miRTarBase - #MIRT558664 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CNKSR3   
Synonyms CNK3, MAGI1
Description CNKSR family member 3
Transcript NM_173515   
Expression
Putative miRNA Targets on CNKSR3
3'UTR of CNKSR3
(miRNA target sites are highlighted)
>CNKSR3|NM_173515|3'UTR
   1 GAGGGACCCTGCTCAGGCCACCTGCCTGGCTCCTGCCCCAAGTGCCTTGCTTTTACAGTGGACAGCCTCTTCTCGTTTCA
  81 GCCTCAGTATTATGTAGGGACCTTATGCAATTTCTTTTTCTTTTGAAAAGTTATCTACTGCCCTTCTTGGAAGTTTGCAG
 161 GATTGGATGGGAACAAATTCAGAGGATCTTAGGTGCTGGCTTGTGGAGACAAAAGGAGGGAAATGGGTAGAGCCTGTTTG
 241 TCTTGCTTCCCCAGAGATAGAATGTGAAGACACGCGCTAGAAATCGCAGTCCTGGCCAGAGACGTTATGGTCATTGTGAG
 321 GGACTGGTGGCATTGTTCCTTTTTGAGGGGCTGGGGGGACTCAAATTGGTGGCTGTTTTCACACAGATGTGTTGGTTTGT
 401 GGTCCAACTTCTTTATCTGAAAAAGCCAGTGAGAAAACATTTTTGATTTGATTTTTCTAAACTATCTACCATATTTTAAG
 481 TGTAGCAGCTTTGACTTTGCAATAACGTGGCAAGTATCTGATTTCTCCTTTGAGGCAGAGGTTTAAGTGTAGGCCTGTTA
 561 CACTTGTTTGATACCTTTTTCATGACAGTCTCAGTATAGATCAGTTGGTACAGAAATACATGAACACATTTTGATAGGGC
 641 TTATTTCACACAAAGAAGTTTATGGTTATTTGTGTGGGGTGGTGTTGTTATATATTATTGTCTTTAAGGGAAAAGAAGCT
 721 ATAAGATTCGCTGACAGCCAAAGTATCATTTAGAAAAGTGAAGCAACAAGATTTAGGTTGATGAAAGATACATGAGTTTG
 801 CATTTTGACCTGTTCAGTGTCTGTCTTCCAGCACGGTGTGTACACTTCTTCAAAATTGTACACAGTTTGCTAATTAGAAA
 881 TATCTTGGAAAGCCTCATGGTCACTAATTTTCAACTAGCATCAGGTATTTTGAAAACGTGTGTCTGGATATTAACTCTTG
 961 TTTAAACTGAATGTATGATATTTTGTTAGAATGGAAAAGTACTATCTTGTTAATTTAAGTATTTTAAATATAGTTGTATA
1041 TTTTTCTTACTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU--AAUACACGA-CGAu 5'
            ||:|  |  ||| ||||| ||| 
Target 5' ttCAGAGGATCTTAGGTGCTGGCTt 3'
178 - 202 130.00 -11.80
2
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             :|:||  | ||| :|||| 
Target 5' gtaGAGCCTGTTTGTCTTGCTt 3'
227 - 248 115.00 -11.10
3
miRNA  3' guguuugguaauaCACGACGAu 5'
                       |||:||:| 
Target 5' tttgtgtggggtgGTGTTGTTa 3'
669 - 690 113.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20075656 9 COSMIC
COSN30100427 14 COSMIC
COSN30529771 21 COSMIC
COSN31559521 35 COSMIC
COSN24301557 74 COSMIC
COSN14905841 80 COSMIC
COSN20075669 140 COSMIC
COSN32062643 201 COSMIC
COSN22861101 273 COSMIC
COSN23603573 276 COSMIC
COSN20103524 462 COSMIC
COSN31490460 794 COSMIC
COSN7786434 866 COSMIC
COSN31543670 877 COSMIC
COSN31537776 925 COSMIC
COSN27190150 1799 COSMIC
COSN9498264 1982 COSMIC
COSN2149009 2196 COSMIC
COSN15672287 2287 COSMIC
