
rs1218199360 139 dbSNP
rs1264025799 144 dbSNP
rs1414701863 150 dbSNP
rs937732400 151 dbSNP
rs373060734 153 dbSNP
rs751431644 156 dbSNP
rs1237039188 159 dbSNP
rs1261415153 160 dbSNP
rs1486478982 160 dbSNP
rs369240123 160 dbSNP
rs1407750391 161 dbSNP
rs1156989021 162 dbSNP
rs1176617680 163 dbSNP
rs1471285502 171 dbSNP
rs879178342 178 dbSNP
rs1412796267 180 dbSNP
rs561628513 181 dbSNP
rs1174739833 182 dbSNP
rs764134212 196 dbSNP
rs1345310392 201 dbSNP
rs115121044 203 dbSNP
rs1296291462 208 dbSNP
rs981592444 212 dbSNP
rs367625685 215 dbSNP
rs531433488 217 dbSNP
rs564336793 222 dbSNP
rs1284095372 224 dbSNP
rs998838138 226 dbSNP
rs188168144 228 dbSNP
rs1217761118 230 dbSNP
rs1277968055 230 dbSNP
rs901456410 243 dbSNP
rs1317649211 244 dbSNP
rs1442738375 248 dbSNP
rs1283309197 249 dbSNP
rs908121268 250 dbSNP
rs1284505836 254 dbSNP
rs983891375 261 dbSNP
rs1330853712 262 dbSNP
rs1200579622 265 dbSNP
rs1271588090 266 dbSNP
rs1288406068 271 dbSNP
rs952087421 276 dbSNP
rs1028029826 278 dbSNP
rs974874117 286 dbSNP
rs1156696777 289 dbSNP
rs964738426 295 dbSNP
rs374080057 313 dbSNP
rs560189614 318 dbSNP
rs1329178083 322 dbSNP
rs1434555680 324 dbSNP
rs1274514222 327 dbSNP
rs1003845572 333 dbSNP
rs1008669146 337 dbSNP
rs747579058 338 dbSNP
rs541679885 339 dbSNP
rs888159896 340 dbSNP
rs1353612660 341 dbSNP
rs1223936086 342 dbSNP
rs1292441529 364 dbSNP
rs1048132556 371 dbSNP
rs1220326098 374 dbSNP
rs3172297 375 dbSNP
rs1344910258 377 dbSNP
rs1176221081 380 dbSNP
rs1379229980 385 dbSNP
rs1011198520 387 dbSNP
rs62244262 389 dbSNP
rs1388251951 393 dbSNP
rs1055168884 417 dbSNP
rs1459012168 428 dbSNP
rs1323073091 430 dbSNP
rs937803772 438 dbSNP
rs183776667 443 dbSNP
rs1046512 449 dbSNP
rs950189597 451 dbSNP
rs1247286026 454 dbSNP
rs1286497781 459 dbSNP
rs543865618 463 dbSNP
rs930861056 464 dbSNP
rs978059611 471 dbSNP
rs1237015271 472 dbSNP
rs1461398508 475 dbSNP
rs1189447279 483 dbSNP
rs1366657912 488 dbSNP
rs17035860 492 dbSNP
rs964792330 494 dbSNP
rs1421438572 497 dbSNP
rs1473087042 498 dbSNP
rs149027903 500 dbSNP
rs1329586345 517 dbSNP
rs1399588718 518 dbSNP
rs1336655287 523 dbSNP
rs1453481515 523 dbSNP
rs1339214420 528 dbSNP
rs1241302169 531 dbSNP
rs755593518 532 dbSNP
rs536559502 538 dbSNP
rs1320513499 546 dbSNP
rs375438196 549 dbSNP
rs1201658637 554 dbSNP
rs1465951662 554 dbSNP
rs567009117 558 dbSNP
rs1193871318 563 dbSNP
rs191635486 564 dbSNP
rs879029377 565 dbSNP
rs1476735192 566 dbSNP
rs774687292 567 dbSNP
rs1028898768 568 dbSNP
rs976972002 570 dbSNP
rs987302454 578 dbSNP
rs965983314 581 dbSNP
rs1470459967 583 dbSNP
rs1015852185 584 dbSNP
rs1400211208 590 dbSNP
rs1229393738 599 dbSNP
rs1003793372 602 dbSNP
rs888109109 608 dbSNP
rs371193748 609 dbSNP
rs1268761975 617 dbSNP
rs144910119 618 dbSNP
rs1278026923 620 dbSNP
rs1345741533 624 dbSNP
rs1235007189 625 dbSNP
rs1253718121 628 dbSNP
rs958178224 646 dbSNP
rs1205604233 647 dbSNP
rs1288082608 651 dbSNP
rs1487153342 655 dbSNP
rs1026640856 658 dbSNP
rs568111469 667 dbSNP
rs866756769 668 dbSNP
rs1269418447 684 dbSNP
rs75509450 686 dbSNP
rs1433953640 691 dbSNP
rs1201346398 693 dbSNP
rs1375954860 697 dbSNP
rs1012605309 699 dbSNP
rs1437771341 700 dbSNP
rs1159714730 702 dbSNP
rs1389877695 702 dbSNP
rs1001862848 712 dbSNP
rs574750880 712 dbSNP
rs1297934254 713 dbSNP
rs894248686 717 dbSNP
rs1388100135 719 dbSNP
rs752257334 720 dbSNP
rs1046181733 722 dbSNP
rs1239153412 723 dbSNP
rs748757946 726 dbSNP
rs1351417931 733 dbSNP
rs1351620177 736 dbSNP
rs1292202971 739 dbSNP
rs1489355751 740 dbSNP
rs775151821 743 dbSNP
rs187318406 754 dbSNP
rs1405868898 785 dbSNP
rs1418764943 792 dbSNP
rs930932969 792 dbSNP
rs199863699 794 dbSNP
rs747660921 795 dbSNP
rs920830488 798 dbSNP
rs531295725 804 dbSNP
rs1332757722 812 dbSNP
rs1374083270 812 dbSNP
rs201445268 812 dbSNP
rs753948044 812 dbSNP
rs1451048202 813 dbSNP
rs770219447 814 dbSNP
rs1315684343 815 dbSNP
rs1248427831 821 dbSNP
rs1242364521 831 dbSNP
rs745511001 832 dbSNP
rs911851676 842 dbSNP
rs1192547964 843 dbSNP
rs754869422 844 dbSNP
rs1266688548 846 dbSNP
rs1221730205 847 dbSNP
rs1307391437 849 dbSNP
rs987531153 850 dbSNP
rs1199557240 851 dbSNP
rs1240048111 852 dbSNP
rs1456525821 852 dbSNP
rs1231283074 860 dbSNP
rs1041660110 861 dbSNP
rs947326006 862 dbSNP
rs915238742 870 dbSNP
rs1415174646 876 dbSNP
