miRTarBase - #MIRT552039 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DNAJC10   
Synonyms ERdj5, JPDI, MTHr, PDIA19
Description DnaJ heat shock protein family (Hsp40) member C10
Transcript NM_018981   
Expression
Putative miRNA Targets on DNAJC10
3'UTR of DNAJC10
(miRNA target sites are highlighted)
>DNAJC10|NM_018981|3'UTR
   1 TAATGTTGAAGATGAAGAAAAAGTTTAAAAGAAATTCTGACAGATGACATCAGAAGACACCTATTTAGAATGTTACATTT
  81 ATGATGGGAATGAATGAACATTATCTTAGACTTGCAGTTGTACTGCCAGAATTATCTACAGCACTGGTGTAAAAGAAGGG
 161 TCTGCAAACTTTTTCTGTAAAGGGCCGGTTTATAAATATTTTAGACTTTGCAGGCTATAATATATGGTTCACACATGAGA
 241 ACAAGAATAGAGTCATCATGTATTCTTTGTTATTTGCTTTTAACAACCTTTAAAAAATATTAAAACGATTCTTAGCTCAG
 321 AGCCATACAAAAGTAGGCTGGATTCAGTCCATGGACCATAGATTGCTGTCCCCCTCGACGGACTTATAATGTTTCAGGTG
 401 GCTGGCTTGAACATGAGTCTGCTGTGCTATCTACATAAATGTCTAAGTTGTATAAAGTCCACTTTCCCTTCACGTTTTTT
 481 GGCTGACCTGAAAAGAGGTAACTTAGTTTTTGGTCACTTGTTCTCCTAAAAATGCTATCCCTAACCATATATTTATATTT
 561 CGTTTTAAAAACACCCATGATGTGGCACAGTAAACAAACCCTGTTATGCTGTATTATTATGAGGAGATTCTTCATTGTTT
 641 TCTTTCCTTCTCAAAGGTTGAAAAAATGCTTTTAATTTTTCACAGCCGAGAAACAGTGCAGCAGTATATGTGCACACAGT
 721 AAGTACACAAATTTGAGCAACAGTAAGTGCACAAATTCTGTAGTTTGCCGTATCATCCAGGAAAACCTGAGGGAAAAAAA
 801 TTATAGCAATTAACTGGGCATTGTAGAGTATCCTAAATATGTTATCAAGTATTTAGAGTTCTATATTTTAAAGATATATG
 881 TGTTCATGTATTTTCTGAAATTGCTTTCATAGAAATTTTCCCACTGATAGTTGATTTTTGAGGCATCTAATATTTACATA
 961 TTTGCCTTCTGAACTTTGTTTTGACCTGTATCCTTTATTTACATTGGGTTTTTCTTTCGTAGTTTTGGTTTTTCACTCCT
1041 GTCCAGTCTATTTATTATTCAAATAGGAAAAATTACTTTACAGGTTGTTTTACTGTAGCTTATAATGATACTGTAGTTAT
1121 TCCAGTTACTAGTTTACTGTCAGAGGGCTGCCTTTTTCAGATAAATATTGACATAATAACTGAAGTTATTTTTATAAGAA
1201 AATCAAGTATATAAATCTAGGAAAGGGATCTTCTAGTTTCTGTGTTGTTTAGACTCAAAGAATCACAAATTTGTCAGTAA
1281 CATGTAGTTGTTTAGTTATAATTCAGAGTGTACAGAATGGTAAAAATTCCAATCAGTCAAAAGAGGTCAATGAATTAAAA
1361 GGCTTGCAACTTTTTCAAAAACCTGTTAGAATATGCTTTATTGTGTTTTGAGGAGTTTTCCTTTTTTTCTTTTCAATATC
1441 ACTTTATCCTGCTCACCAGTATTTCCTCATAAGGGTTATTATAGCCATAATTAATGTTAAAATAGACTTTGTTCTTCATA
1521 TTCTCCCATCTTTTTCGCTACTATATACTCTGTCTGGATTCTGCTGTATGCCTGTTGGCATATATGGAACAGTCACCACT
1601 TGTCACACTTAACACCAGCTTTTTGAATTATGATCAGTAATGGCAAGAGCCTTTCATTCTCGAATGTTTAAAGCCTAGGA
1681 GTTCTACAAAATTGGCTTCTTTCTACAAGAATCCCAAAATGGAATGCCTAAAGAAGTCTTACTTGGGTAAATACTTACTA
1761 AAATATACTGGTTATGTGCATATCACCACACTGGACACTGAGGAGTGTTCAAAAGGAATCTAAGACATGGTCCCCATCTT
1841 CCAACTGTCTGTAATTCACTGTTTTGTCATTGAGCTCATAAGGTACTTACATTACTACCTATAAATGTTTCCTGTACTTG
1921 TTAGTTGTTGAGAAACATTTTAGGCAGTAAATAAAATAGTAAATATTATGTGTCCTATAATTTGACCTAAGCTGTGTGCC
2001 TTTGGAATCAGCTCTAAGCCAGGGCCCCCTGGGAGTCATGTTAAGAAACACGTATCATAAAGTGACATACATCAAGGTTA
2081 TCTTATATAGTCATAACAGTATTATTGGGTCTTTCAAAAACAGCTGGCAGATTGAGCTTTTAATGGCTATATTGATACAG
2161 TAGATAGAGCACCTCTAAGGAGTACCAGGTATAATGTGCCATTTCTCTCAGCAACACCATTTTTGTGTGCAGCTGACCCT
2241 CTAACATGGTATCAATTCTAGCTGACCAAAGCACATTCTATCAGGCAGCCAGGCTTGGAAATTAGGTCCATTTAAAGTAT
2321 GTGGCTTACAGTCAGGTATGGTGGTGTGCGCCTATTGTCCCATCTACTTGAGAGGCTGAGGCAGGAGGGATTGCTTGGGC
2401 TCAGGATTTTGAATCCAGCCTGGGCAACATAGCAAGACCCCATCTCTAATAAATAAATTATGTTTTGGGCATTAATGATG
2481 TTTGTCTATTCTGATTTCTCAAATTTTATTTAGGTCTTTCATAGCTTTTTTATTTAAAGGTATATGATTAAGATAAAGGA
2561 AAAGTAAAATGAAATGTTTATGTAATTTTATATTCTCAAAATTTTCTTTAAATTTGCTCTGTTTTCTGACAGTGCTCAAA
2641 GTGGGAATTTTTTTAGAAGTACGGTTATCAAAAAAACACATTTCCTATGGGACACACATTTCAAAGATGTTTAGTACGAT
2721 AAAATTTTTAGTAAAAGGGTAGCACTTTTAAGTCATTTGAATAGAATATTTGTGTAATATTTAGTCTAGTGTTAGTCCTT
2801 AAATCTGCCAACAAAACCAGATAGATGTCTTAAAGTAGGCACATTTATTCCATTGTGACTGTTAAGAAATAATAAAAGAT
2881 TAAATTAACAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGU---AAUACACGACGAu 5'
            ||| ||||   ||:||||| ||| 
Target 5' agCAACACCATTTTTGTGTGCAGCTg 3'
2210 - 2235 144.00 -17.90
2
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            |||||| |  | |||||:  
Target 5' aaCAAACCCTGTTATGCTGTat 3'
593 - 614 132.00 -12.50
3
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            ||| |:|| | | | ||||| 
Target 5' ttCAATATCACTTTATCCTGCTc 3'
1432 - 1454 132.00 -6.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30524684 4 COSMIC
COSN30160975 16 COSMIC
COSN30477423 18 COSMIC
COSN31555426 32 COSMIC
COSN31612295 37 COSMIC
COSN31603867 69 COSMIC
COSN30126248 71 COSMIC
COSN30502344 100 COSMIC
COSN30484198 110 COSMIC
COSN30120152 117 COSMIC
COSN31558907 131 COSMIC
COSN30127802 143 COSMIC
COSN30110335 179 COSMIC
COSN28187846 225 COSMIC
COSN21424866 342 COSMIC
COSN21619247 627 COSMIC
COSN21756258 692 COSMIC
COSN26277313 802 COSMIC
COSN1810430 883 COSMIC
COSN5785737 1052 COSMIC
COSN32065326 1142 COSMIC
COSN28019262 1430 COSMIC
COSN32061470 1452 COSMIC
COSN16663099 1802 COSMIC
COSN9120299 2155 COSMIC
COSN8274947 2660 COSMIC
COSN9120300 2739 COSMIC
COSN9120301 3281 COSMIC
COSN26800558 3477 COSMIC
COSN4987812 3769 COSMIC
COSN21869480 3821 COSMIC
COSN27593830 3851 COSMIC
COSN24358319 3994 COSMIC
COSN4910383 4164 COSMIC
COSN15994184 4271 COSMIC
COSN7150171 4354 COSMIC
COSN142680 4560 COSMIC
COSN22705723 4615 COSMIC
COSN9120302 4643 COSMIC
COSN23642185 5021 COSMIC
COSN20264618 5137 COSMIC
COSN23546800 5249 COSMIC
COSN23506272 5311 COSMIC
COSN20964342 5689 COSMIC
COSN19256413 5753 COSMIC
COSN7150172 5863 COSMIC
COSN9120303 6042 COSMIC
COSN9868332 7111 COSMIC
COSN29728579 7217 COSMIC
COSN20846106 7410 COSMIC
COSN5490974 8277 COSMIC
COSN29438145 8459 COSMIC
COSN25709951 8596 COSMIC
COSN1810431 8670 COSMIC
COSN14550330 8820 COSMIC
