miRTarBase - #MIRT558511 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CYP26B1   
Synonyms CYP26A2, P450RAI-2, P450RAI2, RHFCA
Description cytochrome P450 family 26 subfamily B member 1
Transcript NM_019885   
Expression
Putative miRNA Targets on CYP26B1
3'UTR of CYP26B1
(miRNA target sites are highlighted)
>CYP26B1|NM_019885|3'UTR
   1 CCCAAGACCCACCCGCCTCAGCCCAGCCCAGGCAGCGGGGTGGTGGTTGTGGGAGGTAGAAACCTGTGTGTGGGAGGGGG
  81 CCGGAACGGGGAGGGCGAGTGGCCCCCATACTTGCCCTCCCTTGCTCCCCCTCCCTGGCAAACCCTACCCAAAGCCAGTG
 161 GGCCCCATTCCTAGGGCTGGGCTCCCCTTCTGGCTCCAGCTTCCCTCCAGCCACTCCCCATTTACCATCAGCTCAGCCCC
 241 TGGGAAGGGCGTGGCAGGGGCTCTGCATGCCCGTGACAGTGTTAGGTGTCAGCGCGTGCTACAGTGTTTTTGTGATGTTC
 321 TGAACTGCTCCCTTCCCTCCGTTCCTTTCGGACCCTTTTAGCTGGGGTTGGGGGACGGGAAGAGCCGTGCCCCCTTGGGC
 401 GCACTCTTCAGCGTCTCCTCCTCCTGCGCCCCCACTGCGTCTGCCCAGGAACAGCATCCTGGGTAGCAGAACAGGAGTCA
 481 ACCTTGGCGGGGCGGGGGCTGCGTCCAACCTGGAGATTGCCCTTCCCTATGCCACGGTTCCCACCCTCCCTCACCAGTTT
 561 GGACAATTTGAAATTACCTATTGCTGCTACTTGTTCTGTCCTCTGACCTTGGGGCAAAGGAGCCCCAGGCCCTGTCTCCC
 641 CAGCATCCTCCCTGGTGGCCCTGGGCAGGTGCACTGACACCCCCACCTTCCCATCCCCTGCTGAACCAGGCCCTGTTACA
 721 CACAGCCGCCTAAGGCCCGCGGCTCATGTGCTGCCCGCCCCCATATTTATTCACTGATAGAGAATCTTGGGGATGCTGGG
 801 GTCTGGAGTGAACATCTCCTCCCCTTCATGCCCTAGCCTGTGTTCTAGCTGTCCTGGCGAGACTTCTGTGAGTGAAGAGG
 881 AAGGGGTCTCTGGTCAAACCCAGCCCCCAGGGCCTAGGGTTGAAAGCCTTCCCCGGCTCCGGGCATTATTTGGGTTTAAT
 961 CTCGGAGCCTCACTCCTGGACTGAAGTCCGGTGCCTCTGCCTTATCCCTGGTGGAGATGGAATGTGGCCCATTGCCTCCT
1041 CCCTCTCCTGTCAAAAACCCTGATCAGGTAGATTTGGAGGCGGCCACGATTTCCTGTTTGGCCCCTGTTCACCCCAGTGC
1121 ACTGGCCCTGACTCCAGGCGTGAGTATGGGGAAGGATACGGGTTCTTCTGACGGGGAGCAAGGGCCTCCGTCTTCCCTTC
1201 CTTAACTCTCCCCCTTTGCCCTCCGCCCTGAAAAAGGTGTCCTTGAAGTCCCTTCCACCTCTATGCCACTGTCTGCTTAG
1281 CCCAGCTCAGGGGTGGGGAAGAGGCGAAAGCGTGGGGGAGGTGAGCGCAGCGGCAGTTCTGCCTCGGAGCTGATTGCAGG
1361 GCCCTGTGTGGTCTCCGGACAGCTGCGGGAAGGCTGCCGCAGCTGAAGCTGAAGAGGCGGCTACGTGCGGTTTGTCAGGG
1441 GGATTGGGTTGAAAACTGGCCAGTCGGGATGACTGGGTGAAAGAGGAGTAGCTCCTGCCACTGGCGTTTTGAGTGTTGGC
1521 AATTTGGGATGCCTCCTGGGGAAGGTTTCCGGGCGTTTGGTGAGTCTCTAGATTTTTCCTTGCTTTCTGTGTTTATTGGT
1601 TTTTGATGTTGTAAAAGCAATGAATCCCCTTTACAAGAAAATCGAAAACACAGAAGAATGAAGGACATGCCAGTCCCCGA
1681 TCGCTGCTGTGAGCACCTCAGTGGCTCCCTCAGACCAGATCCCGTAGGCAGCCCCACAGACCGACCCTGACCCCACTCAC
1761 AGCCACCCTGAAGATAGACTATAGGAACGGGCCCATACCACACAGACTGCTCTCCAATCCCTGAGTCTCAGATGTTTCAT
1841 TTATTTCCTACTTTTCCACTACTAAAAAACAGTGTGGAATAGACATTATTGGCAAAATTGCTCATCCCTAATCCTGAAAA
1921 ACAGGCCAGAATGGGTAAAGACTTGTCAAAGCTTGCAACATAGCTACATGGTGCACCCGGACCTGTACCCCCTCCCCCCA
2001 ACACAAAACCAGTGTCTGGGAGGTTCATTTTCCTTTAAACTGATCCAGCTGGCCCTGAACCAATTGTTTTTGACTGAGTA
2081 TCTAGGAGAGCAGTAAGTGGAACTTCAGACAAGCCCACTGGGTCTGGTCCAGGTGAGGGGCAGGGGGCATGGGGCTGGGA
2161 GGTCTCAGGGGCCTTCCCTGGGGGTGGCCAGCCTGGTAGGGGGCAGAGAAGGAAAAGCTGAGGGGGGTCCCTGTGAGGGA
2241 GGAAAGAAGGATCATTTGCCCCGCTGGGTCTCAAAGGCAGTGAGAAGAGAGCTGAAGAAAGCTCTGGCTGGCTGACAGGA
2321 TCCCTGTGTTGTAATTGGTCCCTCCTTTCAGCTCTCTAGTGAGATGCCCGTGTCTGTGCGTGTGCGTGTGTGTTTCATAC
2401 AGCTAGCATTAGATGGGTGATGTTTCTTACTTATCATCCCTAACTATTGCAACTTGACCTTAAAAAGACAAAACCCCACA
2481 AAACTCTTCCTGCCACGGGCTTGCAGATTGAAGCACTTTCGATGTTGGGCGCTGGCGTTTGTGTTCTGGGCACCACCGTG
2561 ACCCTGCCCAGATGGCTATAATATTATTTTATACACAAACCTTTTTTTTCATAAATGTTATAATTTTGTGTCTGTCTTTA
2641 TAAACTATTATAAGTACTATTTTTGTTATAATTCAAAATAGATATTTAGTATAAAGTTTTTGCTGTTAAATATTTGTTAT
2721 TTAGTAAAATATGAATTTTGCTCTATTGTAAACATGGTTCAAAATATTAATATGTTTTTATCACAGTCGTTTTAATATTG
