miRTarBase - #MIRT552348 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF704   
Synonyms Gig1
Description zinc finger protein 704
Transcript NM_001033723   
Expression
Putative miRNA Targets on ZNF704
3'UTR of ZNF704
(miRNA target sites are highlighted)
>ZNF704|NM_001033723|3'UTR
   1 GAGACCCCCAGGCAGAGGGGCTCAGGGCCCTGAGCCGCTCCTGCCCTGGCCTGCCACTGCAGGTGTTGGAAAGAGCTTTT
  81 CCTACTGAATAAAACACAGTTGAAGCCAGGAAAAGCCCTTTCAGGAACCTTGGAGGAATAACAGCAAAAACACAGAAAAA
 161 TTGTTTAAGTCACCACCTATGACAAAAGAAAGTTGCTCTTACTGAGAACCCAGCTTGGAGCAGCTATAACTAGTTTTTTT
 241 TCCTTCAAAAGAAAAGTCAACTTTTTTTGCTGTATGTCTAGACTTAAAACTGTGGACTTCTGTAGCAATTGAACCAACAA
 321 AGCCCATTTTACCTAGAAAGGAGGCATATTTTGATAAGCTTTCTGAATTATGCCATTTTCAAGATTTTTTTGACACTTAA
 401 AAAACAAGCTACAGGTTATTCAGTAGCATTTGTACAAAGATCAATACTTACTTTTGTTGTGAATAATCTTTTCCGTATCT
 481 TCCATTTGACTTCTTGGAGCAGTATATGTCAGGATGTGTTGCAAGACAGCGCAGCACTCTGGGCATCTTTTCTATGGCTT
 561 TTTGTTTGTTTTTCTTTTAAGAATGGCCCCACACTGAACCATGGTAGAGCTATTAGTTTGTAGGGCCCCAGATGGCATAA
 641 ACTCGAGAAGGGATTGTCCACGGAAATCACCAGCAGACTTCAGCCCGAAGCTGAGTTCAGGAAGTCCAGCTGTCACTGTT
 721 GGGAAACATCTAGGAGTCTTCCTTGGATCCATAAGAAGCTCTTCCCCTAAAGGCAGCACAGCTAACTCTACTCTCTACCT
 801 GCCACAACTCAGTCAAGAATTGGCACCTGTAGCCATCTGGGTAAGCCTCGATGCTTCTTTCAGGGATGTGACACAAATGG
 881 CAACTCGGAGCTATTTGTTACTGCTTGTCTGTCAAGATTGTAGCCAGGTTAATGGGTCATTTTCCTTCTCTCCAGACTCC
 961 ACCACTGACTGATTTCAGAAGAGGTAGAGAACTCCAAACTGTCCCAGCAGGTTTGCTTTAGACAACAGAGCACAGCCCAC
1041 ATGGCCCTACCTGTTCAGAAAGTCATGTTAGATCAACAAACCACTTCCATTCTGAGTGCACTTTTATAGGTTTTATGCTT
1121 TAGCATGTCCGGGAGATGAGTTAATTAACAATATAAACATTATGTGAGTAAATGGAAGGTCCAAACTTTAAGTTTTTCTT
1201 ATAAAAATATTGGAGCTATTCATTTAAGAATTTGCTCAAAAGGGAACATAACGCCAAAAGGAAAATGCATGTAGGTATAG
1281 GAATTTCTCAGTTTAGTAGGGCCAGGGCTTGCACTATGTTCCATTTATTGGGCTTCGTAACTTACTTGCTTGTTTGTTTG
1361 GGGGATAGTGGTGTGGGGAGAGGGGAGTCGTCAAGCCCTATAAATAAGCTCATTCTCTATCTACCCGACTCTCAATTGCC
1441 CTGCTAAAGAGTTATTTCTCCTATACCTATGCAAAGTAGGAAGAGCACCTTATAGGAGGCACTGTATAGGGACAGGGGAC
1521 ATGGGATCAGCCATAGGAATGTTAAATGAAATTGCACAGAGGAAAGTTTAATATATGTCTAGAGATTATACATACACTTT
1601 TTTAAGCGTAAAAAGAAGACATCTAGTAATGACAGATATTCTTTTTATATACAAGCAAAAGAAAGTATAAGGAGGTTCTA
1681 CAGTGCAACATCCACAATCTGTGCATTCACATATTATGGGACTTTTATTTTTTAAACTCTCATATAAATTTTTTAAAATT
1761 ACTCCTTGGAAGAGATCCTGGTTTTTTTCTTCATTTATTTTTTTCTTTAAAAACATTTATTTTAAGAGAAGAGAAAAAGA
1841 GCTTCATCTAATTTTGCATCTTGATTACCAATCAGTACTAGTCACAGCACCAGCAATACTGTATGTTTTAGACTGACAAG
1921 GTCAGCCAGGAAATGGCATTTTTTTAAACGCAGAAATGTGTTTGTTTCCTCTACTCTAACACGTCCTTTCTCCTCCTGGT
2001 GTCCTGTCACCCCCCATGCAGCACCACTGATGCGAGATGATGCTCTGGCCTGGTCCAGGAAGCCCTGAGCCATGGGCAGA
2081 TTGCCCAGTGGCCTTGGGCGGCCAGAGCTTGTCACCTGTTTAAACAAGTTCACCATGTGTTTAAATGACAGGGTACAGTC
2161 CTGGACCAGAGGTTTTTCTCTTCAGCAAAGCTCCCTGGCCCTTGATCGTTGGACTGTTACTAATAGAAAAAGATTCAAGT
2241 CATGAAGTATAAAATCCATCCCCCATCCCAGAACTTTGAAACACAAGGAGGGAGAGATCTTTGCTATGGAGCAGTCCTGG
2321 AGCAAAGCCCCGTGGCTTCCACCCCCAGATATATACCCCATAAGTAGTGCTGAGCTCCAGCTTAGCTGAGCCAAGCTCAG
2401 TCCTTATCTGGTGTTCAGCCAGTGCACAGGTATAAGCAGAACTACAGAGCTGAATGTAGCTTCCCTGGGATCTCTTCTCC
2481 TTTCTAAAGCATTTTTCACACAGTTCTGTACCTCCTACCCAAGTTGGGGCTGCTTTCTGCCTGCTAGCCCACGGCTCTGT
2561 GTACTTTCTTTTCTGGCTTCAGGTGCAGACAGACCCTCAGTACCTTCCTGGACACAGACACATATTCCCTGGACCAAGGC
2641 GTGGAATAACTAGTAGACCACCAAGCCACAGGTGGCTGGTCTTGAAGAAAAGGGATTATACTCCTTACAGGCCACCCAGA
2721 AAGCTATGAATTCCAATATACACCACTGATCGTGCAAGTTAGGGTTTTTTTTTTTTAAACGTAGCATTATTTTGTTATAT
2801 TTTGGAACTAAATGAAGTGCCAAATTAACCAGACATTCGTTTGATGCCATCTCTGTGGAACCAAGTTCTCTGTGTGTGTT
2881 CGTTTGGCTGGGAGGAGGGGGAGGACTGGGCAGACTGCTCCCACAGCAGGCTGGCAGTGGAACTGGAGCCCTGGCCACCG
2961 CAGGGAGCTCAGAGGCCAATCTACGCAAAAGGCATGCAAAACAATGGATTCTGGTCCCAAAATATTTCTAAGTAAGGCAT
3041 GATGTAGCCTTTTGATTTTTTTTTTATCCTTTGACACCCCAGCCTTCAGAAAAGGTTTTTCATCTCTCTCCAAAGAAGTC
3121 ATTTCATAGTGACTGACAGGACATTCTCCAGAGAGCGACAAAGCAGAGTGGCCAGCAGGCAGTGGTGTTAAGCCTTGGGC
3201 CTTCCCAGCAGATGTGTGCTGCATTGGTGGGTGGGAGGCAGTGTGACAGCCTGGAGAAAACACACAGGTAGCAAGGGAGT
3281 CAGGGGGGAGGTACAAGAGGGCTGTGGACACCTGGCTCTTGCTCATCTTCTTGGTGCTGATCAGCTGGTGGTCACCATCC
3361 CTAAGTACCTCCCAGGGAGCTGCCATTTTCTCCTCTGGGAGCAGCTGCCTGAAGCAAGGAGAGAATGACCTGAAGGGAAG
3441 TACCTCCGGCCAAGAGTGCAGGGCTGCTGTGCCTAGCCTGAGCGGGCCATCTCTAGCAGATATGGACTTCTCTCCACCAC
3521 ACTAGCTGAAAAGTTTTCTCCCTTGGTTGGCAAAAGCCAGTGTCAGGAAAAAAGCTGTGGGTTTCTGACCAAGAATGTGT
3601 GCGCTTAGCTGCAAAGTGCCTGTCAGCAGCTCCAGGCACCAACAAGGTGCCCTTTTATTAGACAATTCCTGCCCGAACAT
3681 AACCATATTGCAGATGAAAATTTTCAATAGAGAATGACACAATTCTTGACCTTTCTAAAAACTTTTCAAAGAGATAGTCA
3761 CATGTGTATATGTTGCAAAAGATTTTTGAAACTGAAATGTCCTCCATTAAATCTCAAGAGCACTCGAGTTTTAAGTCTGC
3841 TGTTTCTGGTGTCACACTAAGACACACTTTTGAAAGCAGCCCTGGGTTCTGAATTAGTTGGCACTGCTGAATCCATGTTC
3921 CCCCTTCATCAGACTCCAAAGTGCAGCATTCACTTGCAAAGGTTGAGAGAAAAGTGGCCAGAATTGTACATATAACAGAG
4001 AATACCTTGAGAATAGTAGCAAAATACTGTAAATAATATTCATTTCCTCAGGGAAAAATAAAGGGCATGCAAAAATAGGT
4081 CTGGAGACTCCTGAAACTAGGAAGAATTTTGTTATCACTAAAGTCTTTTATAGTCAGAACAATTTTTTTTTCAAATGAAC
4161 ATGGTATCATTTCAAGACAAATTTATGTGAACTGGGCAGTACTGACATTTGTGAGGCATAGGGGAGTGCCCTGGGAAAAC
4241 GGTTTGGAGCTGACCTGTAGCCTAAGGCTAACATTTGAACCACAGGTGCAATGCCTGGGGGTGGGGGAGGGGGACGGGGT
4321 GGGGGTGGTATTCCTAGACTCACGTAAGGCTTTTTCTGAATGTAATTGTGAATACAAAGCCTTGCTGGTCCTTTTTATCA
4401 TTACCCAATGGATGACTGTTTATTAGCTATCAGCAGAATTCCGTAGGCGAAAGCAAGCCGTGAACGATGTACATTTTGCT
4481 TTAATAGCATGTTAGCGAACAAACTTCCATGGACTTTTGTGGACAAGGTGCTGCTTTTTCTCATGACCCTGTAGAATTGC
4561 TATCGACCACATCTTCTGTAGCACTGACCTGTGTGAACTCAGGGAAGAATTTGTGCATACAAATGAGTGGAAACAGAGCA
4641 GGATTCATGAATATGAATGAGAATGTGAATCATTTTGGAGAATGCCCTGGGCACACGGGTCAACTGGAAATTTCATTTCT
4721 CTAAGAAAGTAGCCCTACCAGCGGCACGGACTGTTCCTGTTCCTCATACCTGTGGGGATTCCTCCATATTGGAACTGTTT
4801 CATGTATCTTTTTTGCATTGTAACTAGCCAAACCTGAAGTCAGTAAATAAAATGAGATTAGCACTTTTTTTAGGTACCAG
4881 TTGTATCACTGAGTAATGCACACCAATAGAGCAAGAAAGTATAAAATGTATTTAAGACCAACTGGTTTGCTTATTATGAC
4961 TGACTTTGAAAAAGCCCATATCCAATGATATACATGCTTTAAAAGGTATATCTATCGTAGGACCAGGAACCAAAATGGGA
5041 ATTTTACTTCTGGTCCTGTTTTGTAAATAGTTCCTTTTTTTGAAGACAATCTCATGTTTTATAACTTTTGTTGTGGGTCT