rs1426135409 879 dbSNP
rs989513257 881 dbSNP
rs1163117967 884 dbSNP
rs1366303073 888 dbSNP
rs1465800147 891 dbSNP
rs1303134776 895 dbSNP
rs1397454614 901 dbSNP
rs1445412986 904 dbSNP
rs1438976686 905 dbSNP
rs780948401 908 dbSNP
rs966744365 912 dbSNP
rs932711927 913 dbSNP
rs1394256996 926 dbSNP
rs1311718104 927 dbSNP
rs757983899 928 dbSNP
rs1219435286 930 dbSNP
rs921369551 931 dbSNP
rs1294166947 942 dbSNP
rs556474511 957 dbSNP
rs977289068 962 dbSNP
rs1238192824 979 dbSNP
rs1166578634 983 dbSNP
rs1287547429 984 dbSNP
rs1484507448 1000 dbSNP
rs1180676530 1011 dbSNP
rs1255850696 1016 dbSNP
rs1396419377 1016 dbSNP
rs965576586 1027 dbSNP
rs1431560339 1028 dbSNP
rs751521169 1033 dbSNP
rs982987674 1034 dbSNP
rs1431076951 1037 dbSNP
rs1360434424 1038 dbSNP
rs1464436965 1040 dbSNP
rs952992714 1043 dbSNP
rs1026590046 1045 dbSNP
rs1340824767 1048 dbSNP
rs1269068812 1052 dbSNP
rs564046175 1053 dbSNP
rs894188475 1055 dbSNP
rs1035453749 1058 dbSNP
rs746853794 1066 dbSNP
rs777523969 1073 dbSNP
rs970389479 1074 dbSNP
rs1208592798 1077 dbSNP
rs77029510 1090 dbSNP
rs1248997826 1095 dbSNP
rs1003982319 1113 dbSNP
rs1343580286 1119 dbSNP
rs1280047928 1120 dbSNP
rs149901795 1122 dbSNP
rs1477276568 1123 dbSNP
rs758348493 1124 dbSNP
rs1302186281 1132 dbSNP
rs1041609249 1137 dbSNP
rs1426608338 1138 dbSNP
rs1047919978 1143 dbSNP
rs995404726 1148 dbSNP
rs899452601 1159 dbSNP
rs1391053505 1165 dbSNP
rs1371193947 1167 dbSNP
rs1039262311 1181 dbSNP
rs943598099 1183 dbSNP
rs947275068 1195 dbSNP
rs1310010035 1199 dbSNP
rs1411576550 1205 dbSNP
rs560283950 1230 dbSNP
rs1284256181 1232 dbSNP
rs1488184895 1233 dbSNP
rs867308450 1241 dbSNP
rs1221757306 1251 dbSNP
rs890477341 1256 dbSNP
rs541767441 1260 dbSNP
rs1371146422 1263 dbSNP
rs932675264 1264 dbSNP
rs1051699403 1270 dbSNP
rs574389440 1272 dbSNP
rs1379173623 1273 dbSNP
rs1176257426 1274 dbSNP
rs945494048 1277 dbSNP
rs1379413513 1279 dbSNP
rs1405745205 1280 dbSNP
rs1041130579 1289 dbSNP
rs944152302 1296 dbSNP
rs1325270475 1305 dbSNP
rs1377769872 1313 dbSNP
rs1242895036 1332 dbSNP
rs908701658 1336 dbSNP
rs1350337737 1343 dbSNP
rs1292554151 1347 dbSNP
rs1409121551 1352 dbSNP
rs562583054 1353 dbSNP
rs79081918 1357 dbSNP
rs753851552 1375 dbSNP
rs891730225 1383 dbSNP
rs1458738235 1392 dbSNP
rs926443278 1400 dbSNP
rs577121040 1401 dbSNP
rs567654037 1402 dbSNP
rs549519550 1405 dbSNP
rs970608782 1408 dbSNP
rs141275247 1409 dbSNP
rs1256959308 1427 dbSNP
rs958401263 1440 dbSNP
rs1238601499 1441 dbSNP
rs1035805052 1442 dbSNP
rs6775593 1454 dbSNP
rs967563130 1457 dbSNP
rs1020113849 1467 dbSNP
rs1335681413 1472 dbSNP
rs1011435160 1477 dbSNP
rs1290270607 1478 dbSNP
rs1027146197 1481 dbSNP
rs1354714454 1490 dbSNP
rs544401808 1491 dbSNP
rs1258311602 1503 dbSNP
rs570082921 1513 dbSNP
rs899335259 1514 dbSNP
rs1312143627 1521 dbSNP
rs1271762583 1533 dbSNP
rs1189603627 1536 dbSNP
rs1442907109 1536 dbSNP
rs1017706908 1540 dbSNP
rs893023008 1542 dbSNP
rs1474758480 1551 dbSNP
rs1187415313 1553 dbSNP
rs1424586628 1554 dbSNP
rs549874439 1555 dbSNP
rs1467440265 1556 dbSNP
rs1394229794 1560 dbSNP
rs1050334917 1565 dbSNP
rs996534942 1569 dbSNP
rs1395923925 1571 dbSNP
rs899821765 1575 dbSNP
rs147797896 1578 dbSNP
rs1007790845 1601 dbSNP
rs1041471742 1611 dbSNP
rs183421244 1612 dbSNP
rs1279301225 1614 dbSNP
rs1341990080 1624 dbSNP
rs1216458864 1627 dbSNP
rs945368703 1628 dbSNP
rs1452588788 1639 dbSNP
rs1345143965 1643 dbSNP
rs1202039600 1644 dbSNP
rs1276429113 1651 dbSNP
rs1485335720 1654 dbSNP
rs536989455 1655 dbSNP
rs533149751 1656 dbSNP
rs1054289389 1659 dbSNP
rs1047187464 1661 dbSNP
rs936740943 1663 dbSNP
rs564189992 1667 dbSNP
rs1160699807 1673 dbSNP
rs1478400143 1674 dbSNP
rs931489825 1675 dbSNP
rs1174771671 1676 dbSNP
rs374319518 1682 dbSNP
rs767816505 1685 dbSNP
rs920138795 1700 dbSNP
rs557644322 1702 dbSNP
rs1426147533 1706 dbSNP
rs193181202 1713 dbSNP
rs570395475 1718 dbSNP
rs980581688 1725 dbSNP
rs1234763747 1726 dbSNP
rs1463690618 1729 dbSNP
rs1270209161 1731 dbSNP
rs1209615973 1745 dbSNP
rs1334170392 1748 dbSNP
rs144367648 1749 dbSNP
rs1487204030 1750 dbSNP
rs1242509022 1757 dbSNP
rs917830602 1760 dbSNP
rs1452468966 1762 dbSNP
rs764636467 1763 dbSNP
rs982483290 1772 dbSNP
rs1393393098 1773 dbSNP
rs967098286 1776 dbSNP
rs763557047 1795 dbSNP
rs1342250951 1797 dbSNP
