miRTarBase - #MIRT555035 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB23   
Synonyms HSPC137
Description RAB23, member RAS oncogene family
Transcript NM_016277   
Other Transcripts NM_183227   
Expression
Putative miRNA Targets on RAB23
3'UTR of RAB23
(miRNA target sites are highlighted)
>RAB23|NM_016277|3'UTR
   1 GATGTTTTGGGAGGAAAACAATTGAATTACATTGTGCAATGCATTAAGAAACCCATCCAGCTGTCATGGTATGTTACAAG
  81 GTTTTCAGCAGACTTTGCTCCTAATGGCTCTCTGAAAGTGACAGACTTAAATATTGCTCTGCAGTGCTTTTCAGAATGTA
 161 GAGTGAGACCTCTGGTGGAAAAATTATTGCCCTGTGGACTCCTTTAATTTTTTTTACATTAGACGAAGCTTCTCCTGTTT
 241 GTAAAGGAATGCTATAAGAAATTTCAAACACAGGTTTTGCGGAATTTTAAATGCTGGAAAACATAAATGAAATGCCTAAA
 321 TATATTGTTACAGATTTTAATACTGTGGATCAAGGAAAGATAGCAAGCATTCTTTTCCTGAAATTGGTCATGTAGCTTTT
 401 CTGCGAAATAGTATTGAATCTGAATACTTTCACAAAATAATACTGAAAGGTAAACCCTAAATCTTGCCAGACTGCATTAG
 481 TATTTTGGCATTGAAACTTGTGCAATATCTGTGTAATGTAGAATGTGGGGTGTGCATGCAGATGTCTGGTACTGGAGTAA
 561 GCTGAAGGTATGTGCAGTATTTAAGAAAATGTACATTCTAATTAATTCACTTATAAAACCATTTACATATTGTGTATATG
 641 TTTTTATTTTCAAATGATAAACTCTAGACATATATTTTGCAAAATGAGCTTGGGTTTAAAAAGTGCTTTGTGCCAAAAAT
 721 ATCATACCTAATTTTTATAGTGCTTTACTATCAGAATTTATATTGTTTATTATATCTTTTAAAAGCAGTAAGCAGTTTTC
 801 ATCTGACAGCGTAGATAAAAGAGGAGTATAGGAATTTGAATGCTAGAGCATCTCCCAGGTGAGCCTTATTGCAGATCTTT
 881 TTGATATAGTCACCCATAAGCATGGTGAGCTCCTGCTCTCATAAGGTCAGCCAAAGCCCCTTAAGAAGGTACACAGCACA
 961 TCTGCAGTCATTCAGGAGGTCCTGTGAAGTGTGGTGATGCATCTAACACCTTTTGCTGCTCACTGAGAACCCAGCTTTGA
1041 ACTTACAAGATTACACTAACCATTTTTAAAGTGCACAAAAATATTATTATTAGTCTTAACTAAAATTACATATTTTATAA
1121 TGCCCTGCAACTCTAAACCATCCTTTTGTTTACACATTTTTGTATGGTATTTTAAGATTATCAATCACTTCAACATTTCT
1201 ATAACCTTGTTTGTATAGCACTTTCTCAAGAGCTGTCAGTCCCACATACAGAATCATTTCTTTTACAAAATGATTTAATA
1281 TGTAATCATGTGTCAGGACATAAATTTTGTCACTTGGGACAGTAGCTTTCCAGCTAAGATAATTGCGTGAACTCTGTTAA
1361 AACTGATTATCACTCATCAATGGCTTTATTTTTAACCTATAAATAACCCCTTTCAATATACCTGGTTTTTACAGCATTGC
1441 AAAATCTGTAAAAATAACTTTTATTGGAAAATGTCATGAAGTCATTTTTCATTATTTGTACTAAACAATGTTTTATGTAC
1521 TCCTTTTGTGTTTTATCTTTTGTTTTTCCATCTGTACTCCCCTCATCCTCCTAATGTTGAGAAAATCAAATTTCCTGGGT
1601 GTGTCCTTGTTAAGTGATCAAAAGTAAATGTTCTCTTTGCCATTTTAGATGGAAAAATAAAAAAAATTAAAAAGTAAATT
1681 TTTGCTTTTCATTATATTGAAATGATCTGGCATTATCTATTTCACAGTAATGTAAAATGCTTATTTTTATGTCACCAGTT
1761 GTCACCACTCCCATTGCTGATAGTGACATAGGTTTTGGGGGCAAAATTCAGTTCCTAACAAACAGTGGATACTGCTAATG
1841 AGTCATCTTTTCTACTCTCTTCAATTTTCTACTCTCTACTCTCCTCTTTAATTTTTGCACAAAATAATACTTTGCAACAA
1921 ATAGTCTTTTGTCTTTATTGGCAGAAAAATCACTTGTTATATGTGTTCTAGTTAGTTCTTTTTCATGTTAGCTGTGTGGC
2001 TAAAAGCGTGTTACCTTTCTATATTTAAAAAAAGTAATCTCTGAGGATAGTTACAGTTCCTGTAATATAATTTTATGTAC
2081 CTAGTTTTATCTTTTTTTAAATAAGAACTGAAGAGAGAGCTTTGTTACATATTTGAATTTTTAATTTGCACTGCTGTATT
2161 TTAAACCTAACCATAATTAGTCATTTAAAATAATTAAGTAGGCCTGAAAGTCAGCCATGTTAATTTCTCAATTTAATCAA
2241 TTCTTAAAGCCTTCAAAAATTGACATTTTTTTTCCAAGACCCTTCATTCTCTTAAATAACTTTAATTTTATGAAACCATG
2321 TATACTAAAGAAAAACTTTTCCAAGATTCCAGGTGATTGTGCATTTGTGCTCTAATCTACTTTTTTAACATTACGGCTAA
2401 TCTTTTGCGTAGACATATCGCTGTGGAATAACTGCCATATTTCAGAGTTCCTCAGGTTTCCTTTTCCTTTTCCAGTCTCT
2481 GTCTATGAATTAAATAGTATATAGAATGACCCATATAAGGCAATATAGTTAAATAAAACCAGGTTAAATGATTTCCTTTG
2561 TATCTGCCCAAAGTTGATAGCACACGTTACTTTTTCAAAATAAAGCTAAAACTACCAAAAAGAGGATGAAAACTTTTTCC
2641 TCATTATGGAGTGAAGTTCTAGGTGGTTGCTTTAGAAGTTGGCAGTGCAGTGCTCAGAAGGAACTCTCAATAAATAACAT
2721 GTACTCCTTGGACCTGTGAGTTTTAGGAAACTGGACCTTTTCTGAAGACCTTAGAATAGGGAGTTGGCCTTAGGACCTAA
2801 TGTCCCAACTTAGTGTTGGACCCTTTTAATATAAGATATTGTTAATTATTAGCATACTTTTCAAAACCTTTGAAATAGTT
2881 ACTGCTAACCTGATAAAATGTTCCCATTAATCTATCATTAGTCTGTTTCTCTGAAAACAAAATGCATTGATGAGGTGAAA
2961 GCTTGTTCCACATGGCACCTACCTAATGAACAGGACTTACTCAGTTTTTAACTGTTAAGAATGTCACATGTACTATTGTC