5121 GAGAATCACAATGGTAATATGTCTTGGCAAAACATAACCTTTAAATACAAAAACAATTATAACTTAATTTTCCAAATAAA
5201 ACAAGAAATACACTGATTAGGCTTCTACAGTTCTAAGAGACATGACACTTTGGTAATAAGCGTCAGTACTCTACTTCTCA
5281 AGTTAACTGGAAATATTTTACAAGATGCAGTGTTTTGTAATCACAAAGAACGCAGACATTTTGTGAGAAATGACCTTGGT
5361 TTTATACATTGTAGCTTATTTTTTAAAATATAGTATTTTACCAGGCAGGAAGTATTAATATTATAAGTAATTCTTGCTCA
5441 CCAAACAAAGGGCTATGTCTCTTTTAAGCAAATGTTTTGATGCATATCTTTTTAATTAACCCTCTGCAGCAAGGGTAGAA
5521 ATACAGATCAGATGGAATGGGTATTATAGGAGAATCAAGATAGCAACAGCTACTCCTTTTACCATTACTAGTGTGTTTTC
5601 AAAGTATGGAAAAAGATGCCTGAAGAGTCATTTTATATATTTTAAATCTAAAAAGTGTTAACAGGTATGCTTATAGGCCA
5681 TGGGAGAAATATTCTTATAAATTTTTTAGTGTAAAATGATAAATTCTGTGTCACAAAGACAAGTTTACCACTTGACCTAC
5761 CAGAATCACAGATACTTGCATTTAACTAGCAAGTATCATTTGGTGGAAATTTCTAAAATCATAGTAGACAGGCCCAAAGA
5841 TAGAATTCTTAGGTGATCAGTAGTGTTTAAAATAATTTTGTCCTCAGCACTAACTATATAACTGTAATTTCTACATAAGA
5921 ACAAGTGCTTCCAAAATATAGTGGAGGGAAAAAATAAAAAAGGAAAATAAAAAAACAAAACAAAAAGAACAAGTGCTTGA
6001 TTTTTCACTGTGAAGAACTAGCAGGCACATGAGGTTGTGATCAGAAAGTGACTGAGTTCCCAAGAACCAGGAAACAGAGG
6081 GGAGTTGTGAAGAGTTTATTAAAACTGTACAAATAATTCAGAGCTTTGCCAAAACCATTTCATAATGCTGTACAGTTTTT
6161 TCAAGCCCACTCACTGTTAAAACAAGAAAGCACCTTTTCTTTCTAAGATTTTAGTAATCCAAAAGCTAGCCTAATTAGCC
6241 AAGTATGCAGATAACATCAAAAGCAAAGCTGAGATAGAACAGCCATACACCCGTTGGGCAGCTCTTATGAGGTGGTCAGA
6321 AGGTCACTCAGACCTTGGTTTCAAATAGGCTTTAGAATCTGCACACTTGAGGACTAGAAATGCACAGAGTTAGGGAAAGC
6401 CATGTACAGGCTTGGCTCCTAGTCTTTGAGATGAGGCGTCTTGCAAATCTCTGTTTTCACTCCTTGGAATGTCTCCATTG
6481 TTAGCATTAAAGTCCCCAAGAAGTTTTTATTGCTGTACGGTTTTGAACCCAATGAGTCTCATTTCCAAAAGATTCCTAAT
6561 TCTATATAGGAGAGGTTGCAAATGTCAGTGCCTCAGAAGGACCAGGCAAGTTCTGTAAATGATTGATGTGGATAAGGCAA
6641 AGAGGAACACAAGAATGGTGGAGACCAGGTTGAACTGCAGAACACATGCCCTCTTTGAAGGGGTGCCCACACTCAGCTCT
6721 AGACAATCAGAACCATGCAGAAATCAGGCCCAGGGCTGCTAGATCTTCTGACGTGGAAGTATGATATTACCTGACACGTA
6801 AGTGTTGACAACTAACTCAAACTCTTGGCCAACACTGTGCAGACCAAAGAGAAGCTGTACACAGACAGGTGCAGCCTGCA
6881 GCCCCCAGTTTCAACTATTGGGAAAAGTGGATTTCACATTCCACAGTTGTCAGGTCAGGTTCATCCATCAGCCCCACAAA
6961 CTCACATGTCGGCACTATCTGGGCAACTAAAATAAAAGAGGGGAAAGAGATCATTTCTCCCCAGATATCATTCTCATGGC
7041 AGACTTGAATATAGATACGCTGAGTTATCCAGCTCTCTCACTCTGCCTCCTTTTGGCATGCCCAGGCTGTGCCCCGTAAA
7121 GTGTTGAATCACTGTTATCCTAATTTTCTTAGTGTTTTCTACCGTGGCCACTGTGATGAGGGGCTGGCAAAGAGCAGCCT
7201 CGTGCCTTCCGAGAAGGCTGCCAGGAGCCTCTGAAGCTTGAAGCGAGCACACATTGCCTCCTTGTGCCAAAGCCCTTGGC
7281 CAGCCTCCCCACACTCCTTCCCTCTCCATCCGGCCTCATGAGTCTTCGTTACCAAGTAAAATTACCACTGCTTCACCTCT
7361 GATACAGCAGAAGCCTTGCTTCAGAACTGGTAGGCATTTAGGCTATTTCAGAGTGTCCACTAACCTCAAAAGGAGGTTTT
7441 TCCACATACAAAACCCTAGCATCTTTGAGGGGAAAGCAAAATGAGAATAAATTATGTCATGAAAAAAATTAGAAGTTGCT
7521 TCCTTCATTTAGATGGACTAAGTTATTTTAAACTCTATCTTACATCAGAGTCCTGATGGTGTTGGGATAGTCACTGACCC
7601 TTTCACGTATGTAATAAGATACGTCTCGTTCACACACTATTTCATTTGATCTTTGTAAGAACCCAGTGTAGAATAGGAAT
7681 ATTTAAAATCAACATTACCCACCTCCAAGGCCAACCCAGAGTAGTCTTGAACCTGAGTCAGCCTCAGTATTGCTTGCAAG
7761 GAAGAGGGAAGGGGCTCATTAAAGGCCTGGCTCAAACCTTAGTCTTCCAGACTGACTAGGGACGTAAGAAGACCCAGGGA
7841 CCCACCATGTTCTCAAACCATCTATTCAGTCCAGGCCTTTCAGCATAGACATAAAGAGCCCACCCGTTACTCAGTCATGT
7921 TGCCAAGTGCAAACTGATTTATCCCCAGATGAATCCCTTTACTGTAGCAGATCCCTAATCCCTAAATTTCAGCCAATTTG
8001 GTAGTTAATTATAGGAGTTTATTAGCTAAATGTATGTTCTGAGTAAAAGTTTTGACTCTTTGGGGAAAATTTATTTTGCT
8081 GCTAGCATACAACATTTGCTATGTATATAAACTTAAGTCAATGCCAGAAATTTTAAAACCAGCTCAAATTTATAATCTGT
8161 AATGATCAAATCAAAACATACTGTAAACTCAGAGTTGGAAACGCCTGGTAATATGGTTAAGTCATGTTTAAATATGAATG
8241 CAATTTAAATGACATTGGCAATGCCTGAGATTTCTTTCATTGTGAATGATTAAAAGGCAGTCCAATATATGAATGGATTT
8321 CATCTTACCTTTCTCCCGTTAATTTACTAGGTGTAACATCTTGAGTGTAAAGTCATTCACAGGCAGTTGGGTTGTGGAGC
8401 TAGAAGGAGCCTCAAAAAAAAACTTTTTGGCCAGACTCCTACATCATGAACAGGGTTTTTGATGAATAATATTTATTATT
8481 ATGTTTCTAAAGTAATACAGTGTTGGAGAATGAAACAGTTTAGTCCTTTCCTCTTCTGATGGAAAAGAATCATAGCGCCG
8561 TTGCCATGACAATAACAGGATGTAGAAAGACCCATGAAGAAAGAAAGAAGAAAGCTATGGTTCCGAAAGCAGGTAACCAC
8641 AGATTTTGAAAGGAGGCAGAGATGGTGATTAAACTGTAGTCCTTGTTTTTTAAAATGTTCTTTCATGTTAGGCACCACCA
8721 CATAGTTAATAACTACCAACTTCTAAAGAGAAGATCCCCTTGATTTATTTATATCATGAAAATACTAAAAATCAATTCTC
8801 AAGTCTAATTAACTATTACATTATCTTGCTAGGTCCTTTTCCCTAAATTTTTAATTCAGAAAATTAACCAGAATTGGCCA
8881 GATGCAGTGGTTCACGCCTATAATCCCAGCACTTTGGGAGTCCAAGGCAGATGGATCACTTGAGGTCAGTAGTTCAAGAC
8961 CAGCCTGGCCAACAGAGGAAGAAAGAGTGAAAACAAAAGAAGAAAGAGGGAAACCCTGTCTTTACTAAAAATACAAAAAT
9041 TAGTCGGGCGTGGTGGCGCACACCTGTAATTCCAGCTACTTGAGAGGCTGAGGCAGGAGAATCCCTTGAAACTGCAGGCA
9121 GAGGTTGCAGTGAGCCAAGATTTCACTGCTGCACCTGGGGTGAGACTACCATTAAGGAAGGAAATTTCCTTTAAACAGAA
9201 AAAAACAAAGGTGCTCATCTATTTCTTCTGAATTCTCTCTACATCCTTGACTTAAGAGGAAAACCAGCACTCAAGAAACA
9281 GCTTTAAAAGAGAACAGTCCCCATTCTAGCTACCAGTCTTGCTTTCCCCCATCTTGGCAAGCCCCAGTGAATTTGCCATT
9361 GAAAGATTACCCTCCCCTTTGCCCTCATCTGCCTGAGCTAGAGGCCAGGCTGTTGTTAATGTTTTTTCAGTTCCAAAGCC
9441 CCTGATGGGACATTCTTGTTTCTGTGCTACTGCTTTCTCTCTCTTAAATTAAGGTGCAAGGGGATAAATATTACTATAAC
9521 TGGGATGTAAGGCTCAGTCAGTGTGGCTATTCCCTCCCTTCGGGGGAAATATTCCATCTGTCTGAACGGTTTTAGGTGAT
9601 CATGAGGAGAGCGGCTTAGTCACACAGCCAGCCACGCTCATCACAAAAGATTTGTTCAGACTCACTGTAAAGAATGACAA
9681 GGCAGATAGCTAATCCTTTCACTGTGCCTCAAAGCCCGCCGTGCAAGTCACCAACCCTACCGGTCCTCTCCACGTGCGAG
9761 GCTAATAGAGTGATCAGAACCAGGAATGTGAGCTGGGTTCCACCTTAGGAGGGGACAATGAGGACAGAGCAAGAGGGCTC
9841 CATGTTTAATTACTCCAGGCTCTGACTTCTGCCCACAATTACAGAGCATGAAAGCAGAATTGGCCTTTAGTAAGTGAAAA
9921 GGAAGTGGCTCCTGCAGCATATAATTGTTATAATTTCGTATTTATGGAAAGAGAAAAGGACTTCAGTCCACTCATGTTGT
10001 TAAGCACTTGTCCCTCACTCCACTGGAGCCCCCTTCCTATGTTTTGGGCACAGATGGCTGGGACCGAGAGGAAAGAGGAA
10081 GAGCGGCTGCCAGAGTGTGAATATACCCCTCAGGGATATACAGCGGAGTTTCATGATAAACTACCCATACTTTCCCAAAA
10161 AAGGTTGAGGAGCAATACATAACTTTGCAGATTACAAACCCTTGTTTTACTTTTTAAACCTTTTTTCCATACTCTGCTTA
10241 TTGGAAATCGATGGCTGTGATGTGACCAACACCTGTGATGATAGCAAAGCCCCTCCTTTCACAGTCTCCTGACTGTTCGG
10321 GGAACCTCCTTGGTCATTGGTAGAAAGCTTTAGAAAAGACTTAGCTTTTTAGGGAAGAACTAAAAAATCTCCAAAACATA
10401 CTAGTCCCATGACTTCGATAACTGAAAATGTCCTGGGTGTAAACTAACCCAGGAATGTGGATCATACATGTTTTTTTTAA