2801 AAAAAGCACTTGTGTGTTTTGTTTTGATATGAAACTGGTACCGTGTGAGTGTTTTTGCTGTCGTGGTTTTAATCTGTATA
2881 TAATATTCCATGTTGCATATTAAAAACATGAATGTTGTGCATTTTGTGATTTTGGAAATACTCAATGTGGCTCTTCTATA
2961 GGCTTCTAGAATAAACCGTGGGGACCCGCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGU-AAUACACGACGAu 5'
             |||::|  ||| ||||||| 
Target 5' ttgAAATTACCTAT-TGCTGCTa 3'
568 - 589 158.00 -11.80
2
miRNA  3' guguuugguAAUACACGACGau 5'
                   | |||||||||  
Target 5' gcccgcggcTCATGTGCTGCcc 3'
735 - 756 137.00 -17.40
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|||  :|| | |||||:| 
Target 5' taTAAA--GTT-TTTGCTGTTa 3'
2690 - 2708 135.00 -8.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15666729 7 COSMIC
COSN30110328 8 COSMIC
COSN14006182 15 COSMIC
COSN6684392 44 COSMIC
COSN20064275 87 COSMIC
COSN31524533 131 COSMIC
COSN16415036 175 COSMIC
COSN9385993 294 COSMIC
COSN20074421 380 COSMIC
COSN31959775 382 COSMIC
COSN26115756 428 COSMIC
COSN31542624 459 COSMIC
COSN7082347 493 COSMIC
COSN30544086 499 COSMIC
COSN7082346 503 COSMIC
COSN22927047 527 COSMIC
COSN31521185 591 COSMIC
COSN31550745 730 COSMIC
COSN30234028 935 COSMIC
COSN15859715 939 COSMIC
COSN31488885 1010 COSMIC
COSN9385992 1026 COSMIC
COSN22735096 1082 COSMIC
COSN31585825 1088 COSMIC
COSN31522110 1140 COSMIC
COSN31484974 1159 COSMIC
COSN31566522 1224 COSMIC
COSN8894828 1287 COSMIC
COSN31517252 1327 COSMIC
COSN4806529 1409 COSMIC
COSN21818178 1693 COSMIC
COSN1242198 1754 COSMIC
COSN28198326 1825 COSMIC
COSN20096857 2374 COSMIC
COSN18771244 2391 COSMIC
COSN5132088 2452 COSMIC
COSN20096856 2609 COSMIC
COSN31528090 2642 COSMIC
COSN31590309 2653 COSMIC
COSN31589434 2657 COSMIC
COSN31549403 2699 COSMIC
COSN31538327 2800 COSMIC
COSN8609544 2826 COSMIC
COSN31551038 2859 COSMIC
COSN15660861 2907 COSMIC
COSN28769600 2986 COSMIC
rs2241059 44 GWAS
rs707718 2907 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766151107 1 dbSNP
rs1267399227 2 dbSNP
rs1212576157 4 dbSNP
rs892407164 9 dbSNP
rs760345819 10 dbSNP
rs1269869325 11 dbSNP
rs369986598 12 dbSNP
rs1349668927 13 dbSNP
rs376643612 14 dbSNP
rs759138854 15 dbSNP
rs761864469 15 dbSNP
rs180851816 17 dbSNP
rs1237118602 18 dbSNP
rs1333099692 19 dbSNP
rs899635377 20 dbSNP
rs541407471 23 dbSNP
rs1440208581 24 dbSNP
rs774130226 25 dbSNP
rs1039473686 34 dbSNP
rs759561625 36 dbSNP
rs556645871 37 dbSNP
rs1384692182 38 dbSNP
rs1157231025 39 dbSNP
rs778170378 40 dbSNP
rs1377793249 41 dbSNP
rs537630028 42 dbSNP
rs2241059 44 dbSNP
rs1249412417 45 dbSNP
rs1189134422 46 dbSNP
rs1446401812 51 dbSNP
rs1483639845 55 dbSNP
rs1019373578 56 dbSNP
rs1007530726 58 dbSNP
rs1347251567 65 dbSNP
rs1307138950 72 dbSNP
rs1393176805 77 dbSNP
rs912299293 81 dbSNP
rs753520747 82 dbSNP
rs889219257 83 dbSNP
rs764691422 87 dbSNP
rs763591399 88 dbSNP
rs1371849687 96 dbSNP
rs1446101335 96 dbSNP
rs775113173 97 dbSNP
rs963544549 99 dbSNP
rs1365293612 108 dbSNP
rs1388234788 114 dbSNP
rs879080089 115 dbSNP
rs548788241 116 dbSNP
rs533791371 117 dbSNP
rs1276920921 128 dbSNP
rs1342923004 129 dbSNP
rs1222477103 131 dbSNP
rs1264143703 132 dbSNP
rs558930155 134 dbSNP
rs917477633 139 dbSNP
rs769379644 140 dbSNP
rs1418984648 142 dbSNP
rs1267643221 144 dbSNP
rs1448554138 147 dbSNP
rs1186249705 169 dbSNP
rs1378357307 174 dbSNP
rs1449528052 176 dbSNP
rs1055884982 180 dbSNP
rs937002773 181 dbSNP
rs1164005654 182 dbSNP
rs1347978267 183 dbSNP
rs1459274649 184 dbSNP