COSN19214816 2688 COSMIC
COSN14765438 2931 COSMIC
COSN28330222 2932 COSMIC
COSN17016963 3004 COSMIC
COSN7695523 3368 COSMIC
COSN14681629 3580 COSMIC
COSN15193325 3640 COSMIC
COSN30334730 4094 COSMIC
COSN14683541 4239 COSMIC
COSN2149008 4555 COSMIC
COSN14978239 4687 COSMIC
COSN14683770 4758 COSMIC
COSN14835189 4762 COSMIC
COSN16369816 4962 COSMIC
COSN7695522 5084 COSMIC
COSN24792677 5365 COSMIC
COSN9498263 5368 COSMIC
COSN21262368 5690 COSMIC
COSN14993863 5710 COSMIC
COSN6309820 5737 COSMIC
COSN14693449 5931 COSMIC
COSN14991937 6139 COSMIC
COSN14933057 6165 COSMIC
COSN25586913 6737 COSMIC
COSN14700759 6918 COSMIC
COSN22458958 6938 COSMIC
COSN14787055 6983 COSMIC
COSN21209434 7324 COSMIC
COSN25810716 7632 COSMIC
COSN4953652 8121 COSMIC
COSN16065460 8183 COSMIC
COSN14903281 8333 COSMIC
COSN20137172 8505 COSMIC
COSN23938063 8691 COSMIC
COSN16777036 8702 COSMIC
COSN25517077 9066 COSMIC
COSN26191549 9471 COSMIC
COSN9498262 9537 COSMIC
COSN22712380 9580 COSMIC
COSN17798822 10076 COSMIC
COSN9311643 10282 COSMIC
COSN14741120 10620 COSMIC
COSN9311642 10788 COSMIC
COSN14994048 10917 COSMIC
COSN25476622 11199 COSMIC
COSN8399343 11789 COSMIC
COSN14741686 12014 COSMIC
COSN28081993 12034 COSMIC
COSN16312416 12177 COSMIC
COSN20199632 12741 COSMIC
COSN14684569 13067 COSMIC
COSN25789256 13495 COSMIC
COSN14947528 13727 COSMIC
COSN23169043 13780 COSMIC
COSN21987410 13885 COSMIC
COSN27690158 13976 COSMIC
COSN24936010 14345 COSMIC
COSN29854412 14447 COSMIC
COSN20471371 14495 COSMIC
COSN19271460 14778 COSMIC
COSN15815245 14883 COSMIC
COSN4856943 14928 COSMIC
COSN16169318 15174 COSMIC
COSN29178521 15349 COSMIC
COSN25494975 16410 COSMIC
COSN24703167 16434 COSMIC
COSN5084920 16507 COSMIC
COSN14933056 16752 COSMIC
COSN14932784 16938 COSMIC
COSN29836048 17399 COSMIC
COSN2149007 17497 COSMIC
COSN26861219 17613 COSMIC
COSN30055066 17726 COSMIC
COSN26323719 17780 COSMIC
COSN29296349 17869 COSMIC
COSN14691296 17873 COSMIC
COSN7786433 18252 COSMIC
COSN29082533 18334 COSMIC
COSN27553282 18344 COSMIC
COSN223921 18455 COSMIC
COSN6309819 18483 COSMIC
COSN16520094 18685 COSMIC
COSN9971008 18702 COSMIC
rs2275336 500 GWAS
rs55800521 10773 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1274275709 2 dbSNP
rs1474814709 3 dbSNP
rs142615338 7 dbSNP
rs1021247243 8 dbSNP
rs765250801 15 dbSNP
rs780589138 23 dbSNP
rs1304851019 30 dbSNP
rs73790959 32 dbSNP