10481 AAAAAATCCCTGAATCAATATTTTCCTACAACACACCCTAAAATTCCTATTTTTGTAATTAATGGTTGGACAGTGATCAG
10561 CCATTTAAACATAGGCTTTCTGGAATAACCAGACACTAGAATAGTTTCCAAAGTGTTTTGCGTATCAAAATCCTATATAC
10641 TTAGAAGAAGAACTCAGGATAAGAAAAAATCGCTAGGTCCCAAAGGGTTCATGACTATCATCAGATGCAACTGCGAGTGG
10721 CCTACGGTCATTTTTTCAAATGAGAAGACTGGAGAGAGAGAACAACAGTAATCACAAAACCTCTGTTGCCCTTAGTCCAT
10801 GACAATGTTTAAGGAAACTTTAAAAAATTAAGCCATCTTCTGAATTGTTTTCTACACCAAATCTAAAATATTAAAATGAA
10881 ATTATTAAATATTTAAAATGGGGTATTTAGTGGAAATGCAATCAGTAGAAAACATTGCTTTTTAGTGCCTGCTAAACAAG
10961 TAAAGGAGAAAGAATGAAGAGAAAACAGCAGTCCTTCCTGTGTGACACTCGTGTGGAAATGACAGGCATTCACATGTCAT
11041 TGAGTGCTAACTCAAAAGCTAGGTGGCAATGCTGTCCAATGTTTAGAGATCTTTTGAAATATAATTTTACCACCATTCAG
11121 AGGTAAGTACTTGCTTAACAGAAGTCTTTAATGTTAGTGAATGAATGTATAAAATTATAAACTATGCATTTTCAAAGAGT
11201 AGCATGTATTTTGTATCGAATCCAAGTAAATTTTTTTCATAGCTACCTACCACAACTGCAAATTATTCAAAATAAACTTG
11281 GATACATATCCTTATGGGGATATGGGAAGCCCATCTATATTCTCCTACTTGATGTTTTTAAAGATTGAAACTTTATTCTG
11361 AAACATCAGGCTCTAAAAAATTCCATCATTAAGATGAATAAATGGGAAATGGTTTATTTGTTACTTCGTAAGCATAAATG
11441 GGAAATGTTGGCTGTTAGAAAATGTGCCCAGTTCTTTAAAGGTGGATGTTCTAGTAACACTGGATTAACAAGCAAACAAA
11521 ACTGCATGAAGTGAACGAATATTTCATTGGATAAAGTTAGCATAGGTTTTATCTGCTGGGTTTAATTCTCAATCCCAGAA
11601 AAAAATATTCTTCAAGGGGTATCAGTTATAGTTTCAAAGAACAAAATATGAAAATATTGTCCAGCAAAGCAAATCATTGA
11681 TCTTTTTTCAAAATTACTTATATTTTGGAAAGTCTATATAGAATATCCACAAATTTCTTCAGCCCTCTTGTTGATTTCAT
11761 ATTTTCATGAAACTTTTTCCCCTAATAATTTGTCTTCGCTCTTTAATCAGTGCTTTACTACATTACTCAGCCTGAAAAAA
11841 TATCTTTTCCTTCATCTGACAATGTGGAAATAAAGAACTCCATTTCTGTCATTCTGGTTCTCTTCAGTGTCCATTGAGAA
11921 AGTTTCTCAACTGTTTGTAAAATACGGGGGGAAAAAAACACGCATTTCTAAACCTGGTACTTAAGGTTATACTGGATTGT
12001 TTGCTACCTAATTAGAAGTTATTGGGGAAGGGGCATTGTGTCTTTTTATATGATTTTTAGCCAAATCCAGATGTTCTGAT
12081 ACACATTTCTGAATACCTGTCTGACTGTAAATACAGCCTGTGGAGGTTCAGGTTGATAAACCTTTCACCTGACTGCTCCA
12161 CAGCCATGCTCCTTGCCAGCTTCTGGCACATTGTACATAGATTTGTTGAATGTTTAAATGATGTTGTTTTTCTAAATGCT
12241 GTTCTCTAAAACAATTTTTTGAATTTCTTTTGCTTTCCATTGTTTTGGACTTTGTGTGTTCGTTTTTTAAAAAAAAAAAT
12321 GTTTCCTAAATATTTAACACCAGGAAAAATATTTTTAAATACACTGGTGCTAATTGAAACAGAAGGAAATTTTCAGATCG
12401 AAGATGTACAATGTTAAATGTTCATACCAGTTAAACTGCACTTTCCCAAGGGGACAGCTGGCATCTACTTGAAATGGGCA
12481 TCAAGAGACCACCAAATGTTTACAGTTTCTGTGGCCCGTTTAAGTGTAAAATGCAGAAGTGGCTCTGTCCCCCCAGAGTT
12561 AAGGATTTGCTACACTGGTCCTCTGGAAGCATTTAAGTAGAAGAAAAGGCTTATAGTCAGAATCACTTTAGTAATCGTCT
12641 TCTGGTCCTTGGACTTTTCTGTTCTGTAATGCTTGTAACAATGAATATGGTGTTGCCAATCTAGTCTGATATCATTGTTG
12721 ACCTGTACTTACTTTGTGGATGGTTCTACCTGGGGTTGCACTGGCACAAACAGAGCCAGAACACTGGACTTTCAAAAGAC
12801 CATTTTGACTTCTACAGTGTCCACACACATGAATTTAAATGCACTTGTAACTGGTTAATTACCATGAAGTAAGTCTAACT
12881 TCCACTTAATAAAAGTTTTTGTGTATCTGCTTCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAU-ACACGACGAu 5'
             |||:  ||| | ||||||| 
Target 5' ggaAAAT--TTATTTTGCTGCTa 3'
8064 - 8084 155.00 -10.70
2
miRNA  3' guGUUUGGUAAUA-------CACGACGAu 5'
            :::||: ||:|       |||||||| 
Target 5' caTGGACTTTTGTGGACAAGGTGCTGCTt 3'
4508 - 4536 152.00 -15.31
3
miRNA  3' guGUUUGGUAAUACACGACGau 5'
            | |:| : |:||||||||  
Target 5' tcCCAGCAGATGTGTGCTGCat 3'
3203 - 3224 144.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30506551 18 COSMIC
COSN31498181 23 COSMIC
COSN30506481 25 COSMIC
COSN31479874 34 COSMIC
COSN512317 36 COSMIC
COSN28876978 37 COSMIC
COSN31513747 37 COSMIC
COSN30400524 56 COSMIC
COSN19731734 62 COSMIC
COSN25143814 137 COSMIC
COSN31560026 144 COSMIC
COSN31489098 171 COSMIC
COSN21668048 181 COSMIC
COSN31545438 233 COSMIC
COSN16864988 272 COSMIC
COSN26601741 332 COSMIC
COSN7678155 337 COSMIC
COSN19656270 351 COSMIC
COSN6601671 373 COSMIC
COSN31606565 383 COSMIC
COSN31555182 384 COSMIC
COSN17438054 797 COSMIC
COSN32208118 981 COSMIC
COSN30166856 987 COSMIC
COSN30165052 991 COSMIC
COSN31537149 1065 COSMIC
COSN30160434 1083 COSMIC
COSN26556904 1149 COSMIC
COSN26507606 1261 COSMIC
COSN26551528 1268 COSMIC
COSN4924176 1278 COSMIC
COSN31607048 1287 COSMIC
COSN26650558 1333 COSMIC
COSN31538435 1541 COSMIC
COSN31577494 1561 COSMIC
COSN31484363 1718 COSMIC
COSN32058175 1965 COSMIC
COSN22489384 2164 COSMIC
COSN31593241 2715 COSMIC
COSN17774155 2751 COSMIC
COSN27207708 2765 COSMIC
COSN26557476 2847 COSMIC
COSN26285130 2865 COSMIC
COSN1368665 3056 COSMIC
COSN1368664 3270 COSMIC
COSN9682365 3577 COSMIC
COSN20744326 3603 COSMIC
COSN25671217 3648 COSMIC
COSN18972252 3948 COSMIC
COSN20959508 4215 COSMIC
COSN25228026 4284 COSMIC
COSN29857092 4562 COSMIC
COSN9682364 4580 COSMIC
COSN29186298 5010 COSMIC
COSN19496449 5301 COSMIC
COSN25563232 5318 COSMIC
COSN21196528 5375 COSMIC
COSN16771791 5384 COSMIC
COSN25749558 5647 COSMIC
COSN9270190 5650 COSMIC
COSN5689237 5798 COSMIC
COSN7678154 5859 COSMIC
COSN9682363 6053 COSMIC
COSN15668263 6119 COSMIC
COSN22231597 6138 COSMIC
COSN20312477 6536 COSMIC
COSN4942151 6659 COSMIC
COSN9682362 6659 COSMIC
COSN22556602 6860 COSMIC
COSN30403422 7291 COSMIC
COSN19240912 7327 COSMIC
COSN31962979 7644 COSMIC
COSN8104104 7802 COSMIC
COSN32208117 9691 COSMIC
COSN20376936 9742 COSMIC
COSN20860438 10088 COSMIC
COSN16034852 10244 COSMIC
COSN15736844 10278 COSMIC
COSN17522140 10478 COSMIC
COSN28196111 10479 COSMIC
COSN26315760 10725 COSMIC
COSN9270189 10900 COSMIC
COSN17381114 11124 COSMIC
COSN32020226 11296 COSMIC
COSN29994036 11412 COSMIC
COSN28447319 11428 COSMIC
COSN6365061 11674 COSMIC
COSN24563020 11890 COSMIC
COSN8104103 11916 COSMIC
COSN28198280 12232 COSMIC
COSN8104102 12307 COSMIC
COSN28927294 12308 COSMIC
COSN27589802 12309 COSMIC
COSN20754408 12471 COSMIC
COSN28211251 12764 COSMIC
rs62515108 6973 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs770090465 5 dbSNP
rs375106950 6 dbSNP
rs777686853 7 dbSNP
rs755947140 8 dbSNP
rs752469895 12 dbSNP
rs1329006770 15 dbSNP
rs767174909 17 dbSNP
rs755229528 18 dbSNP
rs1368351295 19 dbSNP
rs751671293 20 dbSNP
rs946366384 26 dbSNP
rs1434559969 27 dbSNP