rs1161229274 200 dbSNP
rs1293845796 203 dbSNP
rs1387607693 206 dbSNP
rs925720680 218 dbSNP
rs1433220431 220 dbSNP
rs372967410 227 dbSNP
rs978470988 237 dbSNP
rs566441456 238 dbSNP
rs370716089 240 dbSNP
rs1254875090 250 dbSNP
rs913071877 251 dbSNP
rs551083754 253 dbSNP
rs956670938 260 dbSNP
rs376847318 261 dbSNP
rs1032221293 267 dbSNP
rs965690194 269 dbSNP
rs562424282 272 dbSNP
rs986562024 273 dbSNP
rs1180729223 278 dbSNP
rs1411562049 280 dbSNP
rs1425535636 283 dbSNP
rs1165357019 290 dbSNP
rs763896328 293 dbSNP
rs550613382 294 dbSNP
rs1027775074 295 dbSNP
rs868051196 296 dbSNP
rs890908710 298 dbSNP
rs897877998 302 dbSNP
rs1447423964 309 dbSNP
rs1046802267 312 dbSNP
rs1259441817 322 dbSNP
rs1381393343 325 dbSNP
rs1229465006 326 dbSNP
rs929638150 331 dbSNP
rs1327541853 337 dbSNP
rs754632729 339 dbSNP
rs1317528235 340 dbSNP
rs1015113436 341 dbSNP
rs529018211 343 dbSNP
rs1208960007 344 dbSNP
rs561417359 345 dbSNP
rs1483943882 347 dbSNP
rs1188586584 348 dbSNP
rs1056035142 349 dbSNP
rs776279469 350 dbSNP
rs770501250 354 dbSNP
rs145347737 360 dbSNP
rs1358404711 361 dbSNP
rs557595070 362 dbSNP
rs116045368 368 dbSNP
rs945809943 376 dbSNP
rs141543767 377 dbSNP
rs746817061 386 dbSNP
rs1032275200 387 dbSNP
rs943869079 389 dbSNP
rs1412087269 390 dbSNP
rs911159045 394 dbSNP
rs55707322 397 dbSNP
rs147629953 400 dbSNP
rs758309984 401 dbSNP
rs1027664825 409 dbSNP
rs973372084 412 dbSNP
rs1482062018 413 dbSNP
rs890927421 417 dbSNP
rs1486506150 418 dbSNP
rs765765249 426 dbSNP
rs962137879 427 dbSNP
rs1189712619 428 dbSNP
rs114394163 429 dbSNP
rs73942508 430 dbSNP
rs1167982018 431 dbSNP
rs573799770 438 dbSNP
rs762527888 439 dbSNP
rs750902279 462 dbSNP
rs1330944762 463 dbSNP
rs1434681754 464 dbSNP
rs1272751156 473 dbSNP
rs1369226066 474 dbSNP
rs1234546234 475 dbSNP
rs778857169 476 dbSNP
rs555102568 481 dbSNP
rs1045314716 484 dbSNP
rs369926358 488 dbSNP
rs756123412 489 dbSNP
rs945693630 493 dbSNP
rs891571328 494 dbSNP
rs1169011393 499 dbSNP
rs1394604142 501 dbSNP
rs79240472 502 dbSNP
rs943902687 503 dbSNP
rs566429247 511 dbSNP
rs979439046 515 dbSNP
rs985662781 517 dbSNP
rs868793264 522 dbSNP
rs576549190 529 dbSNP
rs117806979 533 dbSNP
rs919816973 535 dbSNP
rs973422992 536 dbSNP
rs1025456602 540 dbSNP
rs1212377372 541 dbSNP
rs1208407694 548 dbSNP
rs962024148 554 dbSNP
rs1246356889 556 dbSNP
rs556845549 557 dbSNP
rs962476868 559 dbSNP
rs992921931 560 dbSNP
rs1198233137 561 dbSNP
rs1419109090 563 dbSNP
rs960362023 566 dbSNP
rs1319481955 569 dbSNP
rs1034534496 570 dbSNP
rs767769369 577 dbSNP
rs1383434135 581 dbSNP
rs1318460700 589 dbSNP
rs539049371 598 dbSNP
rs1445815440 600 dbSNP
rs1285867177 605 dbSNP
rs1335249624 609 dbSNP
rs757484692 614 dbSNP
rs184701552 618 dbSNP
rs968961704 622 dbSNP
rs1301092268 645 dbSNP
rs543589926 659 dbSNP
rs1371090839 664 dbSNP
rs1440761358 667 dbSNP
rs1190241611 670 dbSNP
rs1258754552 672 dbSNP
rs1472488952 673 dbSNP
rs1157331455 675 dbSNP
rs1013807268 681 dbSNP
rs1009887495 682 dbSNP
rs891455100 684 dbSNP
rs1455057249 699 dbSNP
rs1041232735 711 dbSNP
rs1007984970 712 dbSNP
rs1158780137 715 dbSNP
rs546261257 716 dbSNP
rs896717102 725 dbSNP
rs764597740 727 dbSNP
rs889504974 728 dbSNP
rs1314652779 730 dbSNP
rs1049598845 735 dbSNP
rs931114469 738 dbSNP
rs763432605 739 dbSNP
rs149961285 740 dbSNP
rs1168156554 745 dbSNP
rs935497068 748 dbSNP
rs1255572251 750 dbSNP
rs1342973385 751 dbSNP