3041 ACTCCTTAGGTTTTCAGCTATAAAACATGTAAGTCTCTCATCATACAGATGAATTCATTTGCTAACAAAATATTTAAAAC
3121 CCGCAGTAGACTCTGAAATATCCAGTCATCAAACTCCTGGCTAACTGGATGATTTGGCTATAATAATCTTTATTATTATT
3201 ATTTTCATCTGTCTCTCGAAATATCTACAGTAGGATGTTAGTAAATGGTCTTTTAAAAGCAAAAAATTGGGGATAAAAGG
3281 AAAACTGAATTCCTTCTATATTTTTATTACTAATAAATAATGCTTTTGTAAATTTGAATGGAAAACCACTTGTATGTATT
3361 GCTATTTGGTTGCAGTTACACTCTGGAGCTTAATTTAAAACACTACTCTAAAAATTTCATGAAGGATGAATTCCAATAAT
3441 CAGAAAATAAATGCATTTCAAAGCTAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            :|| ||| ||   ||||||| 
Target 5' tcTAACACCTTT---TGCTGCTc 3'
1002 - 1021 153.00 -9.60
2
miRNA  3' gugUUUGGU--A-AUACACGACGAu 5'
             ||||||  | ||||| :|||| 
Target 5' ggaAAACCACTTGTATGTATTGCTa 3'
3340 - 3364 129.00 -16.20
3
miRNA  3' guGU-UUGGUAAUAC---ACGACGAu 5'
            || || ||| :||   | ||||| 
Target 5' ccCATAAGCATGGTGAGCTCCTGCTc 3'
893 - 918 128.00 -12.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
910396 81 ClinVar
910395 117 ClinVar
357638 145 ClinVar
357637 416 ClinVar
357636 544 ClinVar
357635 608 ClinVar
357634 618 ClinVar
909448 677 ClinVar
357633 722 ClinVar
357632 735 ClinVar
909447 795 ClinVar
357631 811 ClinVar
908592 850 ClinVar
357630 920 ClinVar
357629 984 ClinVar
908591 1052 ClinVar
908590 1131 ClinVar
357628 1188 ClinVar
357627 1251 ClinVar
357626 1312 ClinVar
911548 1494 ClinVar
911547 1534 ClinVar
911546 1536 ClinVar
357625 1668 ClinVar
911545 1706 ClinVar
910337 1740 ClinVar
910336 1817 ClinVar
910335 2008 ClinVar
910334 2067 ClinVar
910333 2245 ClinVar
910332 2273 ClinVar
910331 2319 ClinVar
910330 2341 ClinVar
909372 2425 ClinVar
909371 2485 ClinVar
909370 2586 ClinVar
909369 2681 ClinVar
909368 2753 ClinVar
909367 2769 ClinVar
909366 2876 ClinVar
909365 3033 ClinVar
908522 3129 ClinVar
908521 3189 ClinVar
908520 3298 ClinVar
908519 3330 ClinVar
COSN26991274 5 COSMIC
COSN30170385 7 COSMIC
COSN30114461 24 COSMIC
COSN30155037 24 COSMIC
COSN26902448 36 COSMIC
COSN26585266 37 COSMIC
COSN30510882 42 COSMIC
COSN31544351 42 COSMIC
COSN31549944 60 COSMIC
COSN31587608 79 COSMIC
COSN31584828 88 COSMIC
COSN31607751 104 COSMIC
COSN30452692 122 COSMIC
COSN31606548 124 COSMIC
COSN18996668 127 COSMIC
COSN30303612 161 COSMIC
COSN23016819 317 COSMIC
COSN31565333 427 COSMIC
COSN26635440 431 COSMIC
COSN16130435 725 COSMIC
COSN31532325 727 COSMIC
COSN30538882 805 COSMIC
COSN22860542 821 COSMIC
COSN23346963 1728 COSMIC
COSN16595460 2306 COSMIC
COSN16050942 2394 COSMIC
COSN25016230 3300 COSMIC
COSN17581924 3336 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758628915 1 dbSNP
rs1275927090 3 dbSNP
rs1215584077 5 dbSNP
rs1231318310 9 dbSNP
rs371572870 14 dbSNP
rs1274697824 19 dbSNP
rs201558464 21 dbSNP
rs761761141 31 dbSNP
rs1286687486 33 dbSNP
rs1224662060 35 dbSNP
rs1291819856 43 dbSNP
rs1482464434 44 dbSNP
rs776568307 47 dbSNP
rs1202559217 57 dbSNP
rs1234310445 67 dbSNP
rs1470714540 69 dbSNP
rs114371587 70 dbSNP
rs1412089509 78 dbSNP
rs1304531152 81 dbSNP
rs1164805041 86 dbSNP
rs374500812 87 dbSNP
rs4559091 93 dbSNP
rs1370183411 99 dbSNP
rs1331131619 102 dbSNP
rs756249722 103 dbSNP
rs1283335754 110 dbSNP
rs747381359 124 dbSNP
rs945199095 130 dbSNP
rs368842740 132 dbSNP
rs1315702235 140 dbSNP
rs2840262 144 dbSNP
rs189570356 145 dbSNP
rs917779471 168 dbSNP
rs1308930173 181 dbSNP
rs1431669631 183 dbSNP
rs1274499522 196 dbSNP
rs531062418 199 dbSNP
rs1016741415 203 dbSNP
rs992061905 216 dbSNP
rs746940019 220 dbSNP
rs1236044032 225 dbSNP
rs1172085285 229 dbSNP
rs780020354 234 dbSNP
rs563531300 238 dbSNP
rs1390178486 240 dbSNP
rs758160762 254 dbSNP
rs959288003 255 dbSNP
rs867131282 263 dbSNP
rs1028114269 271 dbSNP
rs542250979 280 dbSNP