rs377039138 28 dbSNP
rs1439694837 31 dbSNP
rs1320899929 35 dbSNP
rs372497081 36 dbSNP
rs370835879 37 dbSNP
rs1386195648 40 dbSNP
rs529824338 41 dbSNP
rs1415011660 42 dbSNP
rs1423852919 43 dbSNP
rs1320143693 44 dbSNP
rs561253726 45 dbSNP
rs762363761 47 dbSNP
rs1248268558 48 dbSNP
rs1257605464 49 dbSNP
rs777086104 49 dbSNP
rs373091684 50 dbSNP
rs746199346 50 dbSNP
rs374538988 52 dbSNP
rs973324535 56 dbSNP
rs1224150638 63 dbSNP
rs779136768 70 dbSNP
rs1247728418 75 dbSNP
rs1488434240 76 dbSNP
rs182086363 84 dbSNP
rs755069234 85 dbSNP
rs910130393 89 dbSNP
rs1478494486 90 dbSNP
rs1170796927 100 dbSNP
rs984106354 114 dbSNP
rs1418281798 115 dbSNP
rs1407864591 122 dbSNP
rs970067915 123 dbSNP
rs1350303288 128 dbSNP
rs879028990 131 dbSNP
rs1023005473 132 dbSNP
rs1301169289 136 dbSNP
rs1342311642 142 dbSNP
rs992898765 157 dbSNP
rs1459787426 177 dbSNP
rs1264980528 188 dbSNP
rs530449745 198 dbSNP
rs1400625762 199 dbSNP
rs1204201506 201 dbSNP
rs1316828964 204 dbSNP
rs1249047850 210 dbSNP
rs960512836 215 dbSNP
rs1229178202 217 dbSNP
rs754323952 218 dbSNP
rs999782464 219 dbSNP
rs1326606013 222 dbSNP
rs1230304653 229 dbSNP
rs564533013 230 dbSNP
rs1291015297 234 dbSNP
rs1312501390 235 dbSNP
rs73691961 239 dbSNP
rs1027604307 242 dbSNP
rs889051167 242 dbSNP
rs902387409 246 dbSNP
rs1022640069 247 dbSNP
rs146351216 251 dbSNP
rs1036514356 252 dbSNP
rs889494135 256 dbSNP
rs1049486872 257 dbSNP
rs1183278592 257 dbSNP
rs1443726925 260 dbSNP
rs1161454386 264 dbSNP
rs1362303328 269 dbSNP
rs559137626 272 dbSNP
rs896618589 273 dbSNP
rs1450433501 274 dbSNP
rs762281753 278 dbSNP
rs1056575657 281 dbSNP
rs540843211 282 dbSNP
rs574900378 290 dbSNP
rs559700416 292 dbSNP
rs1355047231 295 dbSNP
rs1282903954 301 dbSNP
rs926863337 305 dbSNP
rs1211642362 308 dbSNP
rs1237630522 315 dbSNP
rs1443633734 320 dbSNP
rs1037164418 321 dbSNP
rs1382006763 323 dbSNP
rs761470820 341 dbSNP
rs773929216 347 dbSNP
rs940192185 348 dbSNP
rs910129708 351 dbSNP
rs777188248 353 dbSNP
rs979729417 357 dbSNP
rs1405746418 358 dbSNP
rs555273007 359 dbSNP
rs948706896 363 dbSNP
rs768974235 370 dbSNP
rs1457222236 372 dbSNP
rs988594148 392 dbSNP
rs1333759191 410 dbSNP
rs966137786 422 dbSNP
rs1238819714 423 dbSNP
rs1247837435 427 dbSNP
rs762480934 441 dbSNP
rs960088898 442 dbSNP
rs1196994583 443 dbSNP
rs538537152 444 dbSNP
rs1263292980 445 dbSNP
rs1460587362 449 dbSNP
rs575750128 450 dbSNP
rs1264543190 454 dbSNP
rs953218258 460 dbSNP
rs1180855937 465 dbSNP
rs1231048049 468 dbSNP
rs1027983788 472 dbSNP
rs376739688 474 dbSNP
rs966981106 475 dbSNP
rs10504721 479 dbSNP
rs1446722627 500 dbSNP
rs1469319190 502 dbSNP
rs1010852185 507 dbSNP
rs1401330839 508 dbSNP
rs953956631 511 dbSNP
rs1391120765 512 dbSNP
rs1327269618 515 dbSNP
rs1333325855 521 dbSNP
rs1331423055 528 dbSNP
rs538990532 530 dbSNP
rs1027968076 531 dbSNP
rs1390086046 534 dbSNP
rs1221191925 536 dbSNP
rs1013935535 537 dbSNP
rs895581323 540 dbSNP
rs1194948950 543 dbSNP
rs1248236459 554 dbSNP
rs1426706117 554 dbSNP
rs1055497637 564 dbSNP
rs1002308402 570 dbSNP
rs1163931259 572 dbSNP
rs566979192 573 dbSNP
rs1195950127 574 dbSNP
rs1424513777 574 dbSNP
rs905407384 574 dbSNP
rs1166500148 583 dbSNP
rs769741222 588 dbSNP
rs1406431963 603 dbSNP
rs1303036128 604 dbSNP
rs1344200019 609 dbSNP
rs1402496350 610 dbSNP
rs1362032566 612 dbSNP
rs1044357987 616 dbSNP
rs1183876060 622 dbSNP
rs1226314264 623 dbSNP
rs946994754 627 dbSNP
rs1437967645 628 dbSNP
rs1358151341 632 dbSNP
rs997853585 637 dbSNP
rs75947990 644 dbSNP
rs1490723710 645 dbSNP
rs1037221506 651 dbSNP
rs1292996671 652 dbSNP
rs1428115560 661 dbSNP
rs745718630 662 dbSNP
rs1370454567 663 dbSNP
rs1348951065 666 dbSNP
rs944719949 670 dbSNP
rs1163362296 671 dbSNP
rs533439238 675 dbSNP
rs376961415 684 dbSNP
rs562978795 687 dbSNP
rs1422134385 690 dbSNP
rs1299485893 695 dbSNP
rs1385112530 705 dbSNP
rs536483334 712 dbSNP
rs1381190763 718 dbSNP
rs1292934405 721 dbSNP
rs888634591 722 dbSNP
rs1048611546 723 dbSNP
rs911963175 727 dbSNP
rs544750500 732 dbSNP
rs1281395285 733 dbSNP
rs1407022336 736 dbSNP
rs1366388780 749 dbSNP
rs1246353536 753 dbSNP
rs1314192225 762 dbSNP
rs953184367 764 dbSNP
rs986254488 764 dbSNP
rs1399944758 765 dbSNP
rs920448329 769 dbSNP
rs1382493796 771 dbSNP
rs1327238103 773 dbSNP
rs948947056 775 dbSNP
rs1461947155 781 dbSNP
rs1183363490 790 dbSNP
rs980454093 790 dbSNP
rs1383842300 796 dbSNP
rs969098405 797 dbSNP
rs1442066602 799 dbSNP
rs1160524385 807 dbSNP
rs962005246 809 dbSNP
rs1428013756 810 dbSNP
rs1196597210 811 dbSNP
rs1481114538 823 dbSNP
rs1014975570 835 dbSNP
rs775498463 843 dbSNP
rs879102313 849 dbSNP
rs1057023365 850 dbSNP
rs1034057715 851 dbSNP
rs1242094913 855 dbSNP
rs1307564032 857 dbSNP
rs1445699148 861 dbSNP
rs1236892872 865 dbSNP
rs369168405 877 dbSNP
rs772309786 886 dbSNP
rs567325429 887 dbSNP
rs1203330716 892 dbSNP
rs781123350 894 dbSNP
rs1459330950 897 dbSNP
rs1206250623 901 dbSNP
rs770782000 907 dbSNP
rs1250347501 915 dbSNP
rs977949623 935 dbSNP
rs763465047 936 dbSNP
rs1156292104 938 dbSNP
rs748410747 942 dbSNP
rs915088738 952 dbSNP
rs1469965331 957 dbSNP
rs1011548756 960 dbSNP
rs892708617 969 dbSNP
rs1052712226 976 dbSNP
rs989331312 978 dbSNP
rs1403472621 993 dbSNP
rs1448649437 1001 dbSNP
rs574053686 1010 dbSNP
rs1028250938 1024 dbSNP
rs997842295 1031 dbSNP
rs1389663755 1036 dbSNP
rs911930684 1050 dbSNP
rs965455390 1051 dbSNP
rs1319983496 1053 dbSNP
rs1320272046 1056 dbSNP
rs1401247393 1058 dbSNP
rs1015323600 1066 dbSNP
rs1251158429 1067 dbSNP
rs1174152975 1071 dbSNP
rs1479931262 1075 dbSNP
rs920399897 1079 dbSNP
rs1004396753 1081 dbSNP
rs888213082 1092 dbSNP
rs1480451382 1096 dbSNP
rs962213548 1099 dbSNP
rs907766009 1100 dbSNP
rs1411371965 1104 dbSNP
rs1170868463 1105 dbSNP
rs775332377 1106 dbSNP
rs1353761783 1108 dbSNP
rs992741364 1110 dbSNP
rs555802234 1115 dbSNP
rs1013043285 1119 dbSNP
rs1244220035 1127 dbSNP