rs371219985 751 dbSNP
rs925403127 756 dbSNP
rs1483041439 757 dbSNP
rs1180608171 758 dbSNP
rs1254497044 764 dbSNP
rs1420033686 767 dbSNP
rs1182096212 774 dbSNP
rs1043755676 787 dbSNP
rs1464132370 789 dbSNP
rs942696493 792 dbSNP
rs879510766 803 dbSNP
rs1175028905 805 dbSNP
rs1375486179 809 dbSNP
rs1429101241 810 dbSNP
rs550307961 811 dbSNP
rs1398378801 812 dbSNP
rs1391688991 816 dbSNP
rs940709342 821 dbSNP
rs574577825 829 dbSNP
rs1329507251 830 dbSNP
rs1236748443 837 dbSNP
rs181608666 841 dbSNP
rs549594963 858 dbSNP
rs1253678979 876 dbSNP
rs1341544374 877 dbSNP
rs960166107 884 dbSNP
rs1277322536 886 dbSNP
rs1481167941 887 dbSNP
rs1209576035 888 dbSNP
rs918492038 892 dbSNP
rs927347599 893 dbSNP
rs1436185408 900 dbSNP
rs1195105438 902 dbSNP
rs1252868976 912 dbSNP
rs1448288079 931 dbSNP
rs1166645322 933 dbSNP
rs972601159 934 dbSNP
rs962529681 935 dbSNP
rs1388275604 937 dbSNP
rs980322151 940 dbSNP
rs554847069 941 dbSNP
rs1364566803 953 dbSNP
rs1226189959 959 dbSNP
rs1236394088 960 dbSNP
rs1021868110 963 dbSNP
rs1010441987 964 dbSNP
rs1024001644 969 dbSNP
rs1215188825 971 dbSNP
rs956253020 973 dbSNP
rs1439330576 975 dbSNP
rs1464071141 976 dbSNP
rs1019290449 979 dbSNP
rs1008285898 989 dbSNP
rs759027253 990 dbSNP
rs1329030257 992 dbSNP
rs1429095063 1001 dbSNP
rs1395161286 1002 dbSNP
rs1366563703 1004 dbSNP
rs1462768683 1010 dbSNP
rs1165932263 1013 dbSNP
rs1375206966 1029 dbSNP
rs1052626322 1033 dbSNP
rs1290760241 1052 dbSNP
rs374259461 1057 dbSNP
rs1396019401 1058 dbSNP
rs776073527 1065 dbSNP
rs1337408490 1074 dbSNP
rs1234237615 1079 dbSNP
rs10181341 1081 dbSNP
rs1328104507 1082 dbSNP
rs866169750 1087 dbSNP
rs1036825907 1088 dbSNP
rs545650648 1094 dbSNP
rs1485902938 1103 dbSNP
rs1181224563 1105 dbSNP
rs939928719 1107 dbSNP
rs1253914003 1110 dbSNP
rs533479514 1126 dbSNP
rs889857314 1128 dbSNP
rs1410924439 1132 dbSNP
rs1051128338 1140 dbSNP
rs1161535065 1146 dbSNP
rs1345873036 1147 dbSNP
rs1465549159 1154 dbSNP
rs1301637314 1159 dbSNP
rs1468615837 1160 dbSNP
rs917799726 1163 dbSNP
rs1288159040 1170 dbSNP
rs1057154145 1172 dbSNP
rs918541390 1173 dbSNP
rs938665951 1173 dbSNP
rs1316996195 1179 dbSNP
rs1208770601 1184 dbSNP
rs566038439 1185 dbSNP
rs980148858 1186 dbSNP
rs1442121408 1189 dbSNP
rs1250877132 1192 dbSNP
rs1468356346 1199 dbSNP
rs760160328 1204 dbSNP
rs772874737 1205 dbSNP
rs1408933169 1206 dbSNP
rs1212700411 1207 dbSNP
rs1432692899 1213 dbSNP
rs1485887852 1214 dbSNP
rs771818807 1221 dbSNP
rs747945667 1224 dbSNP
rs139132281 1225 dbSNP
rs1369114317 1230 dbSNP
rs909687163 1231 dbSNP
rs1280961758 1234 dbSNP
rs1222006927 1237 dbSNP
rs980329340 1239 dbSNP
rs1218257069 1246 dbSNP
rs1300677523 1249 dbSNP
rs956333543 1261 dbSNP
rs1020267692 1267 dbSNP
rs1435897316 1275 dbSNP
rs573789548 1283 dbSNP
rs1353220349 1284 dbSNP
rs1233219353 1286 dbSNP
rs953834086 1288 dbSNP
rs1488299319 1289 dbSNP
rs1191977906 1291 dbSNP
rs548299085 1292 dbSNP
rs115643428 1293 dbSNP
rs1416957939 1301 dbSNP
rs1226739445 1305 dbSNP
rs955669525 1306 dbSNP
rs1031214548 1308 dbSNP
rs540018994 1311 dbSNP
rs995256198 1312 dbSNP
rs879918022 1314 dbSNP
rs999707955 1317 dbSNP
rs1159273074 1318 dbSNP
rs1372543293 1320 dbSNP
rs898211910 1322 dbSNP
rs1474987340 1325 dbSNP
rs1415889052 1326 dbSNP
rs1190344881 1327 dbSNP
rs1216222251 1328 dbSNP
rs1475372049 1331 dbSNP
rs1273527166 1332 dbSNP
rs1015451977 1336 dbSNP
rs778767121 1338 dbSNP