rs754047906 33 dbSNP
rs1305797500 35 dbSNP
rs766600128 36 dbSNP
rs1397395978 39 dbSNP
rs760603680 40 dbSNP
rs1171441737 41 dbSNP
rs1310978463 58 dbSNP
rs1027985932 59 dbSNP
rs1355429503 66 dbSNP
rs1234416746 75 dbSNP
rs1293439009 79 dbSNP
rs9397716 80 dbSNP
rs1224531835 82 dbSNP
rs780117795 85 dbSNP
rs948698198 89 dbSNP
rs1408105911 90 dbSNP
rs916023328 94 dbSNP
rs553800256 101 dbSNP
rs1160876864 102 dbSNP
rs1485330545 104 dbSNP
rs1004018515 105 dbSNP
rs1188549741 106 dbSNP
rs1420193565 110 dbSNP
rs1474044998 114 dbSNP
rs112354497 115 dbSNP
rs1256515631 115 dbSNP
rs1188468402 141 dbSNP
rs886927960 142 dbSNP
rs1375210386 146 dbSNP
rs1240221443 148 dbSNP
rs1315364712 157 dbSNP
rs1045646652 162 dbSNP
rs191671750 164 dbSNP
rs1294189722 172 dbSNP
rs574765834 173 dbSNP
rs1270136207 182 dbSNP
rs1231658117 198 dbSNP
rs1346874831 199 dbSNP
rs1211251191 202 dbSNP
rs1025378605 203 dbSNP
rs556327850 204 dbSNP
rs1484824406 210 dbSNP
rs1186046132 216 dbSNP
rs1262492003 217 dbSNP
rs74920838 224 dbSNP
rs1398083584 227 dbSNP
rs1360327607 232 dbSNP
rs1027518844 236 dbSNP
rs994500831 249 dbSNP
rs571093746 251 dbSNP
rs559219295 252 dbSNP
rs925363266 254 dbSNP
rs1287828942 257 dbSNP
rs745825093 258 dbSNP
rs945589979 270 dbSNP
rs1369714111 273 dbSNP
rs763116327 274 dbSNP
rs914071376 274 dbSNP
rs1282146454 275 dbSNP
rs987087018 276 dbSNP
rs138147314 284 dbSNP
rs1214968910 285 dbSNP
rs1027997372 286 dbSNP
rs567076869 288 dbSNP
rs1191764029 291 dbSNP
rs975080377 304 dbSNP
rs1454845910 307 dbSNP
rs904812407 309 dbSNP
rs1043313638 310 dbSNP
rs948731545 311 dbSNP
rs1165204998 314 dbSNP
rs962787789 320 dbSNP
rs1425278270 321 dbSNP
rs1323253384 322 dbSNP
rs1016712310 331 dbSNP
rs548270161 332 dbSNP
rs886980531 347 dbSNP
rs1276456746 354 dbSNP
rs529857436 358 dbSNP
rs145415328 362 dbSNP
rs550336961 364 dbSNP
rs1318600264 368 dbSNP
rs950575281 372 dbSNP
rs777358899 375 dbSNP
rs1249960795 391 dbSNP
rs1272588806 401 dbSNP
rs1211973892 407 dbSNP
rs1055548586 411 dbSNP
rs532148510 416 dbSNP
rs1231597018 418 dbSNP
rs34224990 425 dbSNP
rs113404262 438 dbSNP
rs1273981054 445 dbSNP
rs973280581 445 dbSNP
rs1410832325 450 dbSNP
rs1247287157 464 dbSNP
rs200975287 465 dbSNP
rs10603494 469 dbSNP
rs367546542 469 dbSNP
rs754165979 469 dbSNP
rs1461699888 470 dbSNP
rs1255729782 471 dbSNP
rs1325117459 471 dbSNP
rs1441234063 473 dbSNP
rs565002809 475 dbSNP
rs755611715 482 dbSNP