rs894698248 1130 dbSNP
rs550506000 1131 dbSNP
rs142461435 1133 dbSNP
rs1021824679 1141 dbSNP
rs1306085485 1144 dbSNP
rs1224267214 1149 dbSNP
rs1011057589 1151 dbSNP
rs892668456 1153 dbSNP
rs1206110048 1159 dbSNP
rs1490331351 1162 dbSNP
rs1221087850 1163 dbSNP
rs1266222640 1164 dbSNP
rs1324444709 1182 dbSNP
rs1186788028 1190 dbSNP
rs1418392967 1190 dbSNP
rs1257402076 1191 dbSNP
rs148422583 1192 dbSNP
rs1009162521 1200 dbSNP
rs924631461 1202 dbSNP
rs188528825 1206 dbSNP
rs550965616 1218 dbSNP
rs1347078923 1230 dbSNP
rs1341684780 1248 dbSNP
rs1431611705 1252 dbSNP
rs528047250 1253 dbSNP
rs1360154292 1255 dbSNP
rs890422495 1260 dbSNP
rs1316254748 1267 dbSNP
rs1359332816 1268 dbSNP
rs1244488642 1271 dbSNP
rs1288924257 1273 dbSNP
rs559414069 1287 dbSNP
rs184137019 1288 dbSNP
rs1241089738 1315 dbSNP
rs899233775 1316 dbSNP
rs1431265174 1318 dbSNP
rs1381751502 1321 dbSNP
rs542341524 1328 dbSNP
rs989277555 1332 dbSNP
rs953893397 1333 dbSNP
rs746058283 1336 dbSNP
rs191721301 1337 dbSNP
rs186471161 1341 dbSNP
rs1401297598 1343 dbSNP
rs544776628 1344 dbSNP
rs745452211 1348 dbSNP
rs992667988 1348 dbSNP
rs1406187673 1351 dbSNP
rs938602537 1353 dbSNP
rs1169072632 1355 dbSNP
rs1450959049 1356 dbSNP
rs1281735498 1360 dbSNP
rs1352054501 1361 dbSNP
rs926936666 1363 dbSNP
rs1283010779 1364 dbSNP
rs965059475 1367 dbSNP
rs1421262881 1371 dbSNP
rs1168118585 1384 dbSNP
rs1314738387 1385 dbSNP
rs144452041 1390 dbSNP
rs184578002 1407 dbSNP
rs1460667496 1409 dbSNP
rs1449089089 1411 dbSNP
rs968815027 1415 dbSNP
rs1234471528 1419 dbSNP
rs1470510939 1425 dbSNP
rs982490337 1426 dbSNP
rs545437591 1427 dbSNP
rs1471062819 1429 dbSNP
rs952532667 1433 dbSNP
rs1026701144 1435 dbSNP
rs1468514858 1443 dbSNP
rs762128078 1462 dbSNP
rs1274051276 1470 dbSNP
rs989002717 1472 dbSNP
rs956862014 1475 dbSNP
rs1224843125 1483 dbSNP
rs573141172 1487 dbSNP
rs751238473 1489 dbSNP
rs1009131717 1492 dbSNP
rs763717836 1504 dbSNP
rs1003566134 1512 dbSNP
rs553458055 1514 dbSNP
rs1274926667 1531 dbSNP
rs1438301323 1535 dbSNP
rs1181049004 1539 dbSNP
rs1248106953 1540 dbSNP
rs1481433453 1554 dbSNP
rs1428779328 1557 dbSNP
rs1383389374 1561 dbSNP
rs903448718 1563 dbSNP
rs1397701116 1569 dbSNP
rs1297510705 1573 dbSNP
rs1439459679 1580 dbSNP
rs1368016319 1581 dbSNP
rs1406172950 1590 dbSNP
rs1283441363 1595 dbSNP
rs1355763876 1595 dbSNP
rs573310187 1607 dbSNP
rs77279101 1608 dbSNP
rs1282617588 1616 dbSNP
rs996172986 1620 dbSNP
rs893217517 1622 dbSNP
rs1490822534 1625 dbSNP
rs899201122 1633 dbSNP
rs1037780448 1635 dbSNP
rs1050538570 1636 dbSNP
rs940777254 1638 dbSNP
rs886232616 1643 dbSNP
rs567491087 1652 dbSNP
rs1475257739 1662 dbSNP
rs1166519967 1678 dbSNP
rs762410541 1681 dbSNP
rs1056910894 1682 dbSNP
rs1425913124 1684 dbSNP
rs1303207236 1690 dbSNP
rs1165810758 1692 dbSNP
rs373118049 1698 dbSNP
rs778223857 1704 dbSNP
rs932453756 1724 dbSNP
rs879759432 1727 dbSNP
rs1226337559 1728 dbSNP
rs921126349 1737 dbSNP
rs927196559 1741 dbSNP
rs1246671706 1753 dbSNP
rs1290981918 1757 dbSNP
rs1487516697 1762 dbSNP
rs980468449 1770 dbSNP
rs1204709597 1777 dbSNP
rs976624788 1781 dbSNP
rs1187050183 1788 dbSNP
rs1175975440 1789 dbSNP
rs757072237 1789 dbSNP
rs1481697311 1795 dbSNP
rs1163462556 1796 dbSNP
rs914230574 1799 dbSNP
rs1233459524 1803 dbSNP
rs1455887078 1810 dbSNP
rs1159801778 1815 dbSNP
rs1385221182 1823 dbSNP
rs943927046 1830 dbSNP
rs1318257605 1831 dbSNP
rs1384667897 1836 dbSNP
rs1453127471 1848 dbSNP
rs1314220791 1850 dbSNP
rs1319857396 1856 dbSNP
rs1340120262 1858 dbSNP
rs1489906067 1871 dbSNP
rs138367820 1873 dbSNP
rs1350203606 1877 dbSNP
rs1207106369 1879 dbSNP
rs372365748 1883 dbSNP
rs908461075 1885 dbSNP
rs775062689 1901 dbSNP
rs1254613224 1902 dbSNP
rs558164007 1904 dbSNP
rs1026689952 1905 dbSNP
rs987623878 1917 dbSNP
rs1363916108 1918 dbSNP
rs368752410 1921 dbSNP
rs536803409 1929 dbSNP
rs1407858447 1930 dbSNP
rs193038429 1936 dbSNP
rs958853360 1939 dbSNP
rs1036239679 1943 dbSNP
rs1003061885 1945 dbSNP
rs1335918434 1946 dbSNP
rs10755966 1949 dbSNP
rs776668425 1950 dbSNP
rs1363372316 1954 dbSNP
rs996865470 1959 dbSNP
rs963374291 1962 dbSNP
rs1265170615 1969 dbSNP
rs536974241 1971 dbSNP
rs1020567666 1972 dbSNP
rs528121702 1982 dbSNP
rs1344968726 1983 dbSNP
rs893163785 1990 dbSNP
rs1254688549 1998 dbSNP
rs1004943488 2002 dbSNP
rs886536973 2004 dbSNP
rs1250456909 2005 dbSNP
rs1050485794 2009 dbSNP
rs932023396 2010 dbSNP
rs1179395227 2016 dbSNP
rs901943763 2016 dbSNP
rs1430969242 2019 dbSNP
rs117743844 2022 dbSNP
rs905741497 2027 dbSNP
rs1357255712 2031 dbSNP
rs943895349 2033 dbSNP
rs1354946038 2034 dbSNP
rs1298632449 2044 dbSNP
rs1395701393 2049 dbSNP
rs1479481419 2054 dbSNP
rs1285351524 2060 dbSNP
rs1346379025 2070 dbSNP
rs947295837 2072 dbSNP
rs908449091 2073 dbSNP
rs1309577782 2079 dbSNP
rs1200401498 2083 dbSNP
rs549104484 2083 dbSNP
rs1283525632 2087 dbSNP
rs58627497 2099 dbSNP
rs112599392 2100 dbSNP
rs912295813 2102 dbSNP
rs1490402335 2111 dbSNP
rs146257963 2112 dbSNP
rs991129236 2118 dbSNP
rs749126808 2124 dbSNP
rs1430024226 2126 dbSNP
rs954850416 2134 dbSNP
rs922100246 2135 dbSNP
rs531095502 2138 dbSNP
rs1389480713 2152 dbSNP
rs565614065 2153 dbSNP
rs545356759 2155 dbSNP
rs1366224440 2156 dbSNP
rs928411737 2159 dbSNP
rs1435871351 2168 dbSNP
rs1291942864 2169 dbSNP
rs982008724 2178 dbSNP
rs1364353930 2200 dbSNP
rs1343080808 2201 dbSNP
rs1284877381 2207 dbSNP
rs967610256 2208 dbSNP
rs963982883 2226 dbSNP
rs1361709288 2228 dbSNP
rs1248851964 2231 dbSNP
rs1287432177 2243 dbSNP
rs1020936694 2249 dbSNP
rs1011862804 2250 dbSNP
rs538001199 2260 dbSNP
rs1293181436 2261 dbSNP
rs1028972252 2262 dbSNP
rs1016235519 2263 dbSNP
rs1220205855 2265 dbSNP
rs1005276222 2266 dbSNP
rs189202872 2274 dbSNP
rs1247243686 2282 dbSNP
rs996180299 2287 dbSNP
rs567996902 2288 dbSNP
rs950760441 2291 dbSNP
rs1176311258 2296 dbSNP
rs1385795815 2297 dbSNP