rs143892558 281 dbSNP
rs1332490586 312 dbSNP
rs1252056963 323 dbSNP
rs1183952319 327 dbSNP
rs1454427979 332 dbSNP
rs1337306213 339 dbSNP
rs1042635536 345 dbSNP
rs559704797 348 dbSNP
rs1226101277 353 dbSNP
rs1277236091 361 dbSNP
rs368762028 363 dbSNP
rs1271376581 364 dbSNP
rs1339516104 377 dbSNP
rs541192523 377 dbSNP
rs1218243722 387 dbSNP
rs1200547119 398 dbSNP
rs774712631 401 dbSNP
rs1009844601 404 dbSNP
rs577095908 405 dbSNP
rs1326103007 414 dbSNP
rs1411578 416 dbSNP
rs1247812905 419 dbSNP
rs764749487 421 dbSNP
rs1463897267 445 dbSNP
rs1227544174 447 dbSNP
rs938224791 450 dbSNP
rs1350938021 453 dbSNP
rs1477767285 454 dbSNP
rs926696016 459 dbSNP
rs1431804235 461 dbSNP
rs1290015947 462 dbSNP
rs1411843744 463 dbSNP
rs1176809570 466 dbSNP
rs543146431 467 dbSNP
rs576125596 468 dbSNP
rs1337655786 477 dbSNP
rs1320250274 478 dbSNP
rs1052073 481 dbSNP
rs1396743656 482 dbSNP
rs1326496089 494 dbSNP
rs1404965453 509 dbSNP
rs1280818592 511 dbSNP
rs1325178398 513 dbSNP
rs1157648492 515 dbSNP
rs1457018809 519 dbSNP
rs1267852930 525 dbSNP
rs961831905 534 dbSNP
rs1019795302 539 dbSNP
rs1285644173 542 dbSNP
rs138311113 544 dbSNP
rs1196764467 545 dbSNP
rs1161854478 546 dbSNP
rs1271157699 546 dbSNP
rs1480856114 547 dbSNP
rs1471573006 549 dbSNP
rs949378400 550 dbSNP
rs1181763791 552 dbSNP
rs1236544131 553 dbSNP
rs1410910440 555 dbSNP
rs1187639660 558 dbSNP
rs1451417390 558 dbSNP
rs1160223417 559 dbSNP
rs1385500882 561 dbSNP
rs1443701738 561 dbSNP
rs919277312 565 dbSNP
rs1404712633 568 dbSNP
rs1300227539 572 dbSNP
rs1346882157 574 dbSNP
rs796246517 576 dbSNP
rs1049685081 583 dbSNP
rs1334335430 584 dbSNP
rs574708107 591 dbSNP
rs1000810921 595 dbSNP
rs903890467 607 dbSNP
rs886061654 608 dbSNP
rs939922502 612 dbSNP
rs753221275 614 dbSNP
rs886061653 618 dbSNP
rs763693497 619 dbSNP
rs1490544900 620 dbSNP
rs1204669899 622 dbSNP
rs555056539 627 dbSNP
rs1421114842 629 dbSNP
rs1269720212 630 dbSNP
rs1183648170 633 dbSNP
rs1436525618 640 dbSNP
rs953906973 660 dbSNP
rs1472405675 670 dbSNP
rs375855440 677 dbSNP
rs1354502596 694 dbSNP
rs147029150 702 dbSNP
rs1424814029 708 dbSNP
rs1448818336 710 dbSNP
rs965394790 715 dbSNP
rs143345846 722 dbSNP
rs1393784299 723 dbSNP
rs1056329984 726 dbSNP
rs1009263826 727 dbSNP
rs1340281091 730 dbSNP
rs886061652 735 dbSNP
rs894053143 737 dbSNP
rs1318659036 754 dbSNP
rs1032632628 760 dbSNP
rs572207850 762 dbSNP
rs951784624 765 dbSNP
rs1390039195 769 dbSNP
rs905367643 771 dbSNP
rs535019953 772 dbSNP
rs1196634862 777 dbSNP
rs1250937878 778 dbSNP
rs1441684336 791 dbSNP
rs1181667811 793 dbSNP
rs1387081917 795 dbSNP
rs768168042 810 dbSNP
rs16888378 811 dbSNP
rs552784139 812 dbSNP
rs1412607946 814 dbSNP
rs1463162867 821 dbSNP
rs1036312915 826 dbSNP
rs1473477363 827 dbSNP
rs1387730909 829 dbSNP
rs1450987643 836 dbSNP
rs942075699 842 dbSNP
rs909764903 844 dbSNP
rs1206494581 845 dbSNP
rs1293474527 857 dbSNP
rs984063997 868 dbSNP
rs932449350 869 dbSNP
rs1309381542 886 dbSNP
rs1465237662 899 dbSNP
rs1228406372 901 dbSNP
rs1255691167 908 dbSNP
rs1322558192 909 dbSNP
rs1008360611 910 dbSNP
rs954242937 914 dbSNP
rs530900959 920 dbSNP
rs1185886561 925 dbSNP
rs1219092802 935 dbSNP
rs1259018327 940 dbSNP
rs1450868920 946 dbSNP
rs1429826164 948 dbSNP
rs1028527766 949 dbSNP
rs1458997816 962 dbSNP
rs570136493 966 dbSNP
rs1289387641 969 dbSNP
rs1467918409 971 dbSNP
rs1178973523 975 dbSNP
rs1407340057 983 dbSNP
rs148372304 984 dbSNP
rs77353467 988 dbSNP
rs1020966620 989 dbSNP
rs559818878 994 dbSNP
rs1366558256 1004 dbSNP
rs1010041611 1007 dbSNP
rs1300525504 1007 dbSNP
rs1300680805 1009 dbSNP
rs1343806194 1012 dbSNP
rs1225601643 1016 dbSNP
rs772529109 1025 dbSNP