COSN29210192 8903 COSMIC
COSN26450559 8947 COSMIC
COSN1229925 9087 COSMIC
COSN218709 9104 COSMIC
COSN222509 9118 COSMIC
COSN1810432 9340 COSMIC
COSN29176253 9912 COSMIC
COSN1810433 10390 COSMIC
COSN9120305 10975 COSMIC
COSN6157504 11083 COSMIC
COSN22393532 11520 COSMIC
COSN21689505 11628 COSMIC
COSN21872497 11721 COSMIC
COSN8608177 11837 COSMIC
COSN28817821 11869 COSMIC
COSN24143387 12064 COSMIC
COSN14617747 12722 COSMIC
COSN6555774 12738 COSMIC
COSN19350893 12856 COSMIC
COSN26850387 12956 COSMIC
COSN22559293 12961 COSMIC
COSN25206916 12967 COSMIC
COSN19106942 13222 COSMIC
COSN27119494 13510 COSMIC
COSN6157505 13530 COSMIC
COSN17068093 13843 COSMIC
COSN26201503 13906 COSMIC
COSN27686477 14780 COSMIC
COSN32165738 15317 COSMIC
COSN21166474 15535 COSMIC
COSN7150174 15791 COSMIC
COSN22464685 15808 COSMIC
COSN20816802 15940 COSMIC
COSN21635755 16023 COSMIC
COSN28487601 16141 COSMIC
COSN4987813 16190 COSMIC
COSN27872461 16743 COSMIC
COSN28583971 16846 COSMIC
COSN15946017 16955 COSMIC
COSN7150175 17119 COSMIC
COSN23542095 17123 COSMIC
COSN23543992 17124 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1472423255 2 dbSNP
rs1178210992 3 dbSNP
rs1292799850 5 dbSNP
rs748849509 6 dbSNP
rs952396567 13 dbSNP
rs762462305 15 dbSNP
rs776254392 15 dbSNP
rs1230256058 17 dbSNP
rs770493728 21 dbSNP
rs770412185 23 dbSNP
rs1187430632 28 dbSNP
rs773672600 31 dbSNP
rs761171008 34 dbSNP
rs1049286063 38 dbSNP
rs764656223 39 dbSNP
rs1186742749 41 dbSNP
rs1252043732 43 dbSNP
rs1003812867 45 dbSNP
rs1473301886 48 dbSNP
rs1265058436 59 dbSNP
rs1015321720 64 dbSNP
rs1217081211 69 dbSNP
rs1430271617 73 dbSNP
rs780545252 77 dbSNP
rs767481293 87 dbSNP
rs554802404 91 dbSNP
rs1215119416 97 dbSNP
rs1279460718 100 dbSNP
rs1301090267 101 dbSNP
rs1447178369 104 dbSNP
rs574555017 111 dbSNP
rs1338089656 115 dbSNP
rs923431403 116 dbSNP
rs900801004 125 dbSNP
rs1171575536 126 dbSNP
rs564628177 129 dbSNP
rs1446129876 133 dbSNP
rs758855712 139 dbSNP
rs1462131607 142 dbSNP
rs151315452 148 dbSNP
rs1196772903 158 dbSNP
rs1475431107 159 dbSNP
rs1010679024 165 dbSNP
rs1022124422 167 dbSNP
rs1189794659 170 dbSNP
rs1206889389 170 dbSNP
rs1309094834 174 dbSNP
rs371237109 187 dbSNP
rs1433367227 197 dbSNP
rs1383382362 199 dbSNP
rs1052421563 206 dbSNP
rs999366041 207 dbSNP
rs559923086 213 dbSNP
rs1298458960 214 dbSNP
rs532225073 224 dbSNP
rs1035353492 225 dbSNP
rs1322234010 227 dbSNP
rs1316446109 245 dbSNP
rs1445792171 247 dbSNP
rs1392859959 250 dbSNP
rs115063714 253 dbSNP
rs991240284 256 dbSNP
rs949494768 258 dbSNP
rs1197823723 262 dbSNP
rs1435971824 267 dbSNP
rs1302727552 269 dbSNP
rs916655937 272 dbSNP
rs952131624 278 dbSNP
rs1221394520 280 dbSNP
rs1236395807 282 dbSNP
rs1293769810 288 dbSNP
rs1275238640 298 dbSNP
rs1046435006 301 dbSNP
rs751804607 307 dbSNP
rs578231212 308 dbSNP
rs1048319636 309 dbSNP
rs888346731 326 dbSNP
rs1367847104 330 dbSNP
rs1157446641 338 dbSNP
rs1419607550 340 dbSNP
rs558398673 340 dbSNP
rs562493273 347 dbSNP
rs141961638 350 dbSNP
rs923532867 352 dbSNP
rs1490471091 357 dbSNP
rs933660644 366 dbSNP
rs1453178231 370 dbSNP
rs1015667796 375 dbSNP
rs1260827017 377 dbSNP
rs540797920 378 dbSNP
rs1049886739 380 dbSNP
rs548244951 381 dbSNP
rs998350696 384 dbSNP
rs764808697 386 dbSNP
rs369480504 388 dbSNP
rs953689858 391 dbSNP
rs1386247717 395 dbSNP
rs13011976 398 dbSNP
rs1043464144 410 dbSNP
rs1160383457 412 dbSNP
rs145736834 413 dbSNP
rs902316702 422 dbSNP
rs1392309249 423 dbSNP
rs547177041 426 dbSNP
rs1324077496 427 dbSNP
rs567073177 432 dbSNP
rs1034913801 436 dbSNP
rs1191178487 445 dbSNP
rs1446372070 455 dbSNP
rs960935690 458 dbSNP
rs1032622622 467 dbSNP
rs1261947758 468 dbSNP
rs1223795691 472 dbSNP
rs1024095538 474 dbSNP
rs952099527 493 dbSNP
rs1281040541 508 dbSNP
rs1329508811 509 dbSNP
rs781121750 513 dbSNP
rs1405502789 516 dbSNP
rs1337425732 521 dbSNP
rs907959966 523 dbSNP
rs1421683437 524 dbSNP
rs188389581 526 dbSNP
rs1475000838 527 dbSNP
rs1373420604 533 dbSNP
rs1469387719 536 dbSNP
rs529343909 538 dbSNP
rs1195306836 541 dbSNP
rs949381916 545 dbSNP
rs982620393 550 dbSNP
rs1242017835 552 dbSNP
rs1203688824 561 dbSNP
rs552948274 562 dbSNP
rs1255687891 563 dbSNP
rs191694878 569 dbSNP
rs1268727411 578 dbSNP
rs932267589 585 dbSNP
rs1340573262 586 dbSNP
rs1437726652 601 dbSNP
rs768408275 602 dbSNP
rs1365901871 608 dbSNP
rs184332767 612 dbSNP
rs778919339 620 dbSNP
rs1164405502 621 dbSNP
rs1328505152 628 dbSNP
rs1410727615 628 dbSNP
rs946388572 631 dbSNP
rs1048203084 635 dbSNP
rs1169395616 638 dbSNP
rs888399237 639 dbSNP
rs1384468430 643 dbSNP
rs1183677356 645 dbSNP
rs1446004614 647 dbSNP
rs939938417 651 dbSNP
rs1235817180 658 dbSNP
rs554971955 660 dbSNP
rs902283816 672 dbSNP
rs900848534 676 dbSNP
rs1359355190 687 dbSNP
rs1293226010 688 dbSNP
rs1237147454 697 dbSNP
rs141262861 699 dbSNP
rs1278998548 703 dbSNP
rs1443239689 703 dbSNP
rs1337710606 704 dbSNP
rs1330657291 706 dbSNP
rs1056724023 707 dbSNP
rs1164200039 709 dbSNP
rs896400812 710 dbSNP
rs1405215930 711 dbSNP
rs114629112 716 dbSNP
rs1234187015 718 dbSNP
rs889526015 719 dbSNP
rs754195962 720 dbSNP
rs1007764135 724 dbSNP
rs553544393 725 dbSNP
rs1270018604 729 dbSNP
rs1225415795 731 dbSNP
rs576665056 733 dbSNP
rs1352092816 734 dbSNP
rs1032508253 742 dbSNP
rs1389600286 743 dbSNP
rs958152301 748 dbSNP
rs1330710099 753 dbSNP
rs1273366972 767 dbSNP
rs988804641 768 dbSNP
rs288283 770 dbSNP