rs1468354422 2304 dbSNP
rs1162847072 2327 dbSNP
rs553080910 2329 dbSNP
rs143719878 2330 dbSNP
rs183344980 2331 dbSNP
rs867045915 2332 dbSNP
rs886971519 2340 dbSNP
rs1316276461 2341 dbSNP
rs1011464449 2352 dbSNP
rs1248627925 2356 dbSNP
rs1047410398 2363 dbSNP
rs1202953965 2369 dbSNP
rs1216118823 2376 dbSNP
rs190789385 2381 dbSNP
rs187537468 2386 dbSNP
rs1185201495 2394 dbSNP
rs1243669708 2395 dbSNP
rs1055348942 2399 dbSNP
rs1180166633 2400 dbSNP
rs937042223 2404 dbSNP
rs377205204 2407 dbSNP
rs912265199 2408 dbSNP
rs77675470 2413 dbSNP
rs1306514761 2423 dbSNP
rs767106787 2431 dbSNP
rs932390121 2431 dbSNP
rs1337881224 2432 dbSNP
rs1384326782 2438 dbSNP
rs868120490 2439 dbSNP
rs1336734298 2445 dbSNP
rs1451016138 2446 dbSNP
rs1374830379 2449 dbSNP
rs1408406825 2450 dbSNP
rs975328713 2454 dbSNP
rs1287243908 2463 dbSNP
rs1177181620 2472 dbSNP
rs942239523 2489 dbSNP
rs1205312407 2496 dbSNP
rs913369205 2504 dbSNP
rs983704343 2506 dbSNP
rs1207884528 2508 dbSNP
rs950687960 2510 dbSNP
rs557657332 2512 dbSNP
rs1470521365 2515 dbSNP
rs990333299 2524 dbSNP
rs957568044 2536 dbSNP
rs981468813 2539 dbSNP
rs1029258741 2540 dbSNP
rs775537359 2548 dbSNP
rs1177577627 2549 dbSNP
rs534605360 2552 dbSNP
rs1413155154 2559 dbSNP
rs1430155301 2560 dbSNP
rs1355625568 2561 dbSNP
rs1409897306 2562 dbSNP
rs996174017 2567 dbSNP
rs1287221975 2571 dbSNP
rs1348214822 2581 dbSNP
rs1225006761 2609 dbSNP
rs1011808207 2612 dbSNP
rs1343969822 2631 dbSNP
rs1390485601 2640 dbSNP
rs780192534 2641 dbSNP
rs1483380635 2655 dbSNP
rs1031997814 2661 dbSNP
rs1249778094 2671 dbSNP
rs1019430909 2690 dbSNP
rs1004997470 2694 dbSNP
rs1377310871 2700 dbSNP
rs1244474891 2703 dbSNP
rs886538022 2715 dbSNP
rs554491947 2716 dbSNP
rs1306840208 2734 dbSNP
rs995302907 2740 dbSNP
rs890755463 2746 dbSNP
rs898409582 2751 dbSNP
rs1330152992 2753 dbSNP
rs756084084 2755 dbSNP
rs1055678407 2764 dbSNP
rs936988528 2765 dbSNP
rs1271774799 2767 dbSNP
rs1038164299 2777 dbSNP
rs1210510955 2777 dbSNP
rs1361623421 2777 dbSNP
rs942186144 2777 dbSNP
rs1229154269 2779 dbSNP
rs746408546 2780 dbSNP
rs781631102 2781 dbSNP
rs983630802 2783 dbSNP
rs928348361 2819 dbSNP
rs548704668 2829 dbSNP
rs929579640 2834 dbSNP
rs1385570982 2838 dbSNP
rs1335415478 2839 dbSNP
rs549303903 2847 dbSNP
rs928610842 2869 dbSNP
rs970107719 2870 dbSNP
rs981396570 2870 dbSNP
rs1384769985 2876 dbSNP
rs1320010738 2880 dbSNP
rs754729276 2881 dbSNP
rs182495563 2882 dbSNP
rs912973153 2887 dbSNP
rs757671916 2889 dbSNP
rs936189755 2890 dbSNP
rs957398920 2913 dbSNP
rs1354468275 2916 dbSNP
rs922178258 2917 dbSNP
rs1390583120 2918 dbSNP
rs138123173 2921 dbSNP
rs998746142 2923 dbSNP
rs891058614 2926 dbSNP
rs1029612171 2937 dbSNP
rs1387062359 2946 dbSNP
rs1187614964 2948 dbSNP
rs549889957 2951 dbSNP
rs1455964124 2956 dbSNP
rs531159297 2959 dbSNP
rs1388942106 2960 dbSNP
rs1038495838 2968 dbSNP
rs941124297 2978 dbSNP
rs758057704 2979 dbSNP
rs950792079 2984 dbSNP
rs1027703459 2985 dbSNP
rs1483153441 2991 dbSNP
rs1338724865 2994 dbSNP
rs1241291168 3004 dbSNP
rs1047897508 3009 dbSNP
rs1289147592 3014 dbSNP
rs1328825585 3019 dbSNP
rs1207203108 3020 dbSNP
rs1265443826 3032 dbSNP
rs1291551489 3038 dbSNP
rs752235772 3048 dbSNP
rs995297693 3056 dbSNP
rs1220775414 3061 dbSNP
rs190319978 3063 dbSNP
rs1046002832 3066 dbSNP
rs928874059 3066 dbSNP
rs1285370532 3067 dbSNP
rs1473919278 3068 dbSNP
rs948719847 3070 dbSNP
rs1334067940 3073 dbSNP
rs915921088 3076 dbSNP
rs1379110575 3082 dbSNP
rs1412526253 3089 dbSNP
rs1466379179 3093 dbSNP
rs1302132182 3096 dbSNP
rs1034216151 3100 dbSNP
rs1309168728 3118 dbSNP
rs990600330 3120 dbSNP
rs1393208659 3156 dbSNP
rs1410701278 3157 dbSNP
rs1350080294 3176 dbSNP
rs1365230355 3187 dbSNP
rs957495201 3188 dbSNP
rs1001427749 3192 dbSNP
rs1187598065 3198 dbSNP
rs1285466377 3200 dbSNP
rs1301497761 3202 dbSNP
rs1233006059 3230 dbSNP
rs146970934 3238 dbSNP
rs1422575253 3243 dbSNP
rs1476679341 3251 dbSNP
rs924408445 3252 dbSNP
rs1481948465 3260 dbSNP
rs528788322 3271 dbSNP
rs868268294 3281 dbSNP
rs1251953536 3283 dbSNP
rs777572211 3283 dbSNP
rs140509489 3284 dbSNP
rs955213955 3284 dbSNP
rs1045362051 3285 dbSNP
rs1175167298 3291 dbSNP
rs945708751 3299 dbSNP
rs1431594007 3304 dbSNP
rs996785124 3309 dbSNP
rs1369970865 3313 dbSNP
rs1408110877 3316 dbSNP
rs891546257 3322 dbSNP
rs964013659 3324 dbSNP
rs75309399 3332 dbSNP
rs1386546177 3333 dbSNP
rs1267798819 3339 dbSNP
rs1299699088 3342 dbSNP
rs936137566 3400 dbSNP
rs1490943565 3403 dbSNP
rs922125754 3406 dbSNP
rs776757847 3407 dbSNP
rs886850171 3409 dbSNP
rs1340761842 3410 dbSNP
rs1205079274 3412 dbSNP
rs1349111821 3419 dbSNP
rs534770796 3422 dbSNP
rs1046822479 3430 dbSNP
rs974921743 3437 dbSNP
rs1190380688 3438 dbSNP
rs879182787 3438 dbSNP
rs944954428 3438 dbSNP
rs1451121524 3439 dbSNP
rs1189088234 3441 dbSNP
rs766387326 3447 dbSNP
rs760609760 3448 dbSNP
rs983438398 3453 dbSNP
rs1406926265 3477 dbSNP
rs573665183 3483 dbSNP
rs745440722 3484 dbSNP
rs949000393 3487 dbSNP
rs563474861 3491 dbSNP
rs1400079656 3495 dbSNP
rs1382754685 3502 dbSNP
rs543489141 3503 dbSNP
rs915874187 3510 dbSNP
rs1054472381 3520 dbSNP
rs1291453259 3536 dbSNP
rs185816911 3545 dbSNP
rs1321923613 3551 dbSNP
rs1457366819 3555 dbSNP
rs577457430 3557 dbSNP
rs1263341737 3560 dbSNP
rs924670063 3564 dbSNP
rs545152433 3578 dbSNP
rs1027677109 3582 dbSNP
rs534768296 3587 dbSNP
rs973486995 3592 dbSNP
rs572273027 3596 dbSNP
rs555603809 3600 dbSNP
rs1414570482 3602 dbSNP
rs1423355403 3603 dbSNP
rs1034121212 3611 dbSNP
rs533276200 3639 dbSNP
rs1391128878 3643 dbSNP
rs1264550384 3647 dbSNP
rs58984500 3654 dbSNP
rs1320383149 3660 dbSNP
rs569648166 3665 dbSNP
rs1024674633 3674 dbSNP
rs775537974 3675 dbSNP
rs1017294255 3684 dbSNP
rs866626240 3690 dbSNP
rs114153483 3691 dbSNP
rs1227245881 3698 dbSNP
rs1310061995 3704 dbSNP
rs1330841832 3706 dbSNP
rs1209113280 3707 dbSNP
rs1429833285 3716 dbSNP