rs951120199 1800 dbSNP
rs1382476143 1807 dbSNP
rs1313132063 1808 dbSNP
rs1026615373 1812 dbSNP
rs1390993451 1817 dbSNP
rs1020061560 1821 dbSNP
rs1362807038 1824 dbSNP
rs974250290 1826 dbSNP
rs527360429 1832 dbSNP
rs1311379761 1835 dbSNP
rs1017758302 1839 dbSNP
rs1238047481 1843 dbSNP
rs140521506 1850 dbSNP
rs1029274852 1860 dbSNP
rs1211910920 1862 dbSNP
rs996093079 1864 dbSNP
rs901780846 1865 dbSNP
rs1041025012 1870 dbSNP
rs1459880930 1873 dbSNP
rs544884194 1878 dbSNP
rs890748099 1881 dbSNP
rs1447987453 1886 dbSNP
rs1417920563 1889 dbSNP
rs1158794860 1890 dbSNP
rs887158035 1891 dbSNP
rs1009788020 1902 dbSNP
rs892475023 1903 dbSNP
rs1047137865 1907 dbSNP
rs188708051 1916 dbSNP
rs1446912817 1917 dbSNP
rs1189376699 1922 dbSNP
rs1332848514 1932 dbSNP
rs1371050811 1937 dbSNP
rs1390814650 1938 dbSNP
rs1313141508 1941 dbSNP
rs1342053615 1943 dbSNP
rs1468255824 1951 dbSNP
rs528405918 1952 dbSNP
rs1211761736 1953 dbSNP
rs1358339280 1959 dbSNP
rs116001782 1964 dbSNP
rs1177150669 1965 dbSNP
rs1455897956 1965 dbSNP
rs756181861 1965 dbSNP
rs1425959063 1966 dbSNP
rs949195818 1969 dbSNP
rs1227591914 1970 dbSNP
rs1465852630 1972 dbSNP
rs1172183373 1974 dbSNP
rs1352318876 1975 dbSNP
rs917715851 1977 dbSNP
rs1303358951 1978 dbSNP
rs1047429269 1979 dbSNP
rs898661125 1980 dbSNP
rs1292496995 1983 dbSNP
rs115211110 1991 dbSNP
rs937591402 1994 dbSNP
rs1219542320 1995 dbSNP
rs1330204726 2001 dbSNP
rs1305843294 2003 dbSNP
rs928901258 2008 dbSNP
rs1204393877 2017 dbSNP
rs1257121401 2020 dbSNP
rs1484553824 2021 dbSNP
rs1320982087 2022 dbSNP
rs981104602 2023 dbSNP
rs973754096 2033 dbSNP
rs762147431 2046 dbSNP
rs1387970191 2051 dbSNP
rs1257337536 2057 dbSNP
rs1390860072 2059 dbSNP
rs1167780214 2061 dbSNP
rs1477934771 2063 dbSNP
rs1195409682 2067 dbSNP
rs945695394 2069 dbSNP
rs964170215 2070 dbSNP
rs1176224454 2073 dbSNP
rs1360798618 2074 dbSNP
rs1432862295 2099 dbSNP
rs912938112 2100 dbSNP
rs1392408493 2112 dbSNP
rs910970539 2116 dbSNP
rs150581233 2121 dbSNP
rs532416747 2126 dbSNP
rs1359895947 2133 dbSNP
rs1214039737 2135 dbSNP
rs989889010 2137 dbSNP
rs1302118633 2151 dbSNP
rs1350674993 2153 dbSNP
rs1232813164 2157 dbSNP
rs1279983426 2165 dbSNP
rs1488822746 2167 dbSNP
rs1218285415 2180 dbSNP
rs986475553 2184 dbSNP
rs1485366036 2187 dbSNP
rs954883874 2193 dbSNP
rs565265181 2199 dbSNP
rs1426733880 2202 dbSNP
rs1030428802 2203 dbSNP
rs1010252586 2212 dbSNP
rs12633016 2213 dbSNP
rs957135014 2215 dbSNP
rs183942446 2222 dbSNP
rs956958268 2230 dbSNP
rs1316020910 2233 dbSNP
rs1343623400 2234 dbSNP
rs1453972835 2239 dbSNP
rs1052688751 2242 dbSNP
rs938335251 2246 dbSNP
rs1452203715 2247 dbSNP
rs1028806559 2248 dbSNP
rs1204346269 2249 dbSNP
rs1354800047 2257 dbSNP
rs540398230 2258 dbSNP
rs1282682473 2259 dbSNP
rs1315954020 2260 dbSNP
rs573281384 2261 dbSNP
rs1000863739 2262 dbSNP
rs1466776316 2262 dbSNP
rs555238953 2263 dbSNP
rs905316600 2263 dbSNP
rs1008144496 2264 dbSNP
rs1344079219 2264 dbSNP
rs1272671930 2265 dbSNP
rs887107191 2265 dbSNP
rs1025634779 2266 dbSNP
rs1013640549 2267 dbSNP
rs1046867943 2267 dbSNP
rs1212488322 2267 dbSNP
rs1378293878 2267 dbSNP
rs1396735176 2267 dbSNP
rs1400280461 2267 dbSNP
rs1407051832 2267 dbSNP
rs1445068870 2267 dbSNP
rs576895072 2267 dbSNP
rs71091694 2267 dbSNP
rs79047617 2267 dbSNP
rs896331175 2267 dbSNP
rs1258217123 2268 dbSNP
rs1439477662 2269 dbSNP
rs995537777 2269 dbSNP
rs1234971876 2270 dbSNP
rs898600157 2270 dbSNP
rs1055946285 2271 dbSNP
rs1420259386 2272 dbSNP
rs1460137069 2272 dbSNP
rs1164293598 2273 dbSNP
rs1327472964 2273 dbSNP
rs1354264602 2273 dbSNP
rs1401145408 2273 dbSNP
rs1412071990 2273 dbSNP
rs796639008 2273 dbSNP
rs1295543546 2274 dbSNP
rs1306943084 2275 dbSNP
rs929914034 2275 dbSNP
rs139275286 2277 dbSNP
rs528948423 2277 dbSNP
rs1373001085 2278 dbSNP
rs1193960023 2279 dbSNP
rs1308986602 2279 dbSNP
rs1212708807 2280 dbSNP
rs1255215966 2280 dbSNP
rs1272227521 2280 dbSNP
rs1442980745 2280 dbSNP
rs1434448719 2282 dbSNP
rs1423535344 2284 dbSNP
rs1174466884 2290 dbSNP
rs1478517100 2292 dbSNP
rs1363288437 2296 dbSNP
rs1373681876 2300 dbSNP
rs919847617 2301 dbSNP
rs1419387768 2312 dbSNP
rs1415610772 2325 dbSNP
rs543249206 2333 dbSNP
rs575880817 2334 dbSNP
rs557704052 2340 dbSNP
rs539306078 2341 dbSNP
rs1224578997 2342 dbSNP
rs1327625238 2342 dbSNP