rs1349706491 1033 dbSNP
rs1324639209 1045 dbSNP
rs1020748238 1046 dbSNP
rs1264725071 1047 dbSNP
rs1406679842 1049 dbSNP
rs896570723 1054 dbSNP
rs1056276502 1056 dbSNP
rs1167405731 1070 dbSNP
rs1486557685 1081 dbSNP
rs1186536166 1093 dbSNP
rs1479229861 1093 dbSNP
rs1201186091 1098 dbSNP
rs1430401268 1104 dbSNP
rs937824774 1110 dbSNP
rs905051208 1122 dbSNP
rs1353855176 1130 dbSNP
rs541307925 1131 dbSNP
rs773359903 1138 dbSNP
rs1189441105 1139 dbSNP
rs1477673787 1140 dbSNP
rs1363820368 1145 dbSNP
rs1247021203 1148 dbSNP
rs1223512108 1150 dbSNP
rs1284222367 1151 dbSNP
rs1345897959 1154 dbSNP
rs186740414 1157 dbSNP
rs957692065 1158 dbSNP
rs1223068134 1162 dbSNP
rs1304601597 1163 dbSNP
rs1318604618 1163 dbSNP
rs1032560433 1165 dbSNP
rs930591623 1181 dbSNP
rs139778770 1188 dbSNP
rs1491129219 1189 dbSNP
rs1002471688 1190 dbSNP
rs1269245451 1196 dbSNP
rs1469315419 1197 dbSNP
rs182142512 1201 dbSNP
rs1025121870 1205 dbSNP
rs1410646160 1215 dbSNP
rs1420159451 1216 dbSNP
rs535074574 1219 dbSNP
rs1163548505 1224 dbSNP
rs769846634 1227 dbSNP
rs1343029944 1241 dbSNP
rs918895783 1242 dbSNP
rs971760404 1247 dbSNP
rs182662 1251 dbSNP
rs1296200981 1254 dbSNP
rs1375310875 1254 dbSNP
rs1036407845 1256 dbSNP
rs1314371560 1259 dbSNP
rs543165973 1260 dbSNP
rs1367532521 1263 dbSNP
rs1275740036 1268 dbSNP
rs954191542 1281 dbSNP
rs1439127425 1284 dbSNP
rs1491242605 1289 dbSNP
rs1491561820 1290 dbSNP
rs1028475449 1299 dbSNP
rs942003035 1300 dbSNP
rs1234925816 1303 dbSNP
rs1481190680 1304 dbSNP
rs11398 1312 dbSNP
rs1307079551 1317 dbSNP
rs554673220 1319 dbSNP
rs1446978170 1326 dbSNP
rs932568699 1327 dbSNP
rs368874291 1339 dbSNP
rs1021334028 1346 dbSNP
rs1172871499 1353 dbSNP
rs1371823892 1354 dbSNP
rs1356049988 1356 dbSNP
rs1447333859 1364 dbSNP
rs1335851097 1368 dbSNP
rs571694225 1369 dbSNP
rs1413782727 1371 dbSNP
rs1425792447 1372 dbSNP
rs1192703708 1373 dbSNP
rs1338221635 1373 dbSNP
rs143362760 1378 dbSNP
rs1035085365 1379 dbSNP
rs1308442144 1380 dbSNP
rs1249868276 1391 dbSNP
rs1203357896 1392 dbSNP
rs1002319021 1394 dbSNP
rs904998902 1396 dbSNP
rs1184796792 1399 dbSNP
rs1241573252 1403 dbSNP
rs1048945100 1407 dbSNP
rs943890462 1407 dbSNP
rs534984073 1409 dbSNP
rs189407933 1421 dbSNP
rs1175387391 1425 dbSNP
rs930519062 1431 dbSNP
rs1208113678 1434 dbSNP
rs1312115110 1444 dbSNP
rs539740727 1461 dbSNP
rs772021587 1461 dbSNP
rs1036725311 1463 dbSNP
rs1280017891 1463 dbSNP
rs200498640 1463 dbSNP
rs1271436393 1464 dbSNP
rs913613156 1467 dbSNP
rs149190571 1472 dbSNP
rs1222547629 1481 dbSNP
rs745594017 1482 dbSNP
rs1326162985 1486 dbSNP
rs1204852044 1490 dbSNP
rs924959111 1491 dbSNP
rs911579920 1507 dbSNP
rs1327574974 1509 dbSNP
rs1195350398 1515 dbSNP
rs1242801187 1516 dbSNP
rs537671730 1522 dbSNP
rs1288149257 1524 dbSNP
rs1410002766 1525 dbSNP
rs1197582167 1528 dbSNP
rs778774458 1534 dbSNP
rs931746824 1536 dbSNP
rs1173085717 1537 dbSNP
rs1446738272 1538 dbSNP
rs1398893895 1542 dbSNP
rs1319661500 1552 dbSNP
rs1359659105 1553 dbSNP
rs1403930094 1573 dbSNP
rs755092368 1573 dbSNP
rs1281044936 1574 dbSNP
rs921410999 1576 dbSNP
rs969654339 1577 dbSNP
rs979627961 1581 dbSNP
rs1025688053 1582 dbSNP
rs1349105551 1586 dbSNP
rs1188947673 1587 dbSNP
rs757068339 1592 dbSNP
rs1207445849 1594 dbSNP
rs1013716388 1597 dbSNP
rs1021199070 1599 dbSNP
rs962194488 1600 dbSNP
rs1014934045 1601 dbSNP
rs988822591 1612 dbSNP
rs1006281189 1614 dbSNP
rs1473001583 1615 dbSNP
rs1199232498 1616 dbSNP
rs1253003770 1619 dbSNP
rs1035030656 1624 dbSNP
rs1160279640 1627 dbSNP
rs1380364930 1632 dbSNP
rs1482992909 1634 dbSNP
rs1238524453 1637 dbSNP
rs1366995146 1652 dbSNP
rs887888218 1655 dbSNP
rs1002265002 1667 dbSNP