rs1008529877 487 dbSNP
rs1043856863 499 dbSNP
rs2275336 500 dbSNP
rs1321971611 501 dbSNP
rs1271165519 502 dbSNP
rs41292908 506 dbSNP
rs1205699728 507 dbSNP
rs904679212 515 dbSNP
rs560789204 516 dbSNP
rs1419126479 520 dbSNP
rs1475255694 527 dbSNP
rs934251701 534 dbSNP
rs1164438868 548 dbSNP
rs1293707726 555 dbSNP
rs1459155825 561 dbSNP
rs1170940392 571 dbSNP
rs558493619 574 dbSNP
rs111970860 581 dbSNP
rs894689631 582 dbSNP
rs1057160377 585 dbSNP
rs938686799 588 dbSNP
rs1268453737 589 dbSNP
rs541916429 592 dbSNP
rs921484598 598 dbSNP
rs976054757 610 dbSNP
rs1391867682 611 dbSNP
rs1207989472 612 dbSNP
rs1277298570 619 dbSNP
rs1191681838 627 dbSNP
rs574863649 633 dbSNP
rs1346174567 634 dbSNP
rs1453818843 641 dbSNP
rs41292906 643 dbSNP
rs929160358 648 dbSNP
rs544246864 650 dbSNP
rs909535501 652 dbSNP
rs973186581 659 dbSNP
rs1474908666 672 dbSNP
rs1211829187 679 dbSNP
rs577190579 680 dbSNP
rs982585379 682 dbSNP
rs951100603 683 dbSNP
rs559247753 685 dbSNP
rs1014014257 694 dbSNP
rs958519001 703 dbSNP
rs1344769239 707 dbSNP
rs1034295190 709 dbSNP
rs1000519801 721 dbSNP
rs1376029975 722 dbSNP
rs765578212 729 dbSNP
rs762087590 730 dbSNP
rs1316377758 733 dbSNP
rs1044085761 736 dbSNP
rs1369568374 741 dbSNP
rs987582401 745 dbSNP
rs1300110594 777 dbSNP
rs1368985973 778 dbSNP
rs575726137 782 dbSNP
rs769056824 790 dbSNP
rs1388134118 792 dbSNP
rs7764527 794 dbSNP
rs1281612493 795 dbSNP
rs567064601 802 dbSNP
rs934173323 809 dbSNP
rs921413154 810 dbSNP
rs1372201036 817 dbSNP
rs1249534834 832 dbSNP
rs1171635688 834 dbSNP
rs1452143634 835 dbSNP
rs1039993336 837 dbSNP
rs968434383 838 dbSNP
rs1378255336 839 dbSNP
rs1156749046 840 dbSNP
rs1384084765 842 dbSNP
rs1401381101 846 dbSNP
rs1322590283 848 dbSNP
rs62433593 849 dbSNP
rs539639245 853 dbSNP
rs536326408 856 dbSNP
rs1440414247 860 dbSNP
rs1304696955 862 dbSNP
rs1333182384 863 dbSNP
rs770864723 865 dbSNP
rs909556071 865 dbSNP
rs1279507627 866 dbSNP
rs1351968623 870 dbSNP
rs1208846687 871 dbSNP
rs1269446381 877 dbSNP
rs982374547 879 dbSNP
rs1013054193 880 dbSNP
rs1212666696 884 dbSNP
rs1267881785 896 dbSNP
rs1434700229 902 dbSNP
rs1179334913 906 dbSNP
rs568822810 910 dbSNP
rs1363187198 914 dbSNP
rs1472858376 920 dbSNP
rs894762672 937 dbSNP
rs1178014130 938 dbSNP
rs1057374671 947 dbSNP
rs1003307996 948 dbSNP
rs887101877 962 dbSNP
rs772302803 975 dbSNP
rs1047477476 979 dbSNP
rs1336913311 980 dbSNP