rs551606066 2342 dbSNP
rs942374312 2342 dbSNP
rs1482013490 2348 dbSNP
rs1345616799 2358 dbSNP
rs1236428903 2362 dbSNP
rs142718420 2363 dbSNP
rs1205807635 2368 dbSNP
rs1210379602 2371 dbSNP
rs1262670724 2377 dbSNP
rs955102868 2384 dbSNP
rs1191111583 2387 dbSNP
rs558522271 2395 dbSNP
rs1276255842 2396 dbSNP
rs1393614352 2403 dbSNP
rs907420770 2406 dbSNP
rs1412064851 2408 dbSNP
rs1046400227 2412 dbSNP
rs1380234441 2413 dbSNP
rs562753813 2413 dbSNP
rs776108223 2426 dbSNP
rs946313799 2438 dbSNP
rs76034534 2441 dbSNP
rs746727708 2445 dbSNP
rs1301190983 2451 dbSNP
rs777551847 2452 dbSNP
rs190908665 2455 dbSNP
rs1262340121 2458 dbSNP
rs1351832113 2458 dbSNP
rs1353097863 2460 dbSNP
rs558614231 2471 dbSNP
rs921689359 2490 dbSNP
rs748068269 2491 dbSNP
rs1195991555 2493 dbSNP
rs974567765 2494 dbSNP
rs966274628 2495 dbSNP
rs1182972074 2499 dbSNP
rs1365930350 2504 dbSNP
rs1451097491 2511 dbSNP
rs1018818952 2513 dbSNP
rs4678557 2516 dbSNP
rs1025935221 2525 dbSNP
rs1370151877 2527 dbSNP
rs1447498845 2549 dbSNP
rs529860849 2556 dbSNP
rs1308802877 2557 dbSNP
rs568675464 2563 dbSNP
rs1333772955 2567 dbSNP
rs1237102677 2568 dbSNP
rs9311149 2570 dbSNP
rs1412807687 2572 dbSNP
rs1335786386 2586 dbSNP
rs750544261 2587 dbSNP
rs1025582383 2592 dbSNP
rs1468415184 2593 dbSNP
rs1196894575 2603 dbSNP
rs898285844 2607 dbSNP
rs184918526 2608 dbSNP
rs1472467300 2610 dbSNP
rs1235512867 2613 dbSNP
rs182336915 2616 dbSNP
rs1442612122 2620 dbSNP
rs942593958 2621 dbSNP
rs374863070 2624 dbSNP
rs1034858241 2627 dbSNP
rs1206463297 2630 dbSNP
rs1001663690 2640 dbSNP
rs907354066 2642 dbSNP
rs1393116163 2649 dbSNP
rs1462372891 2652 dbSNP
rs1299846117 2653 dbSNP
rs1394004263 2655 dbSNP
rs1390581373 2660 dbSNP
rs1313205230 2661 dbSNP
rs1356330261 2665 dbSNP
rs1050700232 2668 dbSNP
rs1045958423 2669 dbSNP
rs1291448312 2671 dbSNP
rs1334304437 2671 dbSNP
rs1205782748 2675 dbSNP
rs776120018 2691 dbSNP
rs1479968120 2698 dbSNP
rs933771426 2700 dbSNP
rs772322353 2711 dbSNP
rs912972652 2714 dbSNP
rs540609487 2722 dbSNP
rs1268286573 2724 dbSNP
rs1416471730 2725 dbSNP
rs1428619116 2726 dbSNP
rs190102732 2732 dbSNP
rs1010472714 2735 dbSNP
rs1371233263 2737 dbSNP
rs935515475 2746 dbSNP
rs1313245048 2750 dbSNP
rs892069724 2756 dbSNP
rs1286288794 2764 dbSNP
rs1311318458 2765 dbSNP
rs1378787891 2772 dbSNP
rs1449155700 2775 dbSNP
rs925406814 2776 dbSNP
rs1054094003 2789 dbSNP
rs1297902829 2791 dbSNP
rs561391451 2792 dbSNP
rs1318716384 2795 dbSNP
rs1281414034 2797 dbSNP
rs921661650 2817 dbSNP
rs1039192493 2835 dbSNP
rs944507650 2841 dbSNP
rs1256339911 2843 dbSNP
rs969602478 2851 dbSNP
rs1187757027 2854 dbSNP
rs1023663141 2857 dbSNP
rs992153570 2859 dbSNP
rs1174222553 2861 dbSNP
rs186696776 2861 dbSNP
rs746287279 2864 dbSNP
rs1172828039 2868 dbSNP
rs983272538 2869 dbSNP
rs1025731935 2872 dbSNP
rs751802341 2890 dbSNP
rs778301392 2891 dbSNP
rs898342079 2891 dbSNP
rs1434959461 2902 dbSNP
rs181680832 2902 dbSNP
rs1350741944 2915 dbSNP
rs1232510151 2916 dbSNP
rs1411590452 2918 dbSNP
rs920527600 2919 dbSNP
rs974012470 2920 dbSNP
rs1217510305 2930 dbSNP
rs963039071 2939 dbSNP
rs1034386638 2943 dbSNP
rs144259323 2947 dbSNP
rs1193775329 2965 dbSNP
rs545426317 2968 dbSNP
rs1247198690 2971 dbSNP
rs933653910 2974 dbSNP
rs1186208544 2976 dbSNP
rs1466020670 2986 dbSNP
rs578190411 2993 dbSNP
rs142768317 2996 dbSNP
rs1456753678 2998 dbSNP
rs1010421685 2999 dbSNP
rs892016895 3000 dbSNP
rs935719226 3001 dbSNP
rs1054715222 3008 dbSNP
rs1225068036 3010 dbSNP
rs1304388624 3016 dbSNP
rs1328103107 3023 dbSNP
rs560703255 3026 dbSNP
rs1274568713 3029 dbSNP
rs1220237996 3035 dbSNP
rs948320941 3039 dbSNP
rs1212998327 3041 dbSNP
rs916834099 3042 dbSNP
rs1471051614 3044 dbSNP
rs1175312960 3057 dbSNP
rs1406024439 3059 dbSNP
rs533785936 3061 dbSNP
rs572476883 3066 dbSNP
rs1000491699 3067 dbSNP
rs1165727712 3072 dbSNP
rs190099112 3076 dbSNP
rs74771509 3082 dbSNP
rs1460273544 3098 dbSNP
rs1229404994 3099 dbSNP
rs373738120 3101 dbSNP
rs9852434 3107 dbSNP
rs550745669 3108 dbSNP
rs911661897 3109 dbSNP
rs1294521699 3114 dbSNP
rs1332072761 3115 dbSNP
rs1227627252 3118 dbSNP
rs1292986101 3130 dbSNP
rs577688978 3133 dbSNP
rs1047527207 3137 dbSNP
rs1273600651 3142 dbSNP
rs1434350256 3143 dbSNP
rs1006670203 3145 dbSNP
rs1351710960 3161 dbSNP
rs1166760194 3169 dbSNP