rs1387020079 1667 dbSNP
rs886061651 1668 dbSNP
rs780308689 1670 dbSNP
rs535793575 1671 dbSNP
rs1318349128 1672 dbSNP
rs1243783074 1674 dbSNP
rs1294057267 1678 dbSNP
rs1310212295 1679 dbSNP
rs1488901606 1679 dbSNP
rs1227227538 1691 dbSNP
rs1183901688 1694 dbSNP
rs1379320096 1694 dbSNP
rs1238645173 1700 dbSNP
rs1050437740 1702 dbSNP
rs11969200 1706 dbSNP
rs1432753034 1707 dbSNP
rs1027866017 1709 dbSNP
rs184971972 1710 dbSNP
rs897689718 1716 dbSNP
rs771933785 1718 dbSNP
rs1458667196 1719 dbSNP
rs1393565882 1721 dbSNP
rs1365731013 1722 dbSNP
rs1382612685 1723 dbSNP
rs1451122160 1726 dbSNP
rs1041360578 1732 dbSNP
rs1317198813 1737 dbSNP
rs370142911 1738 dbSNP
rs536771333 1739 dbSNP
rs9382689 1740 dbSNP
rs1050071188 1746 dbSNP
rs777608684 1750 dbSNP
rs936387361 1751 dbSNP
rs1200233844 1753 dbSNP
rs1185513090 1763 dbSNP
rs925052202 1770 dbSNP
rs1463883422 1776 dbSNP
rs1491104486 1782 dbSNP
rs1491243642 1783 dbSNP
rs1248024289 1788 dbSNP
rs1423943119 1788 dbSNP
rs1192014221 1790 dbSNP
rs371936654 1796 dbSNP
rs925713227 1799 dbSNP
rs537063944 1802 dbSNP
rs1209736785 1812 dbSNP
rs764411441 1816 dbSNP
rs368441472 1817 dbSNP
rs144680472 1820 dbSNP
rs1220329708 1822 dbSNP
rs1321975447 1823 dbSNP
rs1381653840 1823 dbSNP
rs149301482 1825 dbSNP
rs1225628842 1826 dbSNP
rs1219517155 1832 dbSNP
rs755645669 1834 dbSNP
rs1278577653 1839 dbSNP
rs1322613199 1847 dbSNP
rs1201671651 1848 dbSNP
rs1257753397 1851 dbSNP
rs992383803 1854 dbSNP
rs988381236 1859 dbSNP
rs962163355 1864 dbSNP
rs1259081670 1865 dbSNP
rs960965551 1870 dbSNP
rs1298298660 1872 dbSNP
rs927910061 1876 dbSNP
rs1179038331 1878 dbSNP
rs1383669900 1878 dbSNP
rs1428999919 1878 dbSNP
rs1453703377 1880 dbSNP
rs865894299 1880 dbSNP
rs1388258728 1882 dbSNP
rs1292751746 1884 dbSNP
rs764008789 1887 dbSNP
rs146039378 1890 dbSNP
rs1489537997 1890 dbSNP
rs368383528 1890 dbSNP
rs1221385146 1892 dbSNP
rs1303149780 1893 dbSNP
rs1165545035 1896 dbSNP
rs1027734078 1905 dbSNP
rs1390079473 1907 dbSNP
rs995352261 1908 dbSNP
rs528844604 1910 dbSNP
rs1267651926 1913 dbSNP
rs1430845617 1914 dbSNP
rs532405641 1918 dbSNP
rs1426354750 1920 dbSNP
rs1418976747 1922 dbSNP
rs567189252 1924 dbSNP
rs1365596047 1926 dbSNP
rs1420452466 1929 dbSNP
rs528242891 1932 dbSNP
rs1293561931 1933 dbSNP
rs1363880284 1936 dbSNP
rs1407015325 1936 dbSNP
rs1202376613 1937 dbSNP
rs952124557 1938 dbSNP
rs565186059 1954 dbSNP
rs1050017426 1955 dbSNP
rs765130016 1956 dbSNP
rs995791112 1957 dbSNP
rs143452107 1959 dbSNP
rs1029534273 1963 dbSNP
rs1042798859 1963 dbSNP
rs1247637046 1968 dbSNP
rs572306750 1974 dbSNP
rs574755261 1978 dbSNP
rs759479488 1978 dbSNP
rs939548971 1984 dbSNP
rs1274773590 1990 dbSNP
rs928192036 1991 dbSNP
rs1229456681 1997 dbSNP
rs996150240 1999 dbSNP
rs901846412 2002 dbSNP
rs1040936985 2007 dbSNP
rs549684091 2008 dbSNP
rs892411267 2019 dbSNP
rs1052253357 2027 dbSNP
rs1441125604 2028 dbSNP
rs1296255531 2034 dbSNP
rs1346375925 2034 dbSNP
rs1313699747 2038 dbSNP
rs1380006266 2041 dbSNP
rs1229666177 2043 dbSNP
rs1305241521 2043 dbSNP
rs1491474257 2052 dbSNP
rs1491167945 2053 dbSNP
rs1458572592 2054 dbSNP
rs920623820 2054 dbSNP
rs1369986399 2059 dbSNP
rs936523260 2062 dbSNP
rs903562803 2066 dbSNP
rs191147024 2067 dbSNP
rs1182660592 2069 dbSNP
rs1463931158 2075 dbSNP
rs531551077 2077 dbSNP
rs1014722136 2081 dbSNP
rs917593578 2082 dbSNP
rs987274613 2085 dbSNP
rs1466057819 2089 dbSNP
rs1270549450 2090 dbSNP
rs954579847 2091 dbSNP
rs1449506162 2093 dbSNP
rs1284286188 2094 dbSNP
rs1028864875 2098 dbSNP
rs1280454794 2099 dbSNP
rs1482536021 2099 dbSNP
rs996073996 2101 dbSNP
rs1251833191 2102 dbSNP
rs1261886648 2103 dbSNP
rs552430272 2106 dbSNP