rs1291006003 787 dbSNP
rs1303501751 794 dbSNP
rs562942733 801 dbSNP
rs1006242499 804 dbSNP
rs1015005401 805 dbSNP
rs562668539 809 dbSNP
rs1400849857 814 dbSNP
rs112473306 819 dbSNP
rs1250266049 820 dbSNP
rs1173870770 825 dbSNP
rs531594424 833 dbSNP
rs1479886518 834 dbSNP
rs1430462368 843 dbSNP
rs1201976136 845 dbSNP
rs971155855 849 dbSNP
rs1217132573 855 dbSNP
rs1448875440 856 dbSNP
rs190160806 859 dbSNP
rs541425839 862 dbSNP
rs763838450 862 dbSNP
rs561734501 864 dbSNP
rs976276569 865 dbSNP
rs182329645 867 dbSNP
rs953580525 872 dbSNP
rs1483561421 874 dbSNP
rs527336508 874 dbSNP
rs1346492856 875 dbSNP
rs1334068483 878 dbSNP
rs1468985358 879 dbSNP
rs1406275969 887 dbSNP
rs1179042757 889 dbSNP
rs1427182876 893 dbSNP
rs771884486 905 dbSNP
rs187328259 911 dbSNP
rs1476290271 914 dbSNP
rs909722481 922 dbSNP
rs939827376 924 dbSNP
rs553061090 928 dbSNP
rs1165652621 929 dbSNP
rs946357476 929 dbSNP
rs560659962 931 dbSNP
rs532789756 933 dbSNP
rs562382941 934 dbSNP
rs979095151 936 dbSNP
rs552885189 937 dbSNP
rs569423601 938 dbSNP
rs538548126 939 dbSNP
rs1370964477 940 dbSNP
rs548240154 941 dbSNP
rs568487044 943 dbSNP
rs534015634 944 dbSNP
rs553880200 945 dbSNP
rs1310816999 946 dbSNP
rs555323922 948 dbSNP
rs1357049091 949 dbSNP
rs576606508 951 dbSNP
rs539218030 952 dbSNP
rs1294252230 953 dbSNP
rs556337601 953 dbSNP
rs190691010 959 dbSNP
rs1354360915 962 dbSNP
rs1324108675 969 dbSNP
rs753676060 975 dbSNP
rs935114416 977 dbSNP
rs933679639 978 dbSNP
rs542111294 994 dbSNP
rs896272116 995 dbSNP
rs1245020969 998 dbSNP
rs1175740246 1005 dbSNP
rs1343465620 1011 dbSNP
rs146950872 1016 dbSNP
rs1289592824 1019 dbSNP
rs999947403 1019 dbSNP
rs13509 1020 dbSNP
rs893994118 1026 dbSNP
rs1316500375 1049 dbSNP
rs1009715661 1050 dbSNP
rs1006209514 1051 dbSNP
rs1182605358 1054 dbSNP
rs527498669 1059 dbSNP
rs1261134350 1064 dbSNP
rs1444897488 1066 dbSNP
rs1021651159 1067 dbSNP
rs1426770512 1073 dbSNP
rs1190570270 1074 dbSNP
rs897904435 1076 dbSNP
rs970993350 1077 dbSNP
rs1251426113 1082 dbSNP
rs997977676 1083 dbSNP
rs1171591879 1090 dbSNP
rs541114652 1092 dbSNP
rs1483949137 1102 dbSNP
rs1266483664 1104 dbSNP
rs1221714992 1106 dbSNP
rs1376989650 1107 dbSNP
rs1030420411 1116 dbSNP
rs1466239543 1121 dbSNP
rs180696166 1137 dbSNP
rs1287887739 1140 dbSNP
rs953650837 1142 dbSNP
rs986330614 1144 dbSNP
rs1307335144 1146 dbSNP
rs1021817178 1162 dbSNP
rs1344066152 1168 dbSNP
rs1003988176 1169 dbSNP
rs1033638634 1170 dbSNP
rs1406112013 1173 dbSNP
rs959327680 1174 dbSNP
rs1383460579 1176 dbSNP
rs1287191958 1195 dbSNP
rs1297651814 1208 dbSNP
rs968964617 1211 dbSNP
rs1366641934 1217 dbSNP
rs984178761 1218 dbSNP
rs138060233 1219 dbSNP
rs1161623326 1220 dbSNP
rs1479562607 1229 dbSNP
rs1426983620 1230 dbSNP
rs979062484 1231 dbSNP
rs923640715 1237 dbSNP
rs1269294959 1247 dbSNP
rs760296139 1254 dbSNP
rs1234181995 1257 dbSNP
rs935020623 1257 dbSNP
rs1260768936 1265 dbSNP
rs35638870 1270 dbSNP
rs113561329 1273 dbSNP
rs1320910301 1274 dbSNP
rs1224429683 1282 dbSNP
rs972579137 1282 dbSNP
rs1333182552 1283 dbSNP
rs546047963 1285 dbSNP
rs1382138064 1287 dbSNP
rs563097989 1290 dbSNP
rs1322596913 1291 dbSNP
rs1484998414 1298 dbSNP
rs1050065930 1307 dbSNP
rs910896404 1308 dbSNP
rs531907402 1309 dbSNP
rs1210744610 1314 dbSNP
rs1468454024 1319 dbSNP
rs185315237 1321 dbSNP
rs1054225877 1323 dbSNP
rs1191600515 1330 dbSNP
rs780200114 1330 dbSNP
rs550515415 1333 dbSNP
rs891534902 1338 dbSNP
rs1427806963 1339 dbSNP
rs1261846199 1343 dbSNP
rs1209991107 1346 dbSNP
rs747107698 1349 dbSNP
rs1158070740 1351 dbSNP
rs1203889196 1351 dbSNP
rs547539974 1354 dbSNP
rs906818786 1384 dbSNP
rs1227387415 1392 dbSNP
rs567252275 1398 dbSNP
rs1299935702 1403 dbSNP
rs1450458382 1408 dbSNP
rs1036288415 1416 dbSNP
rs1337697299 1425 dbSNP
rs897782962 1425 dbSNP
rs1404121340 1429 dbSNP
rs1393020999 1430 dbSNP
rs1440824627 1435 dbSNP
rs1324420523 1436 dbSNP
rs1370209288 1437 dbSNP
rs1461429747 1446 dbSNP
rs367839634 1446 dbSNP
rs142218995 1451 dbSNP
rs755962091 1451 dbSNP
rs113727757 1452 dbSNP
rs113744659 1453 dbSNP
rs1190423028 1455 dbSNP
rs111394482 1456 dbSNP
rs1052255120 1457 dbSNP
rs1306733906 1459 dbSNP
rs1315416604 1460 dbSNP
rs1443751079 1475 dbSNP
rs568095955 1476 dbSNP
rs1248894306 1479 dbSNP
rs1230404288 1482 dbSNP
rs1340689567 1483 dbSNP
rs1268859600 1486 dbSNP
rs889236458 1489 dbSNP
rs1033859599 1525 dbSNP
rs1358864811 1526 dbSNP
rs190221532 1536 dbSNP
rs1021785881 1537 dbSNP
rs968932155 1538 dbSNP
rs1326608276 1542 dbSNP
rs999026582 1544 dbSNP
rs1370920778 1546 dbSNP
rs1488746981 1549 dbSNP
rs1005489384 1553 dbSNP
rs547409549 1559 dbSNP
rs961476654 1575 dbSNP
rs1384106593 1588 dbSNP
rs973015555 1595 dbSNP
rs922460812 1601 dbSNP
rs955348761 1605 dbSNP
rs1405501973 1609 dbSNP
rs1230753306 1611 dbSNP
rs1180640792 1613 dbSNP
rs1438815912 1619 dbSNP
rs985385477 1621 dbSNP
rs1473375469 1622 dbSNP
rs1254390351 1628 dbSNP
rs1220941053 1632 dbSNP
rs1490315627 1637 dbSNP
rs879228446 1640 dbSNP
rs1292608334 1642 dbSNP
rs1230031504 1644 dbSNP
rs1031886334 1651 dbSNP
rs1279249512 1652 dbSNP
rs956548990 1660 dbSNP
rs911120638 1662 dbSNP
rs570576347 1663 dbSNP
rs1403056351 1665 dbSNP
rs1364829125 1672 dbSNP
rs1352187430 1676 dbSNP
rs1437792309 1679 dbSNP
rs1297981329 1680 dbSNP
rs1405149671 1685 dbSNP
rs917641075 1686 dbSNP
rs549600248 1687 dbSNP
rs765613778 1688 dbSNP
rs913021531 1698 dbSNP