rs1250875803 3172 dbSNP
rs1482816352 3174 dbSNP
rs186847805 3177 dbSNP
rs1389304610 3181 dbSNP
rs920475348 3182 dbSNP
rs1474255989 3185 dbSNP
rs1166534143 3193 dbSNP
rs765876325 3204 dbSNP
rs557820260 3208 dbSNP
rs758923128 3211 dbSNP
rs1029536389 3215 dbSNP
rs959344850 3220 dbSNP
rs1261945310 3222 dbSNP
rs1414978217 3223 dbSNP
rs182197082 3224 dbSNP
rs1487184436 3227 dbSNP
rs1053173848 3233 dbSNP
rs980143268 3238 dbSNP
rs1341372191 3241 dbSNP
rs546552933 3243 dbSNP
rs1024402455 3248 dbSNP
rs1348360437 3251 dbSNP
rs1010369485 3252 dbSNP
rs1483051294 3257 dbSNP
rs1440978354 3276 dbSNP
rs1186919580 3285 dbSNP
rs1272907452 3294 dbSNP
rs1231130779 3296 dbSNP
rs189492988 3302 dbSNP
rs1343358489 3304 dbSNP
rs561252861 3309 dbSNP
rs1242794075 3311 dbSNP
rs1476636885 3313 dbSNP
rs1300792639 3316 dbSNP
rs1167299169 3318 dbSNP
rs74903284 3319 dbSNP
rs1033212888 3332 dbSNP
rs1043959757 3333 dbSNP
rs1373234407 3336 dbSNP
rs1000842754 3338 dbSNP
rs1327682517 3374 dbSNP
rs1428500931 3379 dbSNP
rs1296808796 3381 dbSNP
rs1294262322 3385 dbSNP
rs1405459234 3386 dbSNP
rs1236219344 3388 dbSNP
rs900777909 3394 dbSNP
rs183747362 3399 dbSNP
rs1200097064 3406 dbSNP
rs1284998859 3407 dbSNP
rs1239097135 3409 dbSNP
rs1186813443 3420 dbSNP
rs1247912651 3431 dbSNP
rs1369917594 3431 dbSNP
rs1306138961 3433 dbSNP
rs948207652 3435 dbSNP
rs1376296083 3444 dbSNP
rs1017665678 3446 dbSNP
rs780615942 3447 dbSNP
rs138276996 3462 dbSNP
rs890171392 3465 dbSNP
rs376108779 3469 dbSNP
rs754531510 3471 dbSNP
rs1047474097 3482 dbSNP
rs1174833786 3490 dbSNP
rs1319384638 3510 dbSNP
rs929100252 3516 dbSNP
rs1056745361 3520 dbSNP
rs939575865 3521 dbSNP
rs1330333983 3528 dbSNP
rs898988502 3530 dbSNP
rs1232747125 3531 dbSNP
rs1426642743 3533 dbSNP
rs545593687 3538 dbSNP
rs1037562289 3539 dbSNP
rs1267650514 3542 dbSNP
rs937900771 3552 dbSNP
rs751445999 3556 dbSNP
rs578076169 3558 dbSNP
rs985469856 3566 dbSNP
rs980474988 3572 dbSNP
rs950033161 3576 dbSNP
rs917293883 3577 dbSNP
rs1327715315 3585 dbSNP
rs1471440928 3597 dbSNP
rs1157702329 3598 dbSNP
rs1417961498 3600 dbSNP
rs953887468 3603 dbSNP
rs1291739494 3610 dbSNP
rs988886699 3610 dbSNP
rs1391730054 3614 dbSNP
rs1029420375 3620 dbSNP
rs956137707 3621 dbSNP
rs1337739126 3622 dbSNP
rs780077869 3624 dbSNP
rs35149869 3637 dbSNP
rs1031362286 3639 dbSNP
rs1264179075 3640 dbSNP
rs1488462047 3641 dbSNP
rs1196734055 3645 dbSNP
rs1253121491 3647 dbSNP
rs1000269549 3654 dbSNP
rs191605651 3656 dbSNP
rs776220260 3657 dbSNP
rs978972195 3658 dbSNP
rs1475891847 3660 dbSNP
rs904152258 3661 dbSNP
rs541327848 3663 dbSNP
rs1227816910 3666 dbSNP
rs1348731865 3668 dbSNP
rs1044178051 3681 dbSNP
rs965303051 3683 dbSNP
rs1462482508 3684 dbSNP
rs770425726 3684 dbSNP
rs1017865897 3686 dbSNP
rs1008942884 3691 dbSNP
rs1012644331 3694 dbSNP
rs895335457 3707 dbSNP
rs1408185137 3708 dbSNP
rs1302102131 3711 dbSNP
rs1056628877 3714 dbSNP
rs1307682733 3716 dbSNP
rs890120457 3722 dbSNP
rs1416665797 3724 dbSNP
rs1360583423 3725 dbSNP
rs750183212 3727 dbSNP
rs1310749772 3732 dbSNP
rs765151467 3735 dbSNP
rs1253405797 3753 dbSNP
rs1340516048 3755 dbSNP
rs1204961956 3758 dbSNP
rs1257746830 3759 dbSNP
rs1486488357 3763 dbSNP
rs1471952107 3764 dbSNP
rs1409148890 3765 dbSNP
rs1288937170 3775 dbSNP
rs1428976148 3775 dbSNP
rs1388038991 3777 dbSNP
rs1428842878 3784 dbSNP
rs1025973156 3788 dbSNP
rs1174069741 3791 dbSNP
rs918827185 3793 dbSNP
rs1184885413 3794 dbSNP
rs1037074181 3796 dbSNP
rs941359508 3798 dbSNP
rs1420275539 3804 dbSNP
rs909851783 3804 dbSNP
rs985522303 3806 dbSNP
rs932712669 3808 dbSNP
rs1255890267 3809 dbSNP
rs1491490141 3809 dbSNP
rs1491147179 3810 dbSNP
rs1491257292 3810 dbSNP
rs4678923 3810 dbSNP
rs1180519285 3811 dbSNP
rs1448858919 3811 dbSNP
rs954676598 3811 dbSNP
rs1194013735 3812 dbSNP
rs1431656912 3812 dbSNP
rs200607906 3812 dbSNP
rs200518002 3813 dbSNP
rs996629567 3813 dbSNP
rs1304538044 3814 dbSNP
rs199570773 3814 dbSNP
rs964827340 3814 dbSNP
rs1263935487 3815 dbSNP
rs1021852675 3816 dbSNP
rs1330090762 3816 dbSNP
rs1208358499 3817 dbSNP
rs1352164843 3818 dbSNP
rs1457135757 3818 dbSNP
rs1327079843 3819 dbSNP
rs1293376906 3820 dbSNP
rs993187364 3820 dbSNP
rs1491053161 3821 dbSNP
rs1241078342 3822 dbSNP
rs780849001 3822 dbSNP
rs199701955 3823 dbSNP
rs201918674 3824 dbSNP