rs1324457969 3722 dbSNP
rs1322549842 3727 dbSNP
rs1435649167 3753 dbSNP
rs1463398162 3754 dbSNP
rs1212106770 3761 dbSNP
rs373901063 3764 dbSNP
rs1215555063 3768 dbSNP
rs935709193 3791 dbSNP
rs900272073 3798 dbSNP
rs1039165372 3799 dbSNP
rs1473064638 3812 dbSNP
rs944877314 3815 dbSNP
rs539529030 3826 dbSNP
rs907340523 3846 dbSNP
rs1425489491 3851 dbSNP
rs1410152837 3855 dbSNP
rs912139931 3861 dbSNP
rs1335362117 3868 dbSNP
rs1013556820 3881 dbSNP
rs1048472741 3882 dbSNP
rs1055137116 3889 dbSNP
rs936012138 3904 dbSNP
rs35675165 3913 dbSNP
rs1287362744 3915 dbSNP
rs151265170 3917 dbSNP
rs1220754625 3926 dbSNP
rs1461221913 3931 dbSNP
rs1041786119 3939 dbSNP
rs1441838816 3942 dbSNP
rs551682833 3953 dbSNP
rs1208074871 3979 dbSNP
rs1254133509 3989 dbSNP
rs1483436069 3992 dbSNP
rs181027435 3993 dbSNP
rs559810294 3994 dbSNP
rs116587489 3997 dbSNP
rs973393766 3999 dbSNP
rs1479176064 4005 dbSNP
rs1272641349 4013 dbSNP
rs922403715 4016 dbSNP
rs1425073130 4031 dbSNP
rs975261232 4035 dbSNP
rs1413304154 4044 dbSNP
rs1171170287 4051 dbSNP
rs1371829936 4053 dbSNP
rs776800073 4058 dbSNP
rs942552371 4059 dbSNP
rs1333683312 4060 dbSNP
rs1438345209 4067 dbSNP
rs1213025214 4076 dbSNP
rs909799515 4084 dbSNP
rs1299480961 4090 dbSNP
rs1276729224 4097 dbSNP
rs984480147 4114 dbSNP
rs951015956 4120 dbSNP
rs1271127967 4123 dbSNP
rs1025266772 4139 dbSNP
rs1199984068 4140 dbSNP
rs959408858 4142 dbSNP
rs1190992807 4152 dbSNP
rs1429815505 4152 dbSNP
rs970463889 4152 dbSNP
rs1167489552 4175 dbSNP
rs926715776 4175 dbSNP
rs979950443 4179 dbSNP
rs1023831079 4183 dbSNP
rs79528689 4184 dbSNP
rs201552946 4185 dbSNP
rs1438446805 4186 dbSNP
rs1033255936 4191 dbSNP
rs1000453757 4192 dbSNP
rs1024209557 4201 dbSNP
rs563338188 4211 dbSNP
rs903162618 4215 dbSNP
rs1249728911 4226 dbSNP
rs1041755087 4227 dbSNP
rs1210605311 4228 dbSNP
rs191888510 4240 dbSNP
rs1169580275 4241 dbSNP
rs1211036947 4245 dbSNP
rs1249188819 4248 dbSNP
rs1010599541 4253 dbSNP
rs955955021 4267 dbSNP
rs1032655679 4270 dbSNP
rs1187364523 4271 dbSNP
rs934010943 4272 dbSNP
rs1444363378 4277 dbSNP
rs1473511258 4282 dbSNP
rs901240391 4285 dbSNP
rs1389579979 4286 dbSNP
rs1184101046 4295 dbSNP
rs1473206579 4296 dbSNP
rs1232310766 4297 dbSNP
rs1202718044 4300 dbSNP
rs1484134727 4302 dbSNP
rs543372841 4303 dbSNP
rs1205668099 4307 dbSNP
rs1358447675 4308 dbSNP
rs1312917475 4315 dbSNP
rs1229894298 4316 dbSNP
rs1269218836 4316 dbSNP
rs1464747496 4318 dbSNP
rs371408756 4319 dbSNP
rs1278397814 4320 dbSNP
rs1443583363 4326 dbSNP
rs1416708891 4329 dbSNP
rs1439613048 4329 dbSNP
rs1351994290 4336 dbSNP
rs942542119 4337 dbSNP
rs1412368837 4343 dbSNP
rs999866115 4344 dbSNP
rs1308243872 4345 dbSNP
rs1424498101 4346 dbSNP
rs1364098805 4351 dbSNP
rs909715636 4354 dbSNP
rs1396676397 4360 dbSNP
rs577721023 4361 dbSNP
rs929913322 4368 dbSNP
rs1230412680 4370 dbSNP
rs1289253980 4373 dbSNP
rs918224084 4380 dbSNP
rs1237352060 4381 dbSNP
rs1258269663 4386 dbSNP
rs1346410191 4387 dbSNP
rs566175673 4394 dbSNP
rs1039230395 4397 dbSNP
rs1407388175 4403 dbSNP
rs1175593438 4405 dbSNP
rs1473599195 4408 dbSNP
rs1252109267 4409 dbSNP
rs1009048470 4411 dbSNP
rs564576738 4417 dbSNP
rs1379270075 4419 dbSNP
rs1466533911 4421 dbSNP
rs1252883288 4425 dbSNP
rs1373668773 4429 dbSNP
rs1198961145 4441 dbSNP
rs981729404 4442 dbSNP
rs970388498 4443 dbSNP
rs550949520 4448 dbSNP
rs1303913174 4449 dbSNP
rs991009437 4459 dbSNP
rs1223707782 4460 dbSNP
rs1322214251 4461 dbSNP
rs958864113 4464 dbSNP
rs1047903357 4465 dbSNP
rs929535622 4466 dbSNP
rs1480131769 4467 dbSNP
rs1000422713 4468 dbSNP
rs1269141219 4483 dbSNP
rs1433589145 4487 dbSNP
rs747432287 4494 dbSNP
rs920846405 4495 dbSNP
rs533463226 4496 dbSNP
rs938045246 4497 dbSNP
rs1169379719 4498 dbSNP
rs1020571764 4504 dbSNP
rs1460699952 4506 dbSNP
rs1295522308 4507 dbSNP
rs1344042762 4509 dbSNP
rs1391853988 4509 dbSNP
rs926723332 4519 dbSNP
rs982630262 4520 dbSNP
rs971243336 4526 dbSNP
rs998184868 4530 dbSNP
rs1229940094 4551 dbSNP
rs555405023 4562 dbSNP
rs1039757822 4564 dbSNP
rs1201958004 4565 dbSNP
rs988682523 4569 dbSNP
rs1488652765 4570 dbSNP
rs955903330 4572 dbSNP
rs1251056927 4581 dbSNP
rs1437589996 4598 dbSNP
rs1345165141 4601 dbSNP
rs1032936935 4603 dbSNP
rs1451299403 4603 dbSNP
rs1215019383 4612 dbSNP
rs1418827933 4613 dbSNP
rs1426842999 4615 dbSNP
rs372215721 4634 dbSNP
rs1350697233 4638 dbSNP
rs1048226922 4640 dbSNP
rs964414930 4643 dbSNP
rs775585930 4656 dbSNP
rs752414500 4675 dbSNP
rs1324348894 4677 dbSNP
rs576150219 4690 dbSNP
rs1017340588 4694 dbSNP
rs1046337594 4697 dbSNP
rs1288830087 4710 dbSNP
rs1009032979 4717 dbSNP
rs916238738 4722 dbSNP
rs990562106 4728 dbSNP
rs1322016849 4732 dbSNP
rs890229177 4737 dbSNP
rs556202496 4742 dbSNP
rs1048322498 4743 dbSNP
rs367653140 4746 dbSNP
rs143278490 4747 dbSNP
rs570581454 4748 dbSNP
rs1484899537 4752 dbSNP
rs1183742204 4765 dbSNP
rs1020543594 4778 dbSNP
rs1241509064 4779 dbSNP
rs547434678 4788 dbSNP
rs998448339 4789 dbSNP
rs1206742174 4800 dbSNP
rs1414596671 4801 dbSNP
rs1458099547 4802 dbSNP
rs1330611190 4803 dbSNP
rs1344008339 4804 dbSNP
rs1268147639 4807 dbSNP
rs1037954992 4808 dbSNP
rs937997592 4810 dbSNP
rs1268146178 4813 dbSNP
rs905222894 4817 dbSNP
rs1428032479 4818 dbSNP
rs1222554895 4842 dbSNP
rs1355672850 4844 dbSNP
rs1310112763 4850 dbSNP
rs1291088070 4857 dbSNP
rs1302920298 4863 dbSNP
rs1228791174 4865 dbSNP
rs1220231967 4871 dbSNP
rs1315101401 4879 dbSNP
rs534940672 4881 dbSNP
rs1212311210 4883 dbSNP
rs1046409675 4890 dbSNP
rs1238079826 4904 dbSNP
rs1485405884 4920 dbSNP
rs1361692036 4930 dbSNP
rs949477961 4936 dbSNP
rs868610100 4937 dbSNP
rs1473116986 4938 dbSNP
rs913992527 4941 dbSNP
rs1406380733 4942 dbSNP
rs988609812 4945 dbSNP
rs965369971 4951 dbSNP
rs1389496228 4959 dbSNP
rs1433560959 4959 dbSNP
rs566239811 4974 dbSNP
rs149150844 4985 dbSNP
rs565650037 4991 dbSNP
rs1278790812 4994 dbSNP