rs931431764 981 dbSNP
rs1289742792 982 dbSNP
rs917025911 992 dbSNP
rs1349304498 1004 dbSNP
rs1232090097 1011 dbSNP
rs1265686723 1013 dbSNP
rs992519430 1031 dbSNP
rs1193897315 1036 dbSNP
rs1249526536 1037 dbSNP
rs1483373264 1038 dbSNP
rs1339438981 1055 dbSNP
rs1255228868 1057 dbSNP
rs745762321 1074 dbSNP
rs528822074 1079 dbSNP
rs1165516771 1080 dbSNP
rs1370453137 1085 dbSNP
rs564635585 1086 dbSNP
rs1000127023 1087 dbSNP
rs1412300430 1089 dbSNP
rs150113070 1095 dbSNP
rs924322272 1096 dbSNP
rs1305787461 1099 dbSNP
rs1022316362 1102 dbSNP
rs1312768101 1109 dbSNP
rs367854233 1116 dbSNP
rs868750071 1122 dbSNP
rs571228166 1142 dbSNP
rs1009545245 1148 dbSNP
rs892456840 1149 dbSNP
rs1021375275 1151 dbSNP
rs1206963401 1152 dbSNP
rs958840673 1155 dbSNP
rs546480185 1167 dbSNP
rs1352065511 1171 dbSNP
rs1182563537 1173 dbSNP
rs79456979 1185 dbSNP
rs1036381910 1186 dbSNP
rs572507732 1186 dbSNP
rs887333598 1189 dbSNP
rs1310899922 1199 dbSNP
rs1390949073 1199 dbSNP
rs1172120615 1200 dbSNP
rs1414079737 1205 dbSNP
rs1402908480 1214 dbSNP
rs770759127 1221 dbSNP
rs1174255432 1223 dbSNP
rs1375412279 1233 dbSNP
rs1051202727 1234 dbSNP
rs1025645340 1242 dbSNP
rs368902487 1246 dbSNP
rs1363325606 1248 dbSNP
rs900030399 1249 dbSNP
rs1473721775 1251 dbSNP
rs1294421554 1252 dbSNP
rs1039744491 1253 dbSNP
rs1187756307 1255 dbSNP
rs1040241897 1270 dbSNP
rs941623866 1271 dbSNP
rs1210712583 1272 dbSNP
rs34989565 1283 dbSNP
rs140797091 1286 dbSNP
rs1347869272 1295 dbSNP
rs1259671701 1298 dbSNP
rs1484937198 1299 dbSNP
rs1052012017 1303 dbSNP
rs1228600721 1307 dbSNP
rs1248914189 1308 dbSNP
rs150919667 1314 dbSNP
rs929668085 1315 dbSNP
rs924490711 1319 dbSNP
rs777386781 1321 dbSNP
rs1434317735 1323 dbSNP
rs1178868550 1328 dbSNP
rs1343885041 1329 dbSNP
rs992571897 1331 dbSNP
rs1319259439 1335 dbSNP
rs1388977608 1341 dbSNP
rs937054558 1342 dbSNP
rs117664882 1345 dbSNP
rs978981520 1346 dbSNP
rs1336043721 1357 dbSNP
rs1380493741 1363 dbSNP
rs1384311105 1366 dbSNP
rs1315013867 1382 dbSNP
rs991221938 1385 dbSNP
rs968679730 1396 dbSNP
rs1020239492 1400 dbSNP
rs1212048581 1406 dbSNP
rs1252536023 1409 dbSNP
rs1321366156 1410 dbSNP
rs1193233574 1428 dbSNP
rs188676016 1435 dbSNP
rs956729227 1438 dbSNP
rs1157842944 1448 dbSNP
rs1164493056 1452 dbSNP
rs1473302258 1454 dbSNP
rs1458550190 1455 dbSNP
rs1323485811 1459 dbSNP
rs752374064 1461 dbSNP
rs998278057 1465 dbSNP