rs10575530 3825 dbSNP
rs1220544523 3825 dbSNP
rs1233420730 3825 dbSNP
rs1249645576 3825 dbSNP
rs1295879432 3825 dbSNP
rs1327892660 3825 dbSNP
rs1481042332 3825 dbSNP
rs1491137922 3825 dbSNP
rs552736653 3825 dbSNP
rs755955467 3825 dbSNP
rs769071926 3825 dbSNP
rs869240885 3825 dbSNP
rs1165800389 3826 dbSNP
rs1416583708 3826 dbSNP
rs1472290240 3826 dbSNP
rs1491522778 3826 dbSNP
rs922460053 3827 dbSNP
rs1411224007 3828 dbSNP
rs1311714782 3832 dbSNP
rs898935908 3833 dbSNP
rs1394030301 3845 dbSNP
rs1414866532 3850 dbSNP
rs1285509425 3854 dbSNP
rs1381105020 3855 dbSNP
rs976977032 3862 dbSNP
rs1336917428 3863 dbSNP
rs956014344 3864 dbSNP
rs1032010974 3865 dbSNP
rs978668079 3871 dbSNP
rs968388927 3874 dbSNP
rs1482889964 3880 dbSNP
rs1456384600 3888 dbSNP
rs1385801470 3889 dbSNP
rs1160819654 3890 dbSNP
rs1188316833 3890 dbSNP
rs1037909345 3891 dbSNP
rs1368359970 3893 dbSNP
rs1012695471 3894 dbSNP
rs1167179390 3895 dbSNP
rs1425863551 3906 dbSNP
rs895556338 3911 dbSNP
rs1188160234 3915 dbSNP
rs1035230405 3919 dbSNP
rs1447135146 3921 dbSNP
rs1270669288 3924 dbSNP
rs937866038 3925 dbSNP
rs1367314282 3935 dbSNP
rs572539566 3936 dbSNP
rs770167842 3937 dbSNP
rs1205840249 3943 dbSNP
rs1341648256 3945 dbSNP
rs1201250389 3946 dbSNP
rs554120728 3948 dbSNP
rs535987364 3949 dbSNP
rs988834600 3951 dbSNP
rs1209558447 3954 dbSNP
rs934710126 3954 dbSNP
rs1451944333 3967 dbSNP
rs1187009177 3970 dbSNP
rs1389955355 3972 dbSNP
rs926073751 3975 dbSNP
rs1454418212 3976 dbSNP
rs979307025 3980 dbSNP
rs964911622 3986 dbSNP
rs941592789 3992 dbSNP
rs1399673495 3994 dbSNP
rs888464407 4000 dbSNP
rs1049696519 4002 dbSNP
rs1318481203 4003 dbSNP
rs1361252984 4005 dbSNP
rs762055474 4016 dbSNP
rs1018221226 4023 dbSNP
rs1390728115 4025 dbSNP
rs932766477 4030 dbSNP
rs1296511704 4038 dbSNP
rs1315555441 4043 dbSNP
rs987735531 4058 dbSNP
rs1433888231 4062 dbSNP
rs1276800516 4064 dbSNP
rs1343222467 4078 dbSNP
rs954989313 4086 dbSNP
rs1218706787 4099 dbSNP
rs1025909600 4103 dbSNP
rs1382250056 4106 dbSNP
rs760373975 4107 dbSNP
rs1389402804 4109 dbSNP
rs976826105 4129 dbSNP
rs1452526146 4131 dbSNP
rs9827364 4133 dbSNP
rs1375564909 4147 dbSNP
rs1477524916 4162 dbSNP
rs1159182921 4165 dbSNP
rs556738909 4166 dbSNP
rs924443358 4177 dbSNP
rs146338569 4180 dbSNP
rs963060199 4187 dbSNP
rs979107568 4192 dbSNP
rs769008374 4193 dbSNP
rs750177653 4200 dbSNP
rs1329506110 4203 dbSNP
rs1436038871 4212 dbSNP
rs116276543 4228 dbSNP
rs1194202050 4233 dbSNP
rs1331349359 4236 dbSNP
rs764252301 4246 dbSNP
rs959817442 4247 dbSNP
rs760878139 4250 dbSNP
rs775832318 4252 dbSNP
rs772688303 4254 dbSNP
rs759986957 4256 dbSNP
rs774659653 4258 dbSNP
rs771289842 4260 dbSNP
rs747742893 4261 dbSNP
rs1368972504 4263 dbSNP
rs993225972 4266 dbSNP
rs1161178511 4284 dbSNP
rs868621687 4291 dbSNP
rs1329994658 4292 dbSNP
rs780881782 4300 dbSNP
rs1404516909 4304 dbSNP
rs1046683399 4319 dbSNP
rs1013496540 4329 dbSNP
rs747211029 4331 dbSNP
rs1408069788 4341 dbSNP
rs1053084497 4343 dbSNP
rs934649735 4356 dbSNP
rs1366775439 4358 dbSNP
rs747974179 4378 dbSNP
rs1043136862 4384 dbSNP
rs1247629998 4407 dbSNP
rs1264005874 4409 dbSNP
rs1356119351 4412 dbSNP
rs1372813082 4413 dbSNP
rs9860494 4429 dbSNP
rs1276329552 4439 dbSNP
rs188586049 4442 dbSNP
rs910700246 4447 dbSNP
rs987615126 4449 dbSNP
rs1465748489 4450 dbSNP
rs1201154947 4451 dbSNP
rs901140926 4464 dbSNP
rs1269450457 4466 dbSNP
rs1204366162 4469 dbSNP
rs1481911457 4471 dbSNP
rs1274934588 4472 dbSNP
rs11294180 4473 dbSNP
rs1170323608 4473 dbSNP
rs1185364558 4473 dbSNP
rs1257601814 4473 dbSNP
rs1261092384 4473 dbSNP
rs1270031055 4473 dbSNP
rs1372626818 4473 dbSNP
rs1425447962 4473 dbSNP
rs1430128584 4473 dbSNP
rs534548803 4473 dbSNP
rs746492228 4473 dbSNP
rs763094166 4473 dbSNP
rs1206927266 4474 dbSNP
rs1229581525 4474 dbSNP
rs1491395205 4474 dbSNP
rs1196002328 4475 dbSNP
rs1256026199 4476 dbSNP
rs1343912534 4477 dbSNP
rs1198273434 4478 dbSNP
rs867617025 4481 dbSNP
rs1190201083 4496 dbSNP
rs1388094763 4504 dbSNP
rs558590780 4507 dbSNP
rs59548883 4511 dbSNP
rs1224766843 4512 dbSNP
rs778777579 4521 dbSNP
rs1345623532 4524 dbSNP
rs1447842147 4525 dbSNP
rs1288211959 4530 dbSNP
rs534895692 4531 dbSNP
rs574871323 4534 dbSNP
rs1467645455 4535 dbSNP
rs971673052 4550 dbSNP
rs1301230572 4553 dbSNP
rs139834071 4559 dbSNP