rs925858950 4996 dbSNP
rs1006945427 5010 dbSNP
rs1280960935 5012 dbSNP
rs145189302 5014 dbSNP
rs1208897089 5016 dbSNP
rs187661319 5017 dbSNP
rs1186613799 5027 dbSNP
rs993959440 5036 dbSNP
rs1017664183 5039 dbSNP
rs987157088 5048 dbSNP
rs1181505656 5050 dbSNP
rs954576049 5055 dbSNP
rs897027102 5063 dbSNP
rs1192211452 5073 dbSNP
rs1395019356 5074 dbSNP
rs1248531857 5082 dbSNP
rs1026095316 5088 dbSNP
rs181698903 5089 dbSNP
rs993622132 5100 dbSNP
rs1257459185 5101 dbSNP
rs564459816 5105 dbSNP
rs7006389 5108 dbSNP
rs1016459492 5124 dbSNP
rs1002383712 5131 dbSNP
rs527542320 5140 dbSNP
rs1046791821 5142 dbSNP
rs561912967 5155 dbSNP
rs1304051486 5159 dbSNP
rs1370242021 5164 dbSNP
rs949422209 5165 dbSNP
rs1299974698 5166 dbSNP
rs936373438 5169 dbSNP
rs139734784 5176 dbSNP
rs1366612397 5180 dbSNP
rs1271148831 5188 dbSNP
rs1314938879 5193 dbSNP
rs1214768803 5201 dbSNP
rs1252914872 5205 dbSNP
rs576405518 5216 dbSNP
rs753389870 5218 dbSNP
rs1404441991 5219 dbSNP
rs556466966 5221 dbSNP
rs1166899118 5227 dbSNP
rs925746699 5241 dbSNP
rs545827583 5242 dbSNP
rs1406875944 5248 dbSNP
rs1303654077 5252 dbSNP
rs1393610830 5259 dbSNP
rs2291163 5262 dbSNP
rs1327031000 5266 dbSNP
rs544500697 5272 dbSNP
rs1226798199 5276 dbSNP
rs1353734098 5277 dbSNP
rs1358816795 5279 dbSNP
rs1234246782 5280 dbSNP
rs772954290 5283 dbSNP
rs913406963 5301 dbSNP
rs73260950 5302 dbSNP
rs987533234 5311 dbSNP
rs767378974 5325 dbSNP
rs1025999523 5331 dbSNP
rs1191933465 5332 dbSNP
rs529454187 5339 dbSNP
rs552289519 5343 dbSNP
rs1018555302 5347 dbSNP
rs985844605 5352 dbSNP
rs566182205 5363 dbSNP
rs1416845293 5364 dbSNP
rs1182903480 5365 dbSNP
rs1459683270 5367 dbSNP
rs1161206875 5369 dbSNP
rs971818757 5370 dbSNP
rs963112529 5384 dbSNP
rs1381714292 5385 dbSNP
rs952782066 5388 dbSNP
rs1016366118 5389 dbSNP
rs1316360729 5392 dbSNP
rs12678475 5393 dbSNP
rs905409621 5394 dbSNP
rs1292914420 5405 dbSNP
rs1333079743 5414 dbSNP
rs1230687212 5418 dbSNP
rs1480083448 5423 dbSNP
rs1350640416 5426 dbSNP
rs1272006042 5427 dbSNP
rs866445401 5442 dbSNP
rs1258995112 5450 dbSNP
rs1486383782 5451 dbSNP
rs1188138671 5455 dbSNP
rs1256384569 5457 dbSNP
rs1474093315 5461 dbSNP
rs535626177 5466 dbSNP
rs1207802399 5470 dbSNP
rs896953331 5473 dbSNP
rs1024777895 5483 dbSNP
rs1025259270 5509 dbSNP
rs1014003306 5515 dbSNP
rs1156776391 5517 dbSNP
rs1404366391 5520 dbSNP
rs761470055 5529 dbSNP
rs895038003 5534 dbSNP
rs1052446729 5539 dbSNP
rs1055089582 5542 dbSNP
rs1308222160 5548 dbSNP
rs1000926184 5552 dbSNP
rs775834014 5557 dbSNP
rs1258290293 5561 dbSNP
rs903531268 5563 dbSNP
rs570030489 5572 dbSNP
rs1391390317 5575 dbSNP
rs550047307 5588 dbSNP
rs1484506984 5590 dbSNP
rs1348912935 5591 dbSNP
rs370646667 5606 dbSNP
rs1250925060 5607 dbSNP
rs1418291705 5617 dbSNP
rs1179503834 5619 dbSNP
rs1431466764 5623 dbSNP
rs1454760970 5627 dbSNP
rs540578934 5633 dbSNP
rs1173138787 5635 dbSNP
rs573124419 5641 dbSNP
rs1373847981 5644 dbSNP
rs1042876616 5656 dbSNP
rs1370864005 5657 dbSNP
rs1431811221 5662 dbSNP
rs943248681 5669 dbSNP
rs1298990890 5673 dbSNP
rs913372992 5673 dbSNP
rs977310354 5681 dbSNP
rs1162864731 5686 dbSNP
rs1159814257 5698 dbSNP
rs910455566 5701 dbSNP
rs944241879 5713 dbSNP
rs533186013 5728 dbSNP
rs1234338949 5730 dbSNP
rs911458282 5738 dbSNP
rs985765148 5749 dbSNP
rs952787957 5757 dbSNP
rs932966513 5758 dbSNP
rs918896946 5774 dbSNP
rs1480180077 5775 dbSNP
rs1193927656 5785 dbSNP
rs771001777 5797 dbSNP
rs570824132 5800 dbSNP
rs1192959661 5806 dbSNP
rs972767024 5825 dbSNP
rs1430384687 5826 dbSNP
rs1171323395 5839 dbSNP
rs1249242125 5844 dbSNP
rs1328392659 5852 dbSNP
rs77184226 5855 dbSNP
rs1440749172 5857 dbSNP
rs1025038431 5859 dbSNP
rs1368078545 5868 dbSNP
rs1215875374 5869 dbSNP
rs1295843112 5876 dbSNP
rs1306605826 5877 dbSNP
rs776683192 5882 dbSNP
rs1268557539 5883 dbSNP
rs1335274678 5898 dbSNP
rs1208608053 5901 dbSNP
rs1251073724 5902 dbSNP
rs981341071 5931 dbSNP
rs113148815 5937 dbSNP
rs969623322 5938 dbSNP
rs1187249131 5956 dbSNP
rs1261260813 5957 dbSNP
rs527796756 5961 dbSNP
rs1359035021 5962 dbSNP
rs34280288 5964 dbSNP
rs1033982083 5965 dbSNP
rs1163386888 5976 dbSNP
rs1347536910 5976 dbSNP
rs1461263257 5976 dbSNP
rs1432250476 5979 dbSNP
rs1288998113 5980 dbSNP
rs1360693664 5980 dbSNP
rs1266520227 5981 dbSNP
rs1000794715 5983 dbSNP
rs1238489697 5986 dbSNP
rs201026907 5987 dbSNP
rs1013867657 5990 dbSNP
rs1042087751 6000 dbSNP
rs539582457 6001 dbSNP
rs1410603449 6006 dbSNP
rs901572360 6007 dbSNP
rs1216561349 6013 dbSNP
rs1260167296 6019 dbSNP
rs1484951031 6026 dbSNP
rs1190259930 6028 dbSNP
rs1258557080 6029 dbSNP
rs1475083361 6032 dbSNP
rs1186303216 6033 dbSNP
rs1410779535 6041 dbSNP
rs568879849 6047 dbSNP
rs1350906668 6052 dbSNP
rs1040161039 6058 dbSNP
rs188784491 6063 dbSNP
rs1417332165 6071 dbSNP
rs1314314733 6075 dbSNP
rs1384832777 6077 dbSNP
rs944195149 6077 dbSNP
rs1000875929 6079 dbSNP
rs540759306 6080 dbSNP
rs78052717 6087 dbSNP
rs986075776 6090 dbSNP
rs747522410 6098 dbSNP
rs542064660 6105 dbSNP
rs1213196987 6108 dbSNP
rs1281270176 6109 dbSNP
rs752463858 6109 dbSNP
rs1163758454 6120 dbSNP
rs1485496010 6124 dbSNP
rs143766673 6129 dbSNP
rs1234923539 6136 dbSNP
rs562805000 6137 dbSNP
rs1470721909 6142 dbSNP
rs920207608 6144 dbSNP
rs546096919 6146 dbSNP
rs778090998 6150 dbSNP
rs933230456 6154 dbSNP
rs1375649809 6155 dbSNP
rs1433661540 6155 dbSNP
rs184347738 6166 dbSNP
rs1035955195 6177 dbSNP
rs866317466 6189 dbSNP
rs1197252875 6191 dbSNP
rs1442733229 6194 dbSNP
rs992265720 6210 dbSNP
rs1374625533 6212 dbSNP
rs908963977 6231 dbSNP
rs1304199390 6237 dbSNP
rs980571130 6238 dbSNP
rs969948426 6245 dbSNP
rs1268741418 6255 dbSNP
rs1204989363 6256 dbSNP
rs553719071 6268 dbSNP
rs748426559 6269 dbSNP
rs1229275111 6273 dbSNP
rs539798442 6274 dbSNP
rs181094813 6280 dbSNP
rs1273277925 6285 dbSNP
rs1470254945 6289 dbSNP
rs1194826453 6290 dbSNP