rs562814162 1473 dbSNP
rs1026315008 1474 dbSNP
rs544697138 1488 dbSNP
rs577126768 1498 dbSNP
rs79508429 1501 dbSNP
rs1227696653 1503 dbSNP
rs1289135137 1504 dbSNP
rs200938575 1505 dbSNP
rs571159475 1505 dbSNP
rs573609356 1509 dbSNP
rs1006105536 1512 dbSNP
rs1246869716 1517 dbSNP
rs1224295285 1521 dbSNP
rs995490447 1521 dbSNP
rs780629978 1523 dbSNP
rs1231514773 1535 dbSNP
rs888603732 1542 dbSNP
rs754458672 1545 dbSNP
rs183258784 1546 dbSNP
rs1254512763 1555 dbSNP
rs1473296115 1560 dbSNP
rs536415955 1565 dbSNP
rs575794413 1566 dbSNP
rs556738838 1571 dbSNP
rs538765371 1574 dbSNP
rs1051614094 1575 dbSNP
rs1285778456 1581 dbSNP
rs570906678 1587 dbSNP
rs1352201798 1593 dbSNP
rs1056687291 1607 dbSNP
rs1298246329 1608 dbSNP
rs1437291062 1610 dbSNP
rs937127042 1614 dbSNP
rs927008810 1621 dbSNP
rs9479835 1624 dbSNP
rs1271413452 1625 dbSNP
rs765730367 1627 dbSNP
rs1206241836 1653 dbSNP
rs1166577513 1654 dbSNP
rs1484954854 1667 dbSNP
rs1185222852 1670 dbSNP
rs1475371666 1672 dbSNP
rs192359341 1674 dbSNP
rs1183242859 1679 dbSNP
rs988759275 1686 dbSNP
rs531171800 1693 dbSNP
rs1029670883 1694 dbSNP
rs1372378366 1696 dbSNP
rs1432763018 1701 dbSNP
rs1333664140 1704 dbSNP
rs1341141847 1706 dbSNP
rs1220340885 1707 dbSNP
rs1268651653 1714 dbSNP
rs1364667718 1731 dbSNP
rs981673032 1740 dbSNP
rs951612925 1744 dbSNP
rs1300239299 1746 dbSNP
rs977133834 1750 dbSNP
rs1291750710 1751 dbSNP
rs567189630 1754 dbSNP
rs1018798994 1756 dbSNP
rs1018234641 1765 dbSNP
rs1448466879 1770 dbSNP
rs1189036018 1771 dbSNP
rs1391774169 1775 dbSNP
rs1006814206 1783 dbSNP
rs1005632558 1785 dbSNP
rs1171935212 1796 dbSNP
rs955520890 1799 dbSNP
rs548888558 1800 dbSNP
rs1316266553 1801 dbSNP
rs1388233814 1804 dbSNP
rs1446706692 1813 dbSNP
rs1030156434 1815 dbSNP
rs953027429 1825 dbSNP
rs1025734535 1828 dbSNP
rs903000925 1829 dbSNP
rs1041541923 1831 dbSNP
rs1275982454 1832 dbSNP
rs1347703089 1841 dbSNP
rs1220489150 1843 dbSNP
rs754195063 1845 dbSNP
rs1437442234 1846 dbSNP
rs1208965776 1847 dbSNP
rs764585246 1850 dbSNP
rs1333113731 1860 dbSNP
rs530573676 1862 dbSNP
rs896050026 1863 dbSNP
rs563508220 1864 dbSNP
rs866526279 1866 dbSNP
rs1156958895 1868 dbSNP
rs550789597 1870 dbSNP
rs778757251 1871 dbSNP
rs1433450447 1884 dbSNP
rs1457775810 1885 dbSNP
rs1392702533 1898 dbSNP
rs1392490303 1904 dbSNP
rs187070647 1909 dbSNP
rs1324580702 1911 dbSNP
rs1333379447 1918 dbSNP