rs1436473438 4567 dbSNP
rs1322925661 4568 dbSNP
rs1016383158 4580 dbSNP
rs1363496933 4585 dbSNP
rs376961936 4587 dbSNP
rs1001943212 4600 dbSNP
rs866508624 4604 dbSNP
rs758315264 4605 dbSNP
rs1230415310 4606 dbSNP
rs1042882725 4611 dbSNP
rs1174557513 4625 dbSNP
rs1024780168 4632 dbSNP
rs947321094 4640 dbSNP
rs1464256697 4645 dbSNP
rs1013442776 4646 dbSNP
rs991364165 4647 dbSNP
rs530886248 4648 dbSNP
rs563806852 4650 dbSNP
rs1471600549 4652 dbSNP
rs114757958 4656 dbSNP
rs1161978268 4658 dbSNP
rs1182305457 4664 dbSNP
rs1000817042 4671 dbSNP
rs961801057 4672 dbSNP
rs1294541787 4675 dbSNP
rs1133661 4679 dbSNP
rs1043471719 4682 dbSNP
rs1384716890 4685 dbSNP
rs943441450 4688 dbSNP
rs34898129 4692 dbSNP
rs910648647 4697 dbSNP
rs1005666046 4698 dbSNP
rs1323543917 4699 dbSNP
rs556436605 4702 dbSNP
rs1221957276 4703 dbSNP
rs536545584 4703 dbSNP
rs1376227304 4707 dbSNP
rs919461450 4708 dbSNP
rs972286771 4710 dbSNP
rs185017451 4713 dbSNP
rs963990873 4714 dbSNP
rs1165845230 4720 dbSNP
rs1352012757 4724 dbSNP
rs757345723 4725 dbSNP
rs1302119611 4728 dbSNP
rs999374740 4728 dbSNP
rs529538959 4731 dbSNP
rs980859173 4733 dbSNP
rs969140735 4734 dbSNP
rs1024732236 4745 dbSNP
rs560587638 4748 dbSNP
rs1319681842 4749 dbSNP
rs542222138 4751 dbSNP
rs1291319177 4752 dbSNP
rs369313744 4754 dbSNP
rs113277655 4755 dbSNP
rs915712621 4759 dbSNP
rs778189983 4763 dbSNP
rs1470036066 4776 dbSNP
rs757173786 4778 dbSNP
rs557038770 4779 dbSNP
rs938557163 4785 dbSNP
rs1021605741 4796 dbSNP
rs1422403001 4804 dbSNP
rs867085536 4808 dbSNP
rs1055095 4812 dbSNP
rs1370729690 4812 dbSNP
rs889174278 4819 dbSNP
rs1051791031 4824 dbSNP
rs1353440606 4825 dbSNP
rs138907552 4826 dbSNP
rs570197667 4827 dbSNP
rs962134356 4838 dbSNP
rs1376975765 4843 dbSNP
rs1244962834 4848 dbSNP
rs1298074128 4860 dbSNP
rs908958683 4861 dbSNP
rs897980756 4868 dbSNP
rs1270905780 4869 dbSNP
rs952896596 4870 dbSNP
rs1210960726 4873 dbSNP
rs1028426318 4874 dbSNP
rs1185049720 4875 dbSNP
rs1461540207 4881 dbSNP
rs1391202764 4896 dbSNP
rs1450893147 4904 dbSNP
rs1166309575 4905 dbSNP
rs1418403523 4913 dbSNP
rs1246856944 4915 dbSNP
rs997081148 4916 dbSNP
rs1206328154 4918 dbSNP
rs965647673 4921 dbSNP
rs1036518374 4924 dbSNP
rs998865305 4927 dbSNP
rs903144702 4931 dbSNP
rs1043169878 4936 dbSNP
rs1280832601 4940 dbSNP
rs1460340908 4946 dbSNP
rs942267731 4953 dbSNP
rs1011638471 4956 dbSNP
rs1354682168 4957 dbSNP
rs1466508080 4969 dbSNP
rs1191573938 4971 dbSNP
rs765782836 4978 dbSNP
rs1478162081 4989 dbSNP
rs1173747789 4993 dbSNP
rs1317678486 4997 dbSNP
rs894331404 5001 dbSNP
rs1159781079 5013 dbSNP
rs1246955049 5014 dbSNP
rs909473246 5015 dbSNP
rs1432628863 5024 dbSNP
rs1317449214 5056 dbSNP
rs980423748 5064 dbSNP
rs947718116 5065 dbSNP
rs917622463 5071 dbSNP
rs1326016643 5075 dbSNP
rs552890719 5078 dbSNP
rs755514690 5083 dbSNP
rs1276642005 5086 dbSNP
rs188481028 5087 dbSNP
rs1318819053 5090 dbSNP
rs567577220 5096 dbSNP
rs555653342 5101 dbSNP
rs1345877133 5119 dbSNP
rs1318813187 5124 dbSNP
rs879857949 5130 dbSNP
rs967954221 5136 dbSNP
rs150267463 5139 dbSNP
rs1284020004 5142 dbSNP
rs1404765666 5155 dbSNP
rs1200573518 5160 dbSNP
rs1266388887 5163 dbSNP
rs938625004 5166 dbSNP
rs765903760 5172 dbSNP
rs907107440 5181 dbSNP
rs1451561452 5186 dbSNP
rs1391216669 5191 dbSNP
rs1036475356 5193 dbSNP
rs1325741163 5197 dbSNP
rs553797838 5198 dbSNP
rs1165292016 5200 dbSNP
rs371152727 5207 dbSNP
rs1289086325 5208 dbSNP
rs1389128773 5209 dbSNP
rs1352801676 5211 dbSNP
rs908855071 5212 dbSNP
rs1237559203 5215 dbSNP
rs984525524 5226 dbSNP
rs1357466998 5227 dbSNP
rs1006843990 5231 dbSNP
rs1486522454 5240 dbSNP
rs931717162 5246 dbSNP
rs569916535 5268 dbSNP
rs975544870 5272 dbSNP
rs551885474 5273 dbSNP
rs1417184038 5278 dbSNP
rs1221457050 5284 dbSNP
rs1450443194 5288 dbSNP
rs1294358271 5291 dbSNP
rs1180973910 5292 dbSNP
rs1369029436 5295 dbSNP
rs1473654472 5304 dbSNP
rs1019868750 5314 dbSNP
rs1030314202 5316 dbSNP
rs1161507721 5320 dbSNP
rs1363886017 5321 dbSNP
rs533244528 5323 dbSNP
rs1308678278 5326 dbSNP
rs1398760736 5329 dbSNP
rs997544181 5333 dbSNP
rs1389800406 5334 dbSNP
rs1306881253 5346 dbSNP
rs897926976 5355 dbSNP
rs1036464687 5358 dbSNP
rs1341662900 5358 dbSNP
rs942195675 5370 dbSNP
rs1341922347 5372 dbSNP
rs1295599688 5381 dbSNP
rs888001486 5386 dbSNP