rs1444649559 2109 dbSNP
rs1197040378 2113 dbSNP
rs1241628261 2114 dbSNP
rs904160453 2115 dbSNP
rs1009947942 2120 dbSNP
rs1021726757 2120 dbSNP
rs1478066057 2125 dbSNP
rs1175454040 2147 dbSNP
rs1399899440 2153 dbSNP
rs891546008 2168 dbSNP
rs1334198651 2178 dbSNP
rs1344128674 2179 dbSNP
rs1056934246 2180 dbSNP
rs1397722097 2180 dbSNP
rs1341516901 2186 dbSNP
rs1281797060 2194 dbSNP
rs768077901 2194 dbSNP
rs1347708684 2197 dbSNP
rs1255401244 2198 dbSNP
rs1283625409 2198 dbSNP
rs1445411927 2210 dbSNP
rs906721130 2215 dbSNP
rs991812174 2224 dbSNP
rs1264094094 2225 dbSNP
rs940934891 2228 dbSNP
rs1198357433 2231 dbSNP
rs1375747201 2242 dbSNP
rs1233679336 2243 dbSNP
rs908169983 2245 dbSNP
rs78165745 2249 dbSNP
rs1045325670 2250 dbSNP
rs948299839 2252 dbSNP
rs1286265175 2256 dbSNP
rs1159935407 2260 dbSNP
rs1417396247 2260 dbSNP
rs1321954867 2261 dbSNP
rs1360713549 2261 dbSNP
rs1333241545 2266 dbSNP
rs1437793854 2270 dbSNP
rs1279558840 2272 dbSNP
rs12211901 2273 dbSNP
rs1242339108 2274 dbSNP
rs563616632 2274 dbSNP
rs1220583248 2292 dbSNP
rs542293516 2292 dbSNP
rs1264971479 2293 dbSNP
rs1199484225 2294 dbSNP
rs1329551703 2303 dbSNP
rs760276939 2308 dbSNP
rs1437763648 2312 dbSNP
rs1159890588 2319 dbSNP
rs940752520 2323 dbSNP
rs1423582288 2330 dbSNP
rs1161158110 2334 dbSNP
rs1029042056 2335 dbSNP
rs1172543748 2339 dbSNP
rs571856902 2341 dbSNP
rs1449685763 2343 dbSNP
rs1310031963 2348 dbSNP
rs954527818 2353 dbSNP
rs559709842 2356 dbSNP
rs773517929 2358 dbSNP
rs1267527845 2360 dbSNP
rs1028796182 2361 dbSNP
rs974607059 2369 dbSNP
rs966046993 2374 dbSNP
rs1470605327 2378 dbSNP
rs1180483351 2387 dbSNP
rs1431838727 2387 dbSNP
rs1157415764 2391 dbSNP
rs544614772 2394 dbSNP
rs1021256158 2395 dbSNP
rs1184780960 2396 dbSNP
rs1369776252 2405 dbSNP
rs1472022401 2407 dbSNP
rs1472932709 2407 dbSNP
rs1010308181 2408 dbSNP
rs577437584 2409 dbSNP
rs892380222 2418 dbSNP
rs1332701276 2420 dbSNP
rs62415930 2425 dbSNP
rs1440246813 2434 dbSNP
rs537378211 2437 dbSNP
rs903697402 2455 dbSNP
rs906673617 2460 dbSNP
rs1044796163 2463 dbSNP
rs1462617618 2468 dbSNP
rs1265947462 2474 dbSNP
rs866133795 2474 dbSNP
rs947775739 2477 dbSNP
rs140949474 2481 dbSNP
rs67756603 2481 dbSNP
rs16888376 2485 dbSNP
rs899422221 2485 dbSNP
rs948292473 2485 dbSNP
rs1328755316 2487 dbSNP
rs1198176575 2491 dbSNP
rs1257691150 2495 dbSNP
rs1192092710 2497 dbSNP
rs940685712 2500 dbSNP
rs1056047454 2502 dbSNP
rs1171838969 2502 dbSNP
rs1241229328 2508 dbSNP
rs555246749 2515 dbSNP
rs1465004208 2523 dbSNP
rs536732780 2525 dbSNP
rs1304619284 2531 dbSNP
rs1333614904 2532 dbSNP
rs1453934035 2533 dbSNP
rs908092832 2535 dbSNP
rs1342614659 2544 dbSNP
rs1318954392 2560 dbSNP
rs1278629299 2563 dbSNP
rs933425525 2565 dbSNP
rs1457097941 2566 dbSNP
rs1257226038 2568 dbSNP
rs1483326348 2570 dbSNP
rs201019928 2577 dbSNP
rs147124444 2579 dbSNP
rs566185462 2585 dbSNP
rs547766165 2586 dbSNP
rs922113619 2587 dbSNP
rs1378272145 2593 dbSNP
rs1453061157 2602 dbSNP
rs1183685982 2604 dbSNP
rs1362635768 2605 dbSNP
rs769099189 2606 dbSNP
rs1400872213 2613 dbSNP
rs1446304075 2615 dbSNP
rs988766249 2618 dbSNP
rs974963913 2625 dbSNP
rs866433148 2626 dbSNP
rs1303410326 2627 dbSNP
rs140866287 2629 dbSNP
rs1238721521 2631 dbSNP
rs1283289444 2632 dbSNP
rs1019074615 2635 dbSNP
rs1002602223 2636 dbSNP
rs1355357347 2636 dbSNP
rs749365027 2639 dbSNP
rs1487747060 2643 dbSNP
rs1193289564 2657 dbSNP
rs988808428 2659 dbSNP
rs1268594781 2662 dbSNP
rs763281017 2663 dbSNP
rs1382285393 2665 dbSNP
rs1012822043 2668 dbSNP
rs1163246763 2669 dbSNP
rs1030893667 2679 dbSNP
rs1354521613 2680 dbSNP
rs773395495 2681 dbSNP
rs1246889219 2682 dbSNP
rs1385600735 2689 dbSNP