rs572737916 1339 dbSNP
rs1056774592 1340 dbSNP
rs1213541279 1341 dbSNP
rs557688310 1345 dbSNP
rs10178600 1346 dbSNP
rs1240409558 1360 dbSNP
rs569064850 1364 dbSNP
rs889919053 1371 dbSNP
rs1051608229 1375 dbSNP
rs1044802129 1376 dbSNP
rs1334403511 1376 dbSNP
rs947483241 1377 dbSNP
rs1233530404 1379 dbSNP
rs914634795 1384 dbSNP
rs1319347252 1386 dbSNP
rs1356505538 1387 dbSNP
rs933988030 1390 dbSNP
rs988960888 1394 dbSNP
rs373336736 1398 dbSNP
rs1275312036 1399 dbSNP
rs1036962345 1400 dbSNP
rs1208313945 1408 dbSNP
rs912845085 1412 dbSNP
rs1282328946 1416 dbSNP
rs1448800380 1417 dbSNP
rs987454402 1418 dbSNP
rs150765484 1419 dbSNP
rs1319578007 1420 dbSNP
rs948549755 1424 dbSNP
rs535489132 1425 dbSNP
rs768641999 1426 dbSNP
rs992945859 1428 dbSNP
rs142183963 1429 dbSNP
rs922484697 1429 dbSNP
rs1318931068 1430 dbSNP
rs1339756885 1431 dbSNP
rs1412835174 1439 dbSNP
rs1294948046 1441 dbSNP
rs1355851125 1453 dbSNP
rs1228078074 1456 dbSNP
rs3768646 1463 dbSNP
rs528209966 1465 dbSNP
rs1476287931 1466 dbSNP
rs1242582941 1468 dbSNP
rs1004080703 1469 dbSNP
rs1277972095 1473 dbSNP
rs567027476 1475 dbSNP
rs1022968918 1482 dbSNP
rs1007094052 1488 dbSNP
rs889917926 1492 dbSNP
rs1466698966 1494 dbSNP
rs558996621 1499 dbSNP
rs140487777 1504 dbSNP
rs114265709 1505 dbSNP
rs905076589 1512 dbSNP
rs1470892967 1514 dbSNP
rs1037057326 1516 dbSNP
rs1374292478 1518 dbSNP
rs1005553385 1520 dbSNP
rs1213140055 1532 dbSNP
rs1375851528 1535 dbSNP
rs888404367 1539 dbSNP
rs1305159962 1545 dbSNP
rs1044392364 1550 dbSNP
rs533636681 1551 dbSNP
rs1044671141 1554 dbSNP
rs947370904 1555 dbSNP
rs563080447 1562 dbSNP
rs1368852642 1564 dbSNP
rs1482953842 1570 dbSNP
rs1194389481 1578 dbSNP
rs917046216 1582 dbSNP
rs1235240518 1587 dbSNP
rs1182078928 1589 dbSNP
rs1394015046 1589 dbSNP
rs893251086 1596 dbSNP
rs1053123921 1598 dbSNP
rs934440486 1600 dbSNP
rs1395556121 1604 dbSNP
rs1461401520 1609 dbSNP
rs1296278631 1611 dbSNP
rs1398356566 1613 dbSNP
rs534782468 1619 dbSNP
rs544199141 1620 dbSNP
rs1462135526 1621 dbSNP
rs1325402719 1629 dbSNP
rs1354116914 1630 dbSNP
rs529279738 1635 dbSNP
rs561833757 1643 dbSNP
rs1307477842 1644 dbSNP
rs1225840065 1649 dbSNP
rs1411394167 1658 dbSNP
rs1340480378 1659 dbSNP
rs540298049 1664 dbSNP
rs1172934450 1667 dbSNP
rs1466766790 1668 dbSNP
rs932907889 1670 dbSNP
rs1253046683 1671 dbSNP
rs1427917152 1677 dbSNP
rs879476764 1678 dbSNP
rs1462242435 1679 dbSNP
rs1392498679 1682 dbSNP
rs1463194004 1683 dbSNP
rs973759463 1686 dbSNP
rs1361355072 1692 dbSNP
rs573257971 1693 dbSNP
rs775815727 1694 dbSNP
rs771981182 1696 dbSNP
rs1298300474 1697 dbSNP
rs1327395872 1702 dbSNP
rs1193765340 1704 dbSNP
rs116106989 1705 dbSNP
rs1230758471 1710 dbSNP
rs908328810 1715 dbSNP
rs545718676 1716 dbSNP
rs961492183 1723 dbSNP
rs570118604 1724 dbSNP
rs1485224356 1727 dbSNP
rs982937408 1738 dbSNP
rs575489304 1740 dbSNP
rs550034024 1742 dbSNP
rs745964628 1745 dbSNP
rs1005563449 1772 dbSNP
rs888405027 1773 dbSNP
rs1415360908 1777 dbSNP
rs74614087 1777 dbSNP
rs1463276681 1780 dbSNP
rs1013220479 1781 dbSNP
rs753122814 1788 dbSNP
rs1364599381 1789 dbSNP
rs1291179090 1792 dbSNP
rs528187634 1793 dbSNP
rs1386373329 1794 dbSNP
rs895721888 1796 dbSNP
rs969299724 1807 dbSNP
rs574450897 1810 dbSNP
rs1234758981 1812 dbSNP
rs1312901652 1817 dbSNP
rs1011567017 1819 dbSNP
rs1261951751 1822 dbSNP
rs893136429 1824 dbSNP
rs1053007083 1825 dbSNP
rs145983995 1826 dbSNP