rs945814436 1716 dbSNP
rs969205984 1723 dbSNP
rs1289171057 1731 dbSNP
rs1045853772 1733 dbSNP
rs1231569792 1737 dbSNP
rs980593065 1751 dbSNP
rs906710683 1759 dbSNP
rs1445397610 1760 dbSNP
rs939487836 1764 dbSNP
rs776097439 1767 dbSNP
rs1322313956 1781 dbSNP
rs1290002562 1783 dbSNP
rs11547935 1793 dbSNP
rs72898754 1804 dbSNP
rs895388123 1812 dbSNP
rs1230965014 1813 dbSNP
rs1483890192 1817 dbSNP
rs1438498961 1837 dbSNP
rs1342968372 1843 dbSNP
rs556039409 1850 dbSNP
rs1005543226 1852 dbSNP
rs1016888424 1863 dbSNP
rs182817109 1871 dbSNP
rs1183157390 1873 dbSNP
rs1173804044 1884 dbSNP
rs112963526 1887 dbSNP
rs1426281083 1895 dbSNP
rs994268811 1896 dbSNP
rs1030130305 1902 dbSNP
rs1474691887 1917 dbSNP
rs1241621463 1921 dbSNP
rs1189238121 1928 dbSNP
rs1466429311 1934 dbSNP
rs535376725 1944 dbSNP
rs1406467939 1954 dbSNP
rs1170315632 1960 dbSNP
rs933305492 1963 dbSNP
rs1322611323 1970 dbSNP
rs186900818 1971 dbSNP
rs985274191 1978 dbSNP
rs1359705599 1980 dbSNP
rs1432072240 1994 dbSNP
rs1308979201 1995 dbSNP
rs1366721593 1996 dbSNP
rs889196155 1999 dbSNP
rs1468936526 2015 dbSNP
rs1360138980 2016 dbSNP
rs1178631972 2019 dbSNP
rs1408728897 2023 dbSNP
rs1355132652 2025 dbSNP
rs752030969 2025 dbSNP
rs957269311 2026 dbSNP
rs1451471844 2030 dbSNP
rs3738945 2031 dbSNP
rs1043128427 2036 dbSNP
rs117734438 2038 dbSNP
rs1305546848 2039 dbSNP
rs770455129 2045 dbSNP
rs288241 2047 dbSNP
rs1270737906 2048 dbSNP
rs1343726747 2048 dbSNP
rs1312228021 2052 dbSNP
rs981228968 2053 dbSNP
rs1379374465 2060 dbSNP
rs1205690594 2068 dbSNP
rs960346128 2071 dbSNP
rs1354300213 2073 dbSNP
rs1169836806 2075 dbSNP
rs1432137217 2076 dbSNP
rs1484494009 2076 dbSNP
rs1162944932 2078 dbSNP
rs1383502660 2078 dbSNP
rs1013668117 2084 dbSNP
rs1416313691 2085 dbSNP
rs1175687507 2087 dbSNP
rs1479562167 2088 dbSNP
rs1250755228 2094 dbSNP
rs750410556 2095 dbSNP
rs969051171 2096 dbSNP
rs191698826 2098 dbSNP
rs1055212011 2099 dbSNP
rs895440624 2107 dbSNP
rs1314507926 2113 dbSNP
rs908982664 2116 dbSNP
rs1373106701 2124 dbSNP
rs963180842 2129 dbSNP
rs941616584 2142 dbSNP
rs543548899 2145 dbSNP
rs756236597 2147 dbSNP
rs778671762 2150 dbSNP
rs1351662236 2152 dbSNP
rs897165056 2152 dbSNP
rs1336356472 2153 dbSNP
rs748045906 2155 dbSNP
rs1182563913 2161 dbSNP
rs1430162633 2168 dbSNP
rs1473536479 2180 dbSNP
rs910517492 2181 dbSNP
rs77789280 2186 dbSNP
rs1488549836 2187 dbSNP
rs1266665309 2194 dbSNP
rs1213254863 2196 dbSNP
rs777529410 2200 dbSNP
rs1367339796 2202 dbSNP
rs891194077 2206 dbSNP
rs904628413 2210 dbSNP
rs578243725 2220 dbSNP
rs1301245622 2232 dbSNP
rs1006764706 2233 dbSNP
rs1018119993 2235 dbSNP
rs1393004780 2236 dbSNP
rs531964460 2237 dbSNP
rs934815893 2239 dbSNP
rs1053330856 2243 dbSNP
rs896049229 2248 dbSNP
rs990075165 2249 dbSNP
rs1458674251 2260 dbSNP
rs1426919724 2261 dbSNP
rs1020593344 2265 dbSNP
rs967089548 2267 dbSNP
rs1268869721 2276 dbSNP
rs904838515 2278 dbSNP
rs1201849169 2279 dbSNP
rs756234281 2280 dbSNP
rs1210186937 2281 dbSNP
rs1321904977 2283 dbSNP
rs1255726461 2286 dbSNP
rs981500310 2288 dbSNP
rs1001885556 2290 dbSNP
rs1293533278 2293 dbSNP
rs928437662 2295 dbSNP
rs1366010043 2296 dbSNP
rs1446038609 2299 dbSNP
rs958445835 2302 dbSNP
rs879567405 2311 dbSNP
rs916753068 2320 dbSNP
rs1399837892 2322 dbSNP
rs288240 2333 dbSNP
rs1038633080 2339 dbSNP
rs770433848 2341 dbSNP
rs1168216176 2342 dbSNP
rs1189696527 2347 dbSNP
rs577422239 2350 dbSNP
rs1477215689 2351 dbSNP
rs183754646 2355 dbSNP
rs987364757 2370 dbSNP
rs1255916843 2371 dbSNP
rs1201320361 2372 dbSNP
rs745330819 2372 dbSNP
rs1006985257 2374 dbSNP
rs1347578973 2396 dbSNP
rs1039776597 2403 dbSNP
rs1343018633 2403 dbSNP
rs892987844 2405 dbSNP
rs943344573 2410 dbSNP
rs1011392527 2412 dbSNP
rs978760244 2421 dbSNP
rs527991881 2424 dbSNP
rs1333270385 2428 dbSNP
rs1396447618 2429 dbSNP
rs547346340 2430 dbSNP
rs1390840353 2436 dbSNP
rs1306149799 2438 dbSNP
rs1428982475 2439 dbSNP
rs1169873038 2441 dbSNP
rs1390272705 2441 dbSNP
rs1020228816 2443 dbSNP
rs1435761625 2443 dbSNP
rs1327072998 2448 dbSNP
rs1367602206 2448 dbSNP
rs1444546919 2455 dbSNP
rs1248826355 2458 dbSNP
rs773940058 2460 dbSNP
rs1483640031 2468 dbSNP
rs967690974 2476 dbSNP
rs934781460 2479 dbSNP
rs1243787202 2482 dbSNP
rs1266686896 2483 dbSNP
rs1285055076 2489 dbSNP
rs1329251365 2496 dbSNP
rs570515050 2499 dbSNP
rs1235190509 2515 dbSNP
rs1002582782 2516 dbSNP
rs6705867 2517 dbSNP
rs958329207 2519 dbSNP
rs1371015495 2522 dbSNP
rs749511149 2526 dbSNP
rs950282904 2528 dbSNP
rs991210959 2541 dbSNP
rs908941062 2542 dbSNP
rs543155219 2543 dbSNP
rs1269486542 2545 dbSNP
rs1389362064 2546 dbSNP
rs1389970167 2546 dbSNP
rs1163523637 2549 dbSNP
rs1329194275 2549 dbSNP
rs962873115 2554 dbSNP
rs974635951 2558 dbSNP
rs1473208874 2560 dbSNP
rs1328461147 2565 dbSNP
rs1254680539 2567 dbSNP
rs1220872278 2570 dbSNP
rs1252979770 2571 dbSNP
rs918881874 2575 dbSNP
rs930219962 2577 dbSNP
rs1051317227 2582 dbSNP
rs373525159 2585 dbSNP
rs1290628284 2588 dbSNP
rs1211877433 2593 dbSNP
rs1201549317 2609 dbSNP
rs779031390 2610 dbSNP
rs1247596822 2617 dbSNP
rs912574910 2622 dbSNP
rs1469820871 2626 dbSNP
rs775192701 2627 dbSNP
rs942649409 2630 dbSNP
rs1414305761 2641 dbSNP
rs550290287 2644 dbSNP
rs1330034822 2648 dbSNP
rs1457878816 2648 dbSNP
rs1323595028 2653 dbSNP
rs1406756117 2656 dbSNP
rs1336533056 2657 dbSNP
rs766891119 2662 dbSNP
rs893207945 2663 dbSNP