rs1038340379 2691 dbSNP
rs1378548940 2692 dbSNP
rs1240417003 2693 dbSNP
rs968015362 2695 dbSNP
rs1023875137 2703 dbSNP
rs1319563958 2706 dbSNP
rs1296107524 2718 dbSNP
rs1266433569 2719 dbSNP
rs1457683578 2719 dbSNP
rs778952906 2720 dbSNP
rs1197353724 2721 dbSNP
rs571419463 2722 dbSNP
rs1440475598 2726 dbSNP
rs1005164107 2738 dbSNP
rs1425804280 2743 dbSNP
rs1012113926 2747 dbSNP
rs1343542386 2751 dbSNP
rs1346118967 2752 dbSNP
rs896219710 2753 dbSNP
rs1056141992 2761 dbSNP
rs550035886 2769 dbSNP
rs1402378919 2771 dbSNP
rs1446803696 2773 dbSNP
rs761834986 2776 dbSNP
rs773786705 2777 dbSNP
rs531538724 2780 dbSNP
rs1229712864 2782 dbSNP
rs1313851083 2784 dbSNP
rs1217337580 2789 dbSNP
rs1260479905 2798 dbSNP
rs1163666280 2802 dbSNP
rs1039157200 2803 dbSNP
rs1367779207 2823 dbSNP
rs1235838798 2828 dbSNP
rs1388208630 2828 dbSNP
rs1484341781 2829 dbSNP
rs1182713257 2830 dbSNP
rs1187803498 2831 dbSNP
rs776707641 2833 dbSNP
rs930875272 2834 dbSNP
rs1168287216 2837 dbSNP
rs922238284 2839 dbSNP
rs1243570488 2841 dbSNP
rs1410492055 2844 dbSNP
rs914437718 2851 dbSNP
rs1356975920 2852 dbSNP
rs561133735 2876 dbSNP
rs1313188796 2877 dbSNP
rs1339456142 2881 dbSNP
rs745815053 2881 dbSNP
rs956002942 2882 dbSNP
rs1319165470 2889 dbSNP
rs112319331 2895 dbSNP
rs376232324 2895 dbSNP
rs1276563671 2898 dbSNP
rs1361735147 2901 dbSNP
rs944933081 2907 dbSNP
rs911940388 2909 dbSNP
rs560997002 2912 dbSNP
rs1314080349 2913 dbSNP
rs988907944 2914 dbSNP
rs1210914359 2918 dbSNP
rs1262673388 2919 dbSNP
rs1272613249 2925 dbSNP
rs146429095 2927 dbSNP
rs770728497 2929 dbSNP
rs925924642 2940 dbSNP
rs1475685578 2960 dbSNP
rs1272226996 2963 dbSNP
rs969747610 2972 dbSNP
rs978813378 2973 dbSNP
rs968360275 2978 dbSNP
rs1023589310 2983 dbSNP
rs1012452176 2991 dbSNP
rs1173735376 2993 dbSNP
rs527347107 2994 dbSNP
rs1359449634 3002 dbSNP
rs1330137935 3004 dbSNP
rs1300405825 3016 dbSNP
rs963867414 3017 dbSNP
rs1303418955 3029 dbSNP
rs1016445817 3030 dbSNP
rs960533701 3030 dbSNP
rs1005505389 3031 dbSNP
rs749068215 3033 dbSNP
rs1051999309 3038 dbSNP
rs1368105261 3041 dbSNP
rs997468832 3044 dbSNP
rs777516864 3047 dbSNP
rs886214673 3068 dbSNP
rs1421643913 3069 dbSNP
rs1478982247 3072 dbSNP
rs1170580396 3073 dbSNP
rs1193675291 3075 dbSNP
rs559820749 3075 dbSNP
rs1417460763 3087 dbSNP
rs1477602513 3089 dbSNP
rs1268411514 3091 dbSNP
rs1333293100 3093 dbSNP
rs1442332815 3101 dbSNP
rs994546706 3113 dbSNP
rs1374835289 3120 dbSNP
rs1242576453 3121 dbSNP
rs900749006 3122 dbSNP
rs544569465 3123 dbSNP
rs1355934998 3126 dbSNP
rs143976520 3128 dbSNP
rs562371430 3129 dbSNP
rs1203922255 3130 dbSNP
rs1214301083 3133 dbSNP
rs1308598515 3135 dbSNP
rs1053303388 3143 dbSNP
rs570346175 3144 dbSNP
rs1437352054 3147 dbSNP
rs575648372 3148 dbSNP
rs1179984936 3172 dbSNP
rs979166475 3180 dbSNP
rs1161792924 3183 dbSNP
rs1393390797 3185 dbSNP
rs139222657 3189 dbSNP
rs1331333071 3194 dbSNP
rs1398739563 3196 dbSNP
rs1449018861 3201 dbSNP
rs1284346203 3204 dbSNP
rs928530608 3204 dbSNP
rs1242937463 3211 dbSNP
rs543244907 3213 dbSNP
rs572544112 3217 dbSNP
rs981397698 3218 dbSNP
rs374911374 3224 dbSNP
rs1257272902 3226 dbSNP
rs1306865312 3227 dbSNP
rs960506824 3233 dbSNP
rs915608715 3240 dbSNP
rs1034800126 3242 dbSNP
rs1441460429 3247 dbSNP
rs1332159733 3259 dbSNP
rs983278827 3284 dbSNP
rs756316180 3288 dbSNP
rs1475699929 3292 dbSNP
rs554325860 3297 dbSNP
rs1170431413 3298 dbSNP
rs962494122 3299 dbSNP
rs183728323 3304 dbSNP
rs1298793135 3309 dbSNP
rs983630133 3309 dbSNP
rs1401650079 3317 dbSNP
rs1394497495 3321 dbSNP
rs950923532 3328 dbSNP
rs72868608 3330 dbSNP
rs994873125 3333 dbSNP
rs766839783 3334 dbSNP
rs536853913 3336 dbSNP