rs891180785 1827 dbSNP
rs1407482822 1835 dbSNP
rs1432753531 1838 dbSNP
rs1051721235 1844 dbSNP
rs1161423583 1850 dbSNP
rs1364452865 1856 dbSNP
rs1434704151 1864 dbSNP
rs1311526392 1869 dbSNP
rs534659169 1870 dbSNP
rs1415736696 1883 dbSNP
rs1303086523 1885 dbSNP
rs777678534 1885 dbSNP
rs1396772807 1889 dbSNP
rs1174213159 1892 dbSNP
rs1308606613 1900 dbSNP
rs3768647 1901 dbSNP
rs1233493444 1907 dbSNP
rs921545083 1914 dbSNP
rs1486549012 1923 dbSNP
rs1457132843 1924 dbSNP
rs1038626294 1925 dbSNP
rs1405243037 1933 dbSNP
rs551942826 1934 dbSNP
rs1479818148 1937 dbSNP
rs188806567 1944 dbSNP
rs908209986 1945 dbSNP
rs1252951235 1946 dbSNP
rs569513245 1959 dbSNP
rs6737643 1961 dbSNP
rs1283016501 1967 dbSNP
rs1234611446 1974 dbSNP
rs954464451 1977 dbSNP
rs922845090 1978 dbSNP
rs1353121623 1985 dbSNP
rs976950222 1988 dbSNP
rs1439648009 1990 dbSNP
rs1305033593 1991 dbSNP
rs1439470172 1992 dbSNP
rs1225663261 1993 dbSNP
rs1350011533 1994 dbSNP
rs1219735098 1995 dbSNP
rs960751948 1998 dbSNP
rs1312536006 2000 dbSNP
rs927716066 2001 dbSNP
rs1377048791 2005 dbSNP
rs1005615587 2016 dbSNP
rs61138718 2020 dbSNP
rs1453036766 2033 dbSNP
rs527980401 2038 dbSNP
rs1022207960 2040 dbSNP
rs1417835548 2043 dbSNP
rs1411939287 2044 dbSNP
rs1172129325 2055 dbSNP
rs1461510879 2061 dbSNP
rs895761478 2063 dbSNP
rs1323385295 2064 dbSNP
rs1035564585 2076 dbSNP
rs1419182801 2082 dbSNP
rs1437122564 2085 dbSNP
rs1269455767 2092 dbSNP
rs1010778873 2109 dbSNP
rs1359639329 2110 dbSNP
rs1416648416 2114 dbSNP
rs998653662 2116 dbSNP
rs13014574 2126 dbSNP
rs13014572 2127 dbSNP
rs1212055027 2137 dbSNP
rs1042808182 2143 dbSNP
rs1452197411 2147 dbSNP
rs1193106646 2150 dbSNP
rs1032100667 2155 dbSNP
rs1476607110 2171 dbSNP
rs1201517299 2172 dbSNP
rs1485856069 2173 dbSNP
rs1417584551 2176 dbSNP
rs1474709143 2179 dbSNP
rs1259009171 2183 dbSNP
rs998842151 2184 dbSNP
rs1329961772 2185 dbSNP
rs891230778 2187 dbSNP
rs558893384 2188 dbSNP
rs997053802 2192 dbSNP
rs900000622 2200 dbSNP
rs546596502 2203 dbSNP
rs1317581726 2204 dbSNP
rs888860042 2205 dbSNP
rs1432769301 2208 dbSNP
rs1357112776 2225 dbSNP
rs1278681127 2227 dbSNP
rs1050552574 2228 dbSNP
rs1313220052 2232 dbSNP
rs932991672 2244 dbSNP
rs1295284893 2251 dbSNP
rs1381544632 2253 dbSNP
rs1382642787 2259 dbSNP
rs1204581926 2260 dbSNP
rs142301814 2262 dbSNP
rs941602150 2263 dbSNP
rs887329667 2264 dbSNP
rs1453779538 2269 dbSNP
rs1217971290 2283 dbSNP
rs1393100716 2287 dbSNP
rs184289105 2289 dbSNP
rs192628350 2290 dbSNP
rs976963134 2303 dbSNP
rs940189556 2308 dbSNP
rs1420446793 2322 dbSNP
rs35919191 2325 dbSNP
rs908681005 2326 dbSNP
rs927736323 2328 dbSNP
rs1421504300 2335 dbSNP
rs980543336 2341 dbSNP
rs1374635516 2349 dbSNP
rs1412656685 2353 dbSNP
rs1188734363 2358 dbSNP
rs780914258 2358 dbSNP
rs1238566238 2362 dbSNP
rs1277912710 2364 dbSNP
rs1352854619 2365 dbSNP
rs575381062 2369 dbSNP
rs1484905848 2370 dbSNP
rs1260203627 2379 dbSNP
rs1442707489 2380 dbSNP
rs201157140 2380 dbSNP
rs1188818576 2381 dbSNP
rs1056764799 2385 dbSNP
rs1230695617 2385 dbSNP
rs1159216612 2386 dbSNP
rs989242380 2388 dbSNP
rs371818557 2390 dbSNP
rs1432761775 2391 dbSNP
rs151135314 2391 dbSNP
rs3030188 2391 dbSNP
rs956639677 2391 dbSNP
rs1346387415 2394 dbSNP
rs1465396069 2394 dbSNP
rs563488061 2396 dbSNP
rs542115966 2400 dbSNP
rs1023047604 2402 dbSNP
rs574788497 2407 dbSNP
rs991933156 2417 dbSNP
rs139104907 2422 dbSNP