rs1414606810 2664 dbSNP
rs1388436714 2665 dbSNP
rs1001854374 2670 dbSNP
rs1323987554 2671 dbSNP
rs188642906 2672 dbSNP
rs1201006438 2674 dbSNP
rs898906700 2675 dbSNP
rs139499424 2676 dbSNP
rs993225850 2688 dbSNP
rs1041937938 2689 dbSNP
rs1289781988 2693 dbSNP
rs190929452 2696 dbSNP
rs1003210454 2708 dbSNP
rs1232195268 2711 dbSNP
rs1274937158 2715 dbSNP
rs1263162665 2718 dbSNP
rs1035581413 2719 dbSNP
rs1435309830 2723 dbSNP
rs958381180 2730 dbSNP
rs144154457 2731 dbSNP
rs148261139 2732 dbSNP
rs141980780 2736 dbSNP
rs1437557839 2746 dbSNP
rs1174814571 2748 dbSNP
rs377450245 2748 dbSNP
rs978729177 2757 dbSNP
rs1247459796 2758 dbSNP
rs1189490755 2759 dbSNP
rs974308936 2763 dbSNP
rs1254289680 2769 dbSNP
rs1473036809 2778 dbSNP
rs1243650725 2787 dbSNP
rs1207682598 2789 dbSNP
rs1187377801 2790 dbSNP
rs1026238162 2791 dbSNP
rs1279320630 2796 dbSNP
rs1366738101 2819 dbSNP
rs1339487176 2821 dbSNP
rs1296159112 2826 dbSNP
rs1228695644 2827 dbSNP
rs951547204 2831 dbSNP
rs1366831400 2836 dbSNP
rs1447835182 2843 dbSNP
rs534928144 2849 dbSNP
rs1336765863 2853 dbSNP
rs1428340350 2860 dbSNP
rs557781489 2862 dbSNP
rs1163735185 2863 dbSNP
rs1395537689 2864 dbSNP
rs747926019 2864 dbSNP
rs988888726 2867 dbSNP
rs912795618 2873 dbSNP
rs1482834770 2875 dbSNP
rs1237795468 2879 dbSNP
rs950236116 2879 dbSNP
rs1044982935 2883 dbSNP
rs1273284798 2885 dbSNP
rs1308734868 2890 dbSNP
rs777652337 2890 dbSNP
rs927529220 2890 dbSNP
rs941626639 2894 dbSNP
rs1380390884 2895 dbSNP
rs942701817 2899 dbSNP
rs1350801202 2905 dbSNP
rs148541325 2909 dbSNP
rs372290487 2909 dbSNP
rs1233822577 2910 dbSNP
rs1309172554 2918 dbSNP
rs898790755 2920 dbSNP
rs1348183208 2928 dbSNP
rs1164385131 2932 dbSNP
rs1424562775 2933 dbSNP
rs952953387 2936 dbSNP
rs975402186 2941 dbSNP
rs993586883 2947 dbSNP
rs146292464 2956 dbSNP
rs1251063129 2963 dbSNP
rs890231460 2967 dbSNP
rs543133854 2968 dbSNP
rs1481350912 2971 dbSNP
rs1008711629 2973 dbSNP
rs1017430385 2978 dbSNP
rs760578263 2981 dbSNP
rs1275448261 2983 dbSNP
rs1285349919 2984 dbSNP
rs1000031613 2992 dbSNP
rs113672047 2992 dbSNP
rs557045246 2996 dbSNP
rs368849434 2998 dbSNP
rs573675252 3002 dbSNP
rs764071322 3003 dbSNP
rs1412190453 3012 dbSNP
rs1032909529 3017 dbSNP
rs1292953317 3023 dbSNP
rs1277191810 3026 dbSNP
rs1458604530 3029 dbSNP
rs1483514810 3030 dbSNP
rs1351900119 3040 dbSNP
rs542373839 3042 dbSNP
rs1200023238 3044 dbSNP
rs1455488130 3046 dbSNP
rs1410911844 3048 dbSNP
rs1182848033 3054 dbSNP
rs1420753595 3059 dbSNP
rs1264670501 3071 dbSNP
rs956037277 3073 dbSNP
rs1488521652 3082 dbSNP
rs1254561627 3086 dbSNP
rs1206416973 3087 dbSNP
rs1041770221 3088 dbSNP
rs1254209618 3096 dbSNP
rs1269108144 3104 dbSNP
rs1425585245 3106 dbSNP
rs1241820479 3108 dbSNP
rs1310885663 3110 dbSNP
rs1301177118 3111 dbSNP
rs1373260219 3112 dbSNP
rs1188310073 3116 dbSNP
rs903026924 3118 dbSNP
rs182054046 3125 dbSNP
rs917325131 3126 dbSNP
rs1056999118 3128 dbSNP
rs1375926543 3128 dbSNP
rs1175258623 3129 dbSNP
rs1433320727 3130 dbSNP
rs139500149 3133 dbSNP
rs927410237 3135 dbSNP
rs1464114297 3138 dbSNP
rs116294426 3143 dbSNP
rs1015880143 3156 dbSNP
rs1207326762 3164 dbSNP
rs1038605653 3167 dbSNP
rs767581860 3176 dbSNP
rs1350182518 3184 dbSNP
rs1295432170 3186 dbSNP
rs1227962667 3199 dbSNP
rs1396143558 3201 dbSNP
rs144324910 3203 dbSNP
rs1026034719 3211 dbSNP
rs1365173321 3214 dbSNP
rs1383769526 3215 dbSNP
rs951649553 3230 dbSNP
rs1300278982 3233 dbSNP
rs1047874002 3235 dbSNP
rs1466452835 3236 dbSNP
rs986969360 3238 dbSNP
rs62188170 3241 dbSNP
rs1448339358 3244 dbSNP
rs1009096638 3245 dbSNP
rs549985396 3250 dbSNP
rs563777414 3251 dbSNP
rs1422477958 3252 dbSNP
rs529385788 3258 dbSNP
rs1201551559 3260 dbSNP
rs1486907365 3262 dbSNP
rs1272581330 3265 dbSNP
rs1038763788 3276 dbSNP
rs1342947523 3276 dbSNP
rs1272200127 3281 dbSNP
rs900320466 3282 dbSNP
rs549162251 3283 dbSNP
rs999999034 3284 dbSNP
rs565887396 3286 dbSNP
rs1428592884 3288 dbSNP
rs1396551240 3293 dbSNP
rs1169317187 3299 dbSNP
rs1368265758 3302 dbSNP
rs1188602632 3306 dbSNP
rs1476389876 3321 dbSNP
rs975622464 3326 dbSNP
rs1247477430 3333 dbSNP
rs1182065146 3342 dbSNP
rs766459331 3348 dbSNP
rs1483448436 3371 dbSNP
rs534904307 3377 dbSNP
rs753974852 3385 dbSNP
rs79793252 3386 dbSNP
rs1024762421 3408 dbSNP
rs977925299 3412 dbSNP
rs1233732218 3416 dbSNP
rs924699850 3425 dbSNP
rs1190390354 3427 dbSNP
rs186827076 3430 dbSNP
rs1409093187 3431 dbSNP
rs1056884807 3445 dbSNP
rs1475210079 3446 dbSNP
rs980141931 3449 dbSNP
rs894438088 3450 dbSNP
rs1384721771 3457 dbSNP
rs1034449528 3471 dbSNP
rs1165181749 3473 dbSNP
rs1463390840 3477 dbSNP
rs948643586 3478 dbSNP
rs1432430848 3484 dbSNP
rs1037549211 3485 dbSNP
rs898841849 3486 dbSNP
rs1470772800 3490 dbSNP
rs993155851 3494 dbSNP
rs918827902 3498 dbSNP
rs537020890 3502 dbSNP
rs1451092419 3503 dbSNP
rs1268377065 3512 dbSNP
rs1215750353 3516 dbSNP
rs930259194 3519 dbSNP
rs983129719 3520 dbSNP
rs1227722353 3526 dbSNP
rs911508882 3531 dbSNP
rs940322556 3541 dbSNP
rs890199914 3543 dbSNP
rs1036079497 3552 dbSNP
rs1281209563 3554 dbSNP
rs1287791886 3556 dbSNP
rs1008436063 3567 dbSNP
rs1329980728 3569 dbSNP
rs944395644 3570 dbSNP
rs1038731230 3571 dbSNP
rs1386941033 3572 dbSNP
rs1320244416 3581 dbSNP
rs1433569621 3582 dbSNP
rs1323084335 3584 dbSNP
rs1410871500 3594 dbSNP
rs1171310564 3595 dbSNP
rs1366532980 3599 dbSNP
rs1019795696 3600 dbSNP