rs1410123511 3346 dbSNP
rs997751289 3352 dbSNP
rs1315953512 3362 dbSNP
rs556332021 3364 dbSNP
rs1481030939 3366 dbSNP
rs1343750173 3381 dbSNP
rs1009135167 3383 dbSNP
rs1259104463 3386 dbSNP
rs367604309 3386 dbSNP
rs1371112205 3389 dbSNP
rs771698423 3392 dbSNP
rs1208575766 3396 dbSNP
rs1012037520 3408 dbSNP
rs1479078294 3409 dbSNP
rs1171803137 3411 dbSNP
rs893231015 3417 dbSNP
rs1053647618 3418 dbSNP
rs1174404094 3424 dbSNP
rs934480033 3431 dbSNP
rs1419370490 3433 dbSNP
rs1297331188 3438 dbSNP
rs777651345 3440 dbSNP
rs1383843381 3450 dbSNP
rs1296118823 3453 dbSNP
rs1330459964 3464 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUU-UGGUAAUACACGACGAu 5'
            :|| ||| ||   ||||||| 
Target 5' ucUAACACCUUU---UGCUGCUc 3'
3 - 22
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000317483.3 | 3UTR | CAUCUAACACCUUUUGCUGCUCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.614 2.0e-3 0.704 2.7e-4 20 Click to see details
GSE21032 Prostate cancer 0.299 3.0e-3 0.257 9.5e-3 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.504 7.1e-3 -0.275 1.0e-1 23 Click to see details
GSE19536 Breast cancer -0.215 1.6e-2 -0.217 1.5e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.215 2.9e-2 -0.277 6.7e-3 79 Click to see details
GSE19350 CNS germ cell tumors 0.399 9.9e-2 0.671 8.5e-3 12 Click to see details
GSE28260 Renal cortex and medulla -0.324 1.4e-1 -0.291 1.7e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.272 1.5e-1 0.406 5.9e-2 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.179 2.0e-1 -0.214 1.6e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.143 2.2e-1 0.185 1.6e-1 32 Click to see details
GSE21687 Ependynoma primary tumors 0.089 2.4e-1 0.114 1.8e-1 64 Click to see details
GSE38226 Liver fibrosis 0.155 2.5e-1 0.103 3.3e-1 21 Click to see details
GSE14794 Lymphoblastoid cells 0.071 2.5e-1 0.065 2.7e-1 90 Click to see details
GSE28544 Breast cancer -0.121 2.9e-1 0.023 4.6e-1 24 Click to see details
GSE21849 B cell lymphoma 0.1 3.0e-1 0.472 4.9e-3 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.084 3.4e-1 0.029 4.5e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.037 4.4e-1 0.045 4.3e-1 20 Click to see details
GSE17306 Multiple myeloma -0.011 4.7e-1 -0.021 4.4e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.007 4.9e-1 -0.294 7.7e-2 25 Click to see details
GSE17498 Multiple myeloma -0.004 4.9e-1 0.001 5.0e-1 40 Click to see details
GSE17498 Multiple myeloma -0.004 4.9e-1 0.001 5.0e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.789 0 -0.834 0 32 Click to see details
BLCA -0.783 0 -0.682 0 18 Click to see details
THCA -0.443 0 -0.526 0 59 Click to see details
PAAD -0.998 0 -1.000 0.5 4 Click to see details
KIRP -0.336 0.03 -0.317 0.04 32 Click to see details
LUSC -0.235 0.08 -0.189 0.13 38 Click to see details
COAD -0.531 0.09 -0.643 0.04 8 Click to see details
PRAD -0.177 0.11 -0.202 0.08 50 Click to see details
HNSC -0.182 0.12 -0.179 0.13 42 Click to see details
BRCA 0.123 0.13 0.114 0.15 84 Click to see details
CHOL -0.416 0.13 -0.433 0.12 9 Click to see details
PCPG -0.872 0.16 -0.500 0.33 3 Click to see details
LUAD -0.31 0.16 -0.399 0.1 12 Click to see details
ESCA 0.31 0.18 0.627 0.02 11 Click to see details
UCEC 0.214 0.19 0.093 0.35 19 Click to see details
LIHC 0.128 0.19 0.125 0.2 49 Click to see details
CESC 0.797 0.21 0.500 0.33 3 Click to see details
KIRC 0.059 0.32 0.032 0.4 68 Click to see details
KICH 0.037 0.43 0.122 0.28 25 Click to see details
KICH 0.037 0.43 0.122 0.28 25 Click to see details
KICH 0.037 0.43 0.122 0.28 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1