rs1045714983 5390 dbSNP
rs1052945796 5415 dbSNP
rs1479353511 5415 dbSNP
rs1194798584 5421 dbSNP
rs1274402071 5424 dbSNP
rs1444074990 5425 dbSNP
rs1181447100 5430 dbSNP
rs566308229 5432 dbSNP
rs547573650 5433 dbSNP
rs1444189198 5437 dbSNP
rs1021610979 5439 dbSNP
rs1375045865 5440 dbSNP
rs1460527389 5451 dbSNP
rs1304914047 5453 dbSNP
rs1011691068 5455 dbSNP
rs779343250 5455 dbSNP
rs894550620 5462 dbSNP
rs1425008769 5463 dbSNP
rs1034215507 5464 dbSNP
rs1229131987 5466 dbSNP
rs1299354553 5468 dbSNP
rs1002704217 5479 dbSNP
rs1225983455 5480 dbSNP
rs141118567 5484 dbSNP
rs1346983234 5492 dbSNP
rs991851839 5496 dbSNP
rs1419583081 5498 dbSNP
rs1242514493 5499 dbSNP
rs935037713 5505 dbSNP
rs764420225 5507 dbSNP
rs1190353055 5508 dbSNP
rs923690682 5511 dbSNP
rs562045547 5522 dbSNP
rs1169750009 5524 dbSNP
rs371467103 5525 dbSNP
rs1378313368 5532 dbSNP
rs1471025003 5545 dbSNP
rs1174862371 5550 dbSNP
rs1406081027 5551 dbSNP
rs1436257430 5554 dbSNP
rs1036287591 5560 dbSNP
rs968280304 5570 dbSNP
rs911099286 5577 dbSNP
rs1271619600 5600 dbSNP
rs1301294338 5609 dbSNP
rs1346827096 5614 dbSNP
rs985763928 5617 dbSNP
rs113178644 5620 dbSNP
rs1329841413 5624 dbSNP
rs530564947 5625 dbSNP
rs1030260482 5630 dbSNP
rs563117100 5631 dbSNP
rs146917927 5634 dbSNP
rs887470211 5635 dbSNP
rs1048700349 5642 dbSNP
rs1186169545 5647 dbSNP
rs1268368734 5653 dbSNP
rs867753364 5655 dbSNP
rs921683233 5659 dbSNP
rs577656721 5662 dbSNP
rs552993881 5664 dbSNP
rs767183820 5666 dbSNP
rs1343821828 5670 dbSNP
rs887939735 5671 dbSNP
rs977720145 5673 dbSNP
rs761544847 5680 dbSNP
rs968015865 5686 dbSNP
rs1021664348 5695 dbSNP
rs1402540782 5697 dbSNP
rs1282108257 5699 dbSNP
rs1350964813 5709 dbSNP
rs1225425281 5712 dbSNP
rs1012488956 5717 dbSNP
rs896751739 5720 dbSNP
rs1222115659 5722 dbSNP
rs1266246374 5729 dbSNP
rs1490905257 5730 dbSNP
rs990139270 5744 dbSNP
rs958815385 5749 dbSNP
rs756128706 5750 dbSNP
rs1003334377 5751 dbSNP
rs1349634602 5752 dbSNP
rs907054917 5753 dbSNP
rs1015155516 5755 dbSNP
rs1179435385 5755 dbSNP
rs1004833280 5761 dbSNP
rs185208730 5764 dbSNP
rs887690430 5765 dbSNP
rs573853373 5783 dbSNP
rs555714204 5784 dbSNP
rs1463171124 5786 dbSNP
rs923636720 5787 dbSNP
rs377490581 5793 dbSNP
rs1370660292 5802 dbSNP
rs1354708865 5809 dbSNP
rs374186802 5813 dbSNP
rs768410092 5820 dbSNP
rs1296379836 5822 dbSNP
rs192458446 5827 dbSNP
rs1228614738 5828 dbSNP
rs1316895977 5829 dbSNP
rs900144078 5833 dbSNP
rs79802626 5834 dbSNP
rs539960503 5838 dbSNP
rs1430789808 5846 dbSNP
rs1438432478 5850 dbSNP
rs944428267 5854 dbSNP
rs534168849 5856 dbSNP
rs1200779726 5859 dbSNP
rs922525210 5863 dbSNP
rs976021255 5865 dbSNP
rs1472585969 5868 dbSNP
rs1182740723 5887 dbSNP
rs1387509828 5891 dbSNP
rs1442344204 5900 dbSNP
rs1248836539 5904 dbSNP
rs962009121 5925 dbSNP
rs1390447979 5929 dbSNP
rs1481182558 5932 dbSNP
rs1255579509 5940 dbSNP
rs912753731 5942 dbSNP
rs1353786404 5945 dbSNP
rs566048914 5947 dbSNP
rs1338398439 5949 dbSNP
rs1380272974 5954 dbSNP
rs1451697037 5959 dbSNP
rs1314631677 5967 dbSNP
rs767526454 5970 dbSNP
rs1216347084 5971 dbSNP
rs952190358 5973 dbSNP
rs760022407 5985 dbSNP
rs1024192103 5991 dbSNP
rs1325753463 5998 dbSNP
rs1263894766 6005 dbSNP
rs1012436745 6015 dbSNP
rs896707664 6017 dbSNP
rs1304822232 6022 dbSNP
rs1056725343 6029 dbSNP
rs78977241 6030 dbSNP
rs990359442 6042 dbSNP
rs1301829566 6044 dbSNP
rs902160445 6053 dbSNP
rs566329356 6055 dbSNP
rs1418190912 6056 dbSNP
rs1043428359 6058 dbSNP
rs9816600 6059 dbSNP
rs36105501 6066 dbSNP
rs1178457263 6069 dbSNP
rs1403898942 6072 dbSNP
rs910993159 6073 dbSNP
rs927255909 6074 dbSNP
rs1327181118 6079 dbSNP
rs527707455 6087 dbSNP
rs1268444665 6088 dbSNP
rs1361335255 6090 dbSNP
rs1362526498 6096 dbSNP
rs571554730 6097 dbSNP
rs922472826 6099 dbSNP
rs1419991348 6100 dbSNP
rs1265539193 6105 dbSNP
rs1014795854 6106 dbSNP
rs1181962054 6107 dbSNP
rs1285428767 6117 dbSNP
rs771020747 6122 dbSNP
rs568301683 6145 dbSNP
rs187952056 6147 dbSNP
rs939962966 6148 dbSNP
rs1241196201 6157 dbSNP
rs1480474018 6161 dbSNP
rs1201035242 6164 dbSNP
rs778092214 6166 dbSNP
rs1243789625 6170 dbSNP
rs907853108 6173 dbSNP
rs182139005 6186 dbSNP
rs1484944496 6187 dbSNP
rs1027536843 6188 dbSNP
rs952201328 6190 dbSNP
rs763346629 6191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method