rs1477761567 3605 dbSNP
rs900289775 3607 dbSNP
rs557278771 3610 dbSNP
rs6738770 3611 dbSNP
rs1245968805 3614 dbSNP
rs1021859466 3626 dbSNP
rs891705198 3637 dbSNP
rs969144717 3638 dbSNP
rs1217377799 3640 dbSNP
rs191651307 3648 dbSNP
rs1303442480 3656 dbSNP
rs1236064126 3658 dbSNP
rs977433717 3664 dbSNP
rs535967980 3665 dbSNP
rs960149709 3666 dbSNP
rs555537224 3671 dbSNP
rs1327103703 3673 dbSNP
rs915755409 3679 dbSNP
rs907173746 3680 dbSNP
rs1414351263 3685 dbSNP
rs1001546852 3687 dbSNP
rs1248609280 3689 dbSNP
rs1175524230 3713 dbSNP
rs1034419752 3716 dbSNP
rs1389847203 3716 dbSNP
rs1187308204 3720 dbSNP
rs184921624 3743 dbSNP
rs974234935 3751 dbSNP
rs1207967560 3753 dbSNP
rs1026266062 3761 dbSNP
rs150638513 3764 dbSNP
rs1269124519 3777 dbSNP
rs561174708 3777 dbSNP
rs529844111 3780 dbSNP
rs746759951 3785 dbSNP
rs1339414387 3787 dbSNP
rs987436499 3789 dbSNP
rs1433411282 3796 dbSNP
rs1214752016 3797 dbSNP
rs912828538 3799 dbSNP
rs139891774 3809 dbSNP
rs944363184 3809 dbSNP
rs1427961537 3831 dbSNP
rs578204947 3831 dbSNP
rs1171436328 3835 dbSNP
rs543766523 3835 dbSNP
rs1409162497 3836 dbSNP
rs1411821306 3836 dbSNP
rs1421409903 3837 dbSNP
rs11303552 3839 dbSNP
rs1179839239 3839 dbSNP
rs566475698 3839 dbSNP
rs571877934 3839 dbSNP
rs59225917 3839 dbSNP
rs869204355 3839 dbSNP
rs890077574 3839 dbSNP
rs1189935325 3845 dbSNP
rs1481803669 3847 dbSNP
rs376778400 3851 dbSNP
rs1250214072 3869 dbSNP
rs1204793021 3875 dbSNP
rs549873224 3876 dbSNP
rs1308825565 3879 dbSNP
rs1159224554 3882 dbSNP
rs1008658682 3884 dbSNP
rs149812333 3885 dbSNP
rs1335882816 3886 dbSNP
rs900018265 3890 dbSNP
rs755249726 3891 dbSNP
rs1349977404 3900 dbSNP
rs996999558 3910 dbSNP
rs1370100452 3912 dbSNP
rs1387586484 3933 dbSNP
rs1348426805 3937 dbSNP
rs1288015801 3940 dbSNP
rs1460760898 3947 dbSNP
rs1418252691 3953 dbSNP
rs1022323307 3954 dbSNP
rs288239 3958 dbSNP
rs1230381053 3967 dbSNP
rs1471535005 3968 dbSNP
rs1268834663 3970 dbSNP
rs549537396 3973 dbSNP
rs558278562 3978 dbSNP
rs1244670627 3979 dbSNP
rs1212649601 3981 dbSNP
rs1335955151 3984 dbSNP
rs1321059440 3987 dbSNP
rs559569024 3988 dbSNP
rs1316779547 3991 dbSNP
rs1267030298 3992 dbSNP
rs1001517453 3993 dbSNP
rs949284053 3994 dbSNP
rs1293188134 3995 dbSNP
rs1441851847 3996 dbSNP
rs528321318 3998 dbSNP
rs551622305 3999 dbSNP
rs992885737 4001 dbSNP
rs915972978 4002 dbSNP
rs1354909036 4004 dbSNP
rs1420396984 4007 dbSNP
rs1422398107 4010 dbSNP
rs12467992 4013 dbSNP
rs112077770 4015 dbSNP
rs1255292516 4020 dbSNP
rs1207303810 4021 dbSNP
rs1485740782 4024 dbSNP
rs1008425136 4031 dbSNP
rs1218506864 4033 dbSNP
rs973199651 4039 dbSNP
rs920543842 4044 dbSNP
rs929238240 4046 dbSNP
rs1235301145 4049 dbSNP
rs1048070679 4050 dbSNP
rs756665530 4057 dbSNP
rs1383931422 4061 dbSNP
rs536953847 4063 dbSNP
rs145876702 4068 dbSNP
rs964303985 4069 dbSNP
rs567196974 4081 dbSNP
rs1411834935 4082 dbSNP
rs1289068515 4086 dbSNP
rs974375059 4087 dbSNP
rs1226563324 4088 dbSNP
rs1038826099 4096 dbSNP
rs1314832536 4103 dbSNP
rs1207420705 4104 dbSNP
rs775137668 4107 dbSNP
rs535934481 4118 dbSNP
rs374709359 4130 dbSNP
rs1483840977 4131 dbSNP
rs1272803237 4138 dbSNP
rs113114508 4139 dbSNP
rs1226920201 4140 dbSNP
rs1325664399 4145 dbSNP
rs1295958549 4151 dbSNP
rs1383857802 4155 dbSNP
rs1324575520 4157 dbSNP
rs1353563508 4161 dbSNP
rs552685551 4163 dbSNP
rs572284338 4164 dbSNP
rs1471551679 4166 dbSNP
rs1183064057 4169 dbSNP
rs534862068 4172 dbSNP
rs1461118155 4175 dbSNP
rs1369844762 4183 dbSNP
rs1458046503 4184 dbSNP
rs1373995735 4187 dbSNP
rs1195859469 4189 dbSNP
rs1251653404 4191 dbSNP
rs990281686 4201 dbSNP
rs1257490446 4203 dbSNP
rs558085787 4207 dbSNP
rs1189231425 4210 dbSNP
rs188580023 4211 dbSNP
rs1032312636 4220 dbSNP
rs1445749982 4227 dbSNP
rs543765765 4228 dbSNP
rs1045590583 4232 dbSNP
rs1229416786 4233 dbSNP
rs928533921 4235 dbSNP
rs937275163 4239 dbSNP
rs1415265540 4245 dbSNP
rs1356826015 4252 dbSNP
rs895840343 4255 dbSNP
rs1014193968 4257 dbSNP
rs1390306882 4259 dbSNP
rs1396838152 4264 dbSNP
rs1169262385 4266 dbSNP
rs1460243352 4267 dbSNP
rs1417541309 4270 dbSNP
rs192831162 4271 dbSNP
rs1047576826 4275 dbSNP
rs970110341 4282 dbSNP
rs1181267620 4283 dbSNP
rs185312986 4285 dbSNP
rs772447770 4291 dbSNP
rs1208260896 4293 dbSNP
rs950575986 4294 dbSNP
rs189272291 4295 dbSNP
rs1019816488 4297 dbSNP
rs1295136387 4299 dbSNP
rs911791446 4301 dbSNP
rs1335811173 4305 dbSNP
rs1343990878 4310 dbSNP
rs1330501573 4311 dbSNP
rs529561766 4326 dbSNP
rs1228838054 4336 dbSNP
rs1277524812 4340 dbSNP
rs1394210799 4345 dbSNP
rs1326928838 4348 dbSNP
rs944382429 4351 dbSNP
rs141819911 4353 dbSNP
rs997018337 4354 dbSNP
rs1470579635 4355 dbSNP
rs921717891 4359 dbSNP
rs1365556466 4366 dbSNP
rs1191995722 4372 dbSNP
rs543868272 4381 dbSNP
rs1043834120 4382 dbSNP
rs368851383 4391 dbSNP
rs1253856284 4402 dbSNP
rs957004805 4403 dbSNP
rs1469626388 4404 dbSNP
rs989860093 4407 dbSNP
rs1350804253 4408 dbSNP
rs182063690 4408 dbSNP
rs1280720073 4422 dbSNP
rs1388726626 4423 dbSNP
rs1231639736 4425 dbSNP
rs545182012 4427 dbSNP
rs934802132 4431 dbSNP
rs1343778443 4435 dbSNP
rs1318269715 4438 dbSNP
rs1168826076 4447 dbSNP
rs1401751070 4454 dbSNP
rs1053397366 4462 dbSNP
rs183747636 4468 dbSNP
rs1434181009 4473 dbSNP
rs530831280 4477 dbSNP
rs1178342477 4478 dbSNP
rs1406836470 4483 dbSNP
rs773496780 4485 dbSNP
rs928419285 4490 dbSNP
rs937160409 4490 dbSNP