rs977855412 2428 dbSNP
rs1266293572 2430 dbSNP
rs772788821 2433 dbSNP
rs1270403092 2434 dbSNP
rs960034631 2434 dbSNP
rs749699761 2436 dbSNP
rs780391355 2439 dbSNP
rs189049771 2440 dbSNP
rs1035576277 2449 dbSNP
rs1452580233 2451 dbSNP
rs955396188 2468 dbSNP
rs1200838180 2476 dbSNP
rs1030202350 2479 dbSNP
rs1461257626 2484 dbSNP
rs1226355687 2485 dbSNP
rs996937360 2495 dbSNP
rs899884459 2496 dbSNP
rs1017128583 2497 dbSNP
rs1005700900 2505 dbSNP
rs1368854356 2506 dbSNP
rs534363236 2511 dbSNP
rs1435810659 2514 dbSNP
rs146384489 2520 dbSNP
rs115973980 2521 dbSNP
rs1260376873 2527 dbSNP
rs1442612280 2529 dbSNP
rs1050146144 2530 dbSNP
rs1166990007 2531 dbSNP
rs939054094 2533 dbSNP
rs530718938 2536 dbSNP
rs901485448 2537 dbSNP
rs1211593619 2550 dbSNP
rs1041332783 2551 dbSNP
rs1427824355 2556 dbSNP
rs149437281 2557 dbSNP
rs1425500498 2562 dbSNP
rs1478303900 2564 dbSNP
rs1164408910 2574 dbSNP
rs947818259 2575 dbSNP
rs1459473940 2580 dbSNP
rs1173142067 2586 dbSNP
rs914967038 2587 dbSNP
rs989296076 2591 dbSNP
rs935154332 2599 dbSNP
rs1469894453 2600 dbSNP
rs528123098 2601 dbSNP
rs1195448753 2606 dbSNP
rs11898950 2609 dbSNP
rs397820569 2610 dbSNP
rs1265484282 2611 dbSNP
rs1319422946 2611 dbSNP
rs34564593 2611 dbSNP
rs1203298499 2613 dbSNP
rs1485541135 2613 dbSNP
rs1252916468 2616 dbSNP
rs1488457508 2623 dbSNP
rs1229027556 2624 dbSNP
rs1187541716 2626 dbSNP
rs369432569 2628 dbSNP
rs1425758946 2631 dbSNP
rs931492160 2637 dbSNP
rs915988856 2638 dbSNP
rs867588880 2639 dbSNP
rs1301202405 2640 dbSNP
rs1300527698 2647 dbSNP
rs1361606960 2649 dbSNP
rs1414494326 2653 dbSNP
rs75120972 2655 dbSNP
rs80162598 2656 dbSNP
rs74839089 2657 dbSNP
rs80255227 2658 dbSNP
rs987405765 2659 dbSNP
rs555942991 2668 dbSNP
rs761585643 2678 dbSNP
rs1312882767 2679 dbSNP
rs1035628234 2685 dbSNP
rs1288027929 2689 dbSNP
rs557997765 2689 dbSNP
rs1029671531 2690 dbSNP
rs1389372792 2693 dbSNP
rs1354179897 2695 dbSNP
rs967292125 2696 dbSNP
rs1235492243 2704 dbSNP
rs1484400718 2708 dbSNP
rs1394751075 2716 dbSNP
rs1021532949 2719 dbSNP
rs1417353734 2723 dbSNP
rs887842 2729 dbSNP
rs1381524482 2733 dbSNP
rs953198239 2743 dbSNP
rs768603905 2748 dbSNP
rs1017013680 2751 dbSNP
rs1005756444 2756 dbSNP
rs1449792247 2770 dbSNP
rs1378347420 2771 dbSNP
rs1181346847 2774 dbSNP
rs1436339217 2782 dbSNP
rs184521564 2788 dbSNP
rs749229900 2789 dbSNP
rs997246177 2797 dbSNP
rs1233472892 2801 dbSNP
rs1252368947 2808 dbSNP
rs1205561438 2818 dbSNP
rs1313681160 2826 dbSNP
rs1211097440 2827 dbSNP
rs780060238 2830 dbSNP
rs1456591346 2835 dbSNP
rs1003806013 2842 dbSNP
rs568452697 2843 dbSNP
rs192518290 2845 dbSNP
rs543202626 2845 dbSNP
rs1415360296 2850 dbSNP
rs528504012 2850 dbSNP
rs1278030961 2852 dbSNP
rs1236416315 2853 dbSNP
rs1011848349 2862 dbSNP
rs747090182 2863 dbSNP
rs1440104459 2864 dbSNP
rs1272935846 2866 dbSNP
rs750021276 2873 dbSNP
rs893586716 2875 dbSNP
rs1337118433 2894 dbSNP
rs928705891 2903 dbSNP
rs707718 2907 dbSNP
rs1200744820 2908 dbSNP
rs114839562 2909 dbSNP
rs1375225223 2917 dbSNP
rs1248914869 2922 dbSNP
rs1311586778 2927 dbSNP
rs1186340800 2930 dbSNP
rs923802995 2934 dbSNP
rs1416708176 2937 dbSNP
rs188060390 2941 dbSNP
rs182538804 2943 dbSNP
rs1468697367 2945 dbSNP
rs541282307 2946 dbSNP
rs914474287 2958 dbSNP
rs1460434288 2959 dbSNP
rs1183183509 2961 dbSNP
rs1351584127 2966 dbSNP
rs933266379 2977 dbSNP
rs921821190 2978 dbSNP
rs2420201 2986 dbSNP