rs1014244936 4491 dbSNP
rs1192388313 4492 dbSNP
rs1447451049 4502 dbSNP
rs1022920566 4504 dbSNP
rs1208185575 4506 dbSNP
rs769825577 4509 dbSNP
rs1346478054 4510 dbSNP
rs1235974041 4511 dbSNP
rs1318404461 4515 dbSNP
rs1360346022 4516 dbSNP
rs1269920539 4518 dbSNP
rs1367230485 4519 dbSNP
rs1328776800 4520 dbSNP
rs1311564191 4521 dbSNP
rs1434239358 4522 dbSNP
rs905834708 4526 dbSNP
rs1376096709 4539 dbSNP
rs1175793934 4542 dbSNP
rs1408358216 4543 dbSNP
rs1417146231 4552 dbSNP
rs550641351 4554 dbSNP
rs994943299 4555 dbSNP
rs1028128040 4558 dbSNP
rs1475615939 4567 dbSNP
rs1431290421 4571 dbSNP
rs1055692066 4573 dbSNP
rs567239411 4575 dbSNP
rs950601483 4576 dbSNP
rs57129747 4581 dbSNP
rs1342453206 4583 dbSNP
rs983676922 4589 dbSNP
rs931289612 4590 dbSNP
rs1278746233 4598 dbSNP
rs1018906294 4603 dbSNP
rs1206256071 4605 dbSNP
rs529669406 4611 dbSNP
rs1292004714 4615 dbSNP
rs1246773670 4626 dbSNP
rs1414662223 4627 dbSNP
rs1466636848 4628 dbSNP
rs546211562 4638 dbSNP
rs562184991 4643 dbSNP
rs887184886 4647 dbSNP
rs944104378 4659 dbSNP
rs1041115368 4671 dbSNP
rs145643242 4675 dbSNP
rs1410370348 4676 dbSNP
rs996981073 4676 dbSNP
rs974617607 4697 dbSNP
rs1032540321 4704 dbSNP
rs921606974 4714 dbSNP
rs766577050 4717 dbSNP
rs1246433070 4722 dbSNP
rs376814958 4723 dbSNP
rs113524817 4729 dbSNP
rs1019981824 4731 dbSNP
rs1193096727 4734 dbSNP
rs1232004133 4736 dbSNP
rs967455226 4737 dbSNP
rs1271589064 4739 dbSNP
rs1233225118 4743 dbSNP
rs558286607 4747 dbSNP
rs1336185162 4749 dbSNP
rs1456815052 4751 dbSNP
rs1157025870 4754 dbSNP
rs1295651184 4755 dbSNP
rs1222176645 4765 dbSNP
rs1372671636 4768 dbSNP
rs759635717 4772 dbSNP
rs1298980676 4774 dbSNP
rs763979328 4785 dbSNP
rs1402197346 4793 dbSNP
rs1323576069 4795 dbSNP
rs981175053 4804 dbSNP
rs1395183956 4805 dbSNP
rs1035457379 4806 dbSNP
rs571797643 4808 dbSNP
rs991344510 4820 dbSNP
rs1329093650 4824 dbSNP
rs1406561385 4826 dbSNP
rs919839832 4829 dbSNP
rs867614589 4832 dbSNP
rs1438196344 4835 dbSNP
rs371079171 4839 dbSNP
rs1213531703 4854 dbSNP
rs1283580429 4871 dbSNP
rs931280980 4877 dbSNP
rs537731372 4879 dbSNP
rs983114240 4884 dbSNP
rs1316441776 4894 dbSNP
rs1226112943 4895 dbSNP
rs751469475 4897 dbSNP
rs557394670 4898 dbSNP
rs944057796 4903 dbSNP
rs1206170324 4912 dbSNP
rs1302920754 4914 dbSNP
rs1041077339 4915 dbSNP
rs899954167 4919 dbSNP
rs1295255454 4926 dbSNP
rs1451456967 4929 dbSNP
rs1289655562 4933 dbSNP
rs113795186 4951 dbSNP
rs1201435776 4952 dbSNP
rs1192591417 4954 dbSNP
rs1454997071 4959 dbSNP
rs1053917510 4961 dbSNP
rs1269952335 4962 dbSNP
rs894041176 4964 dbSNP
rs1021628012 4965 dbSNP
rs1218944396 4965 dbSNP
rs917540098 4965 dbSNP
rs543006960 4974 dbSNP
rs781030377 4976 dbSNP
rs905889615 4991 dbSNP
rs750255118 4992 dbSNP
rs1331478620 5005 dbSNP
rs1303064022 5007 dbSNP
rs1470487367 5009 dbSNP
rs1162529578 5010 dbSNP
rs1388457046 5011 dbSNP
rs1361268381 5014 dbSNP
rs1049172816 5019 dbSNP
rs1303533403 5023 dbSNP
rs1373045202 5027 dbSNP
rs1369626841 5028 dbSNP
rs886515284 5029 dbSNP
rs1434877857 5030 dbSNP
rs1407557316 5031 dbSNP
rs553411849 5035 dbSNP
rs760135652 5043 dbSNP
rs573326611 5050 dbSNP
rs1263114031 5052 dbSNP
rs1240420698 5053 dbSNP
rs1196411291 5056 dbSNP
rs991313504 5057 dbSNP
rs1256816762 5072 dbSNP
rs1026787253 5073 dbSNP
rs545564708 5075 dbSNP
rs1354852062 5076 dbSNP
rs768308897 5080 dbSNP
rs1249831979 5081 dbSNP
rs1225258594 5082 dbSNP
rs1292887581 5084 dbSNP
rs982699675 5085 dbSNP
rs1278788009 5089 dbSNP
rs1028891973 5090 dbSNP
rs967763950 5094 dbSNP
rs979495554 5097 dbSNP
rs908470443 5102 dbSNP
rs944037614 5110 dbSNP
rs760236837 5115 dbSNP
rs1482854183 5118 dbSNP
rs559802273 5122 dbSNP
rs565080567 5124 dbSNP
rs1403987597 5136 dbSNP
rs923750684 5137 dbSNP
rs921343847 5144 dbSNP
rs1438511029 5158 dbSNP
rs956660072 5163 dbSNP
rs1366718508 5166 dbSNP
rs1053806133 5168 dbSNP
rs991833576 5176 dbSNP
rs917425349 5177 dbSNP
rs1417760721 5178 dbSNP
rs1163999239 5181 dbSNP
rs778603235 5192 dbSNP
rs1427457112 5199 dbSNP
rs915371675 5202 dbSNP
rs945554722 5204 dbSNP
rs950195153 5206 dbSNP
rs530652208 5209 dbSNP
rs1042614824 5212 dbSNP
rs1258388661 5213 dbSNP
rs1220404501 5217 dbSNP
rs1332654360 5223 dbSNP
rs1396744722 5224 dbSNP
rs188415768 5227 dbSNP
rs1341692428 5230 dbSNP
rs1331606532 5231 dbSNP
rs1339238232 5232 dbSNP
rs111451167 5233 dbSNP
rs1248723335 5234 dbSNP
rs529954170 5241 dbSNP
rs927521922 5244 dbSNP
rs1341832942 5245 dbSNP
rs141118092 5262 dbSNP
rs1473830262 5264 dbSNP
rs1362092621 5268 dbSNP
rs1181365483 5270 dbSNP
rs1240243518 5271 dbSNP
rs1435454670 5271 dbSNP
rs894156120 5271 dbSNP
rs930694781 5281 dbSNP
rs1253340109 5282 dbSNP
rs1481078142 5283 dbSNP
rs1200005005 5286 dbSNP
rs1254105836 5287 dbSNP
rs1272499031 5288 dbSNP
rs1210320216 5290 dbSNP
rs1462604721 5295 dbSNP
rs1184089035 5304 dbSNP
rs143521064 5307 dbSNP
rs760950778 5313 dbSNP
rs886401649 5315 dbSNP
rs1005384157 5332 dbSNP
rs1004480009 5336 dbSNP
rs1370651984 5341 dbSNP
rs1170217189 5343 dbSNP
rs1324817726 5348 dbSNP
rs1373350535 5349 dbSNP
rs1040454662 5350 dbSNP
rs1170302210 5352 dbSNP
rs901696503 5353 dbSNP
rs1407511922 5356 dbSNP
rs995992102 5359 dbSNP
rs771093498 5361 dbSNP
rs1455071785 5364 dbSNP
rs1338010037 5371 dbSNP
rs1382440591 5378 dbSNP
rs1191934193 5389 dbSNP
rs1452378567 5394 dbSNP
rs1015490464 5397 dbSNP
rs139682974 5398 dbSNP
rs1453315367 5402 dbSNP
rs976711283 5406 dbSNP
rs1204081495 5409 dbSNP
rs1353775099 5410 dbSNP
rs181180478 5412 dbSNP
rs1231570610 5415 dbSNP
rs1298173642 5418 dbSNP
rs7582988 5428 dbSNP
rs968363745 5430 dbSNP
rs1000577778 5436 dbSNP
rs1254373253 5437 dbSNP
rs1325698100 5438 dbSNP
rs545004223 5445 dbSNP
rs1400739098 5446 dbSNP
rs1267472414 5448 dbSNP
rs1172015762 5450 dbSNP
rs1434283223 5468 dbSNP
rs147997521 5469 dbSNP
rs1296120989 5470 dbSNP
rs752781564 5475 dbSNP
rs1262082406 5479 dbSNP
rs1042989047 5480 dbSNP
rs1192791178 5481 dbSNP
rs1432267446 5483 dbSNP
rs1488348642 5484 dbSNP
rs1367108809 5486 dbSNP
rs769449848 5490 dbSNP
rs374672366 5501 dbSNP
rs140832472 5504 dbSNP
rs767365143 5506 dbSNP
rs1055388753 5507 dbSNP
rs894125033 5508 dbSNP
rs1430943179 5513 dbSNP
rs1012604528 5514 dbSNP
rs557543490 5521 dbSNP
rs1219716211 5522 dbSNP
rs1342470932 5525 dbSNP
rs980229279 5526 dbSNP
rs927606523 5532 dbSNP
rs191488197 5536 dbSNP
rs1414242951 5538 dbSNP
rs985025640 5543 dbSNP
rs1336378508 5544 dbSNP
rs1415984835 5546 dbSNP
rs888214015 5548 dbSNP
rs1004044763 5549 dbSNP
rs1291007465 5552 dbSNP
rs181504755 5561 dbSNP
rs940649646 5570 dbSNP
rs965190483 5571 dbSNP
rs1472158027 5577 dbSNP
rs762215542 5577 dbSNP
rs1211735213 5582 dbSNP
rs1347588182 5582 dbSNP
rs553399535 5582 dbSNP
rs1040506378 5592 dbSNP
rs879301609 5598 dbSNP
rs750179047 5603 dbSNP
rs1320708726 5612 dbSNP
rs750261169 5613 dbSNP
rs1291944625 5615 dbSNP
rs1326999638 5616 dbSNP
rs1028213819 5618 dbSNP
rs1217810733 5622 dbSNP
rs931837141 5631 dbSNP
rs1050250379 5637 dbSNP
rs1440207624 5641 dbSNP
rs1488061162 5648 dbSNP
rs1352557245 5655 dbSNP
rs903649371 5663 dbSNP
rs1207808320 5668 dbSNP
rs954017158 5670 dbSNP
rs989916911 5676 dbSNP
rs1001200849 5679 dbSNP
rs915327170 5683 dbSNP
rs967231038 5684 dbSNP
rs1180847353 5686 dbSNP
rs1030891439 5689 dbSNP
rs1409048858 5690 dbSNP
rs1468336482 5696 dbSNP
rs1237185120 5700 dbSNP
rs892147019 5708 dbSNP
rs1417890464 5713 dbSNP
rs377151818 5714 dbSNP
rs573314424 5716 dbSNP
rs1013190680 5718 dbSNP
rs1179701721 5720 dbSNP
rs1459352350 5723 dbSNP
rs1346284862 5728 dbSNP
rs1457755675 5733 dbSNP
rs755880490 5733 dbSNP
rs1221423873 5743 dbSNP
rs1322410031 5751 dbSNP
rs1413259462 5752 dbSNP
rs1024710826 5753 dbSNP
rs1292144610 5755 dbSNP
rs1401970883 5761 dbSNP
rs1171601679 5765 dbSNP
rs928079144 5770 dbSNP
rs186984271 5771 dbSNP
rs1310217728 5774 dbSNP
rs1447304756 5775 dbSNP
rs190879579 5800 dbSNP
rs1323841531 5801 dbSNP
rs1457295640 5812 dbSNP
rs1348657071 5815 dbSNP
rs980449512 5820 dbSNP
rs1166381357 5828 dbSNP
rs1307661583 5848 dbSNP
rs779808628 5852 dbSNP
rs575715582 5853 dbSNP
rs1293595411 5865 dbSNP
rs1489125842 5870 dbSNP
rs1490413502 5873 dbSNP
rs753508251 5880 dbSNP
rs948347282 5883 dbSNP
rs113393408 5886 dbSNP
rs1287034496 5894 dbSNP
rs1242530322 5898 dbSNP
rs1355606984 5899 dbSNP
rs908102233 5901 dbSNP
rs939730349 5926 dbSNP
rs1036784370 5930 dbSNP
rs1368272830 5933 dbSNP
rs940701304 5940 dbSNP
rs560758733 5943 dbSNP
rs1028182871 5947 dbSNP
rs1177242365 5947 dbSNP
rs574347065 5952 dbSNP
rs74789597 5953 dbSNP
rs541361858 5955 dbSNP
rs1409443054 5959 dbSNP
rs1158881588 5970 dbSNP
rs1421077116 5980 dbSNP
rs561000639 5980 dbSNP
rs1162062634 5981 dbSNP
rs932059478 5987 dbSNP
rs1010899361 5990 dbSNP
rs1425559134 5993 dbSNP
rs1263907742 6000 dbSNP
rs1050500372 6001 dbSNP
rs903700527 6005 dbSNP
rs778551898 6015 dbSNP
rs1352945558 6016 dbSNP
rs1303360336 6017 dbSNP
rs747676868 6020 dbSNP
rs936497631 6024 dbSNP
rs1339294339 6026 dbSNP
rs1298338238 6029 dbSNP
rs540186035 6037 dbSNP
rs1399664103 6042 dbSNP
rs966740120 6043 dbSNP
rs1052809344 6056 dbSNP
rs978559599 6061 dbSNP
rs368729768 6064 dbSNP
rs892373107 6072 dbSNP
rs1168955696 6078 dbSNP
rs1298802365 6082 dbSNP
rs753906338 6083 dbSNP
rs1195990427 6084 dbSNP
rs1013242975 6088 dbSNP
rs960854674 6089 dbSNP
rs1024599686 6091 dbSNP
rs1316941667 6098 dbSNP
rs1483457964 6106 dbSNP
rs1359831511 6115 dbSNP
rs1227372223 6120 dbSNP
rs904833228 6131 dbSNP
rs758872464 6132 dbSNP
rs779171743 6152 dbSNP
rs1278727600 6167 dbSNP
rs1219989991 6169 dbSNP
rs1338137232 6170 dbSNP
rs1026710384 6171 dbSNP
rs1404813223 6180 dbSNP
rs1329818715 6181 dbSNP
rs930922898 6188 dbSNP
rs952337225 6194 dbSNP
rs984965217 6197 dbSNP
rs559711906 6209 dbSNP
rs985066241 6212 dbSNP
rs1367898939 6214 dbSNP
rs35971220 6218 dbSNP
rs1015626677 6221 dbSNP
rs1182231242 6227 dbSNP
rs1248679719 6238 dbSNP
rs962287000 6244 dbSNP
rs939720013 6246 dbSNP
rs1457136916 6253 dbSNP
rs1258655707 6257 dbSNP
rs1245485620 6260 dbSNP
rs1037159646 6261 dbSNP
rs1445660541 6271 dbSNP
rs1264287530 6273 dbSNP
rs976293856 6277 dbSNP
rs923278102 6278 dbSNP
rs34476308 6279 dbSNP
rs953331961 6298 dbSNP
rs1378058655 6299 dbSNP
rs986640502 6300 dbSNP
rs1385540019 6301 dbSNP
rs933807248 6302 dbSNP
rs925376421 6305 dbSNP
rs1049583112 6306 dbSNP
rs1238488986 6306 dbSNP
rs1438887143 6306 dbSNP
rs532005146 6306 dbSNP
rs552170136 6308 dbSNP
rs1449850486 6313 dbSNP
rs1266551477 6314 dbSNP
rs1052270607 6321 dbSNP
rs1162156213 6322 dbSNP
rs913695614 6323 dbSNP
rs562407951 6325 dbSNP
rs1011201708 6326 dbSNP
rs1022231427 6350 dbSNP
rs1283479357 6355 dbSNP
rs186613502 6357 dbSNP
rs1358611158 6361 dbSNP
rs189831876 6363 dbSNP
rs904885606 6366 dbSNP
rs1311997598 6371 dbSNP
rs1434761133 6379 dbSNP
rs1338679785 6380 dbSNP
rs1331073011 6398 dbSNP
rs549684241 6