rs964030697 2987 dbSNP
rs191715137 2988 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGU-AAUACACGACGau 5'
             |||::|  ||| ||||||  
Target 5' ---AAAUUACCUAU-UGCUGC-- 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1, repA ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGU-AAUACACGACGAu 5'
             |||::|  ||| ||||||| 
Target 5' uugAAAUUACCUAU-UGCUGCUa 3'
6 - 27
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000001146.2 | 3UTR | AAAUUACCUAUUGCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000001146.2 | 3UTR | ACAAUUUGAAAUUACCUAUUGCUGCUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.35 1.8e-4 -0.358 1.3e-4 100 Click to see details
GSE19783 ER- ER- breast cancer -0.315 2.3e-3 -0.302 3.4e-3 79 Click to see details
GSE21849 B cell lymphoma -0.465 5.5e-3 -0.394 1.7e-2 29 Click to see details
GSE38226 Liver fibrosis -0.517 8.2e-3 -0.390 4.0e-2 21 Click to see details
GSE21032 Prostate cancer -0.239 1.5e-2 -0.207 3.0e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.211 2.3e-2 0.221 1.8e-2 90 Click to see details
GSE21687 Ependynoma primary tumors -0.206 5.1e-2 -0.191 6.5e-2 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.209 1.6e-1 0.198 1.8e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.23 1.6e-1 -0.281 1.2e-1 20 Click to see details
GSE17498 Multiple myeloma -0.144 1.9e-1 -0.038 4.1e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.229 2.0e-1 -0.238 1.9e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.175 2.0e-1 -0.297 7.5e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.182 2.0e-1 0.069 3.8e-1 23 Click to see details
GSE19350 CNS germ cell tumors 0.24 2.3e-1 -0.049 4.4e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.125 2.5e-1 0.126 2.5e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.196 2.6e-1 -0.165 3.0e-1 13 Click to see details
GSE28544 Breast cancer 0.129 2.7e-1 0.423 2.0e-2 24 Click to see details
GSE17306 Multiple myeloma 0.065 3.3e-1 0.096 2.6e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.093 3.3e-1 -0.005 4.9e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.027 4.6e-1 0.245 1.5e-1 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.027 4.6e-1 0.245 1.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.281 0 0.248 0.01 84 Click to see details
KICH 0.241 0.12 0.338 0.05 25 Click to see details
THCA -0.141 0.14 -0.120 0.18 59 Click to see details
KIRP -0.186 0.15 -0.094 0.3 32 Click to see details
PAAD -0.546 0.23 -0.800 0.1 4 Click to see details
UCEC 0.182 0.23 0.233 0.17 19 Click to see details
LUSC -0.116 0.24 -0.127 0.22 38 Click to see details
COAD -0.275 0.25 -0.214 0.31 8 Click to see details
CHOL -0.251 0.26 -0.217 0.29 9 Click to see details
ESCA 0.211 0.27 0.100 0.38 11 Click to see details
LIHC 0.088 0.27 0.090 0.27 49 Click to see details
PCPG 0.546 0.32 0.500 0.33 3 Click to see details
BLCA -0.106 0.34 -0.069 0.39 18 Click to see details
KIRC -0.051 0.34 0.011 0.46 68 Click to see details
LUAD -0.076 0.41 -0.098 0.38 12 Click to see details
HNSC -0.034 0.42 -0.088 0.29 42 Click to see details
PRAD 0.029 0.42 0.055 0.35 50 Click to see details
STAD -0.028 0.44 -0.109 0.28 32 Click to see details
CESC 0.089 0.47 0.500 0.33 3 Click to see details
CESC 0.089 0.47 0.500 0.33 3 Click to see details
CESC 0.089 0.47 0.500 0.33 3 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1<