rs1440634154 1919 dbSNP
rs1478069834 1921 dbSNP
rs905506950 1924 dbSNP
rs1045877372 1927 dbSNP
rs1353773837 1928 dbSNP
rs929714182 1930 dbSNP
rs1043236228 1935 dbSNP
rs1267762539 1936 dbSNP
rs1179247545 1949 dbSNP
rs1179931346 1962 dbSNP
rs918774090 1968 dbSNP
rs1472971656 1977 dbSNP
rs947148166 1980 dbSNP
rs1366975696 1988 dbSNP
rs1457572917 1990 dbSNP
rs1164260520 1991 dbSNP
rs1393326551 1992 dbSNP
rs565258674 1995 dbSNP
rs775869918 1996 dbSNP
rs1275134989 1997 dbSNP
rs1052899162 1998 dbSNP
rs183965456 2007 dbSNP
rs1289648646 2019 dbSNP
rs985468171 2020 dbSNP
rs372228035 2026 dbSNP
rs955536102 2028 dbSNP
rs923154015 2029 dbSNP
rs1219818470 2034 dbSNP
rs1273862957 2042 dbSNP
rs1483322122 2052 dbSNP
rs1184496860 2061 dbSNP
rs1254150569 2062 dbSNP
rs1423528497 2064 dbSNP
rs974674449 2065 dbSNP
rs1370361106 2066 dbSNP
rs1347236193 2068 dbSNP
rs573293967 2069 dbSNP
rs1432146611 2072 dbSNP
rs561517799 2077 dbSNP
rs1399437982 2085 dbSNP
rs1394887284 2086 dbSNP
rs1313014411 2091 dbSNP
rs1341851208 2092 dbSNP
rs1225948576 2093 dbSNP
rs964431757 2094 dbSNP
rs145904395 2106 dbSNP
rs765907314 2129 dbSNP
rs1207209088 2132 dbSNP
rs1413464551 2136 dbSNP
rs1482976628 2141 dbSNP
rs1201065109 2145 dbSNP
rs1258570857 2147 dbSNP
rs1258855635 2147 dbSNP
rs377231720 2147 dbSNP
rs1391158419 2149 dbSNP
rs984621159 2161 dbSNP
rs1174589920 2162 dbSNP
rs774335798 2167 dbSNP
rs1377510667 2169 dbSNP
rs1465135686 2172 dbSNP
rs1302881867 2173 dbSNP
rs1407903030 2176 dbSNP
rs1432425291 2178 dbSNP
rs966795387 2179 dbSNP
rs1365670420 2180 dbSNP
rs529017924 2189 dbSNP
rs1177438638 2203 dbSNP
rs1011380951 2204 dbSNP
rs1025788295 2205 dbSNP
rs1257812350 2206 dbSNP
rs893091808 2209 dbSNP
rs994268599 2215 dbSNP
rs560510827 2219 dbSNP
rs1036378822 2222 dbSNP
rs1466546430 2225 dbSNP
rs1156415123 2233 dbSNP
rs890968299 2241 dbSNP
rs1472087288 2243 dbSNP
rs1189802330 2245 dbSNP
rs1267317354 2247 dbSNP
rs1001237658 2249 dbSNP
rs1176226037 2251 dbSNP
rs1430778631 2258 dbSNP
rs906877746 2259 dbSNP
rs1051409957 2261 dbSNP
rs1184156893 2265 dbSNP
rs772947432 2281 dbSNP
rs1484570600 2284 dbSNP
rs755558307 2285 dbSNP
rs929719751 2287 dbSNP
rs1444166493 2288 dbSNP
rs905558318 2293 dbSNP
rs1042693841 2294 dbSNP
rs538333340 2295 dbSNP
rs747738699 2299 dbSNP
rs1227998108 2300 dbSNP
rs1269043082 2306 dbSNP
rs1330151235 2310 dbSNP
rs780824621 2320 dbSNP
rs1052953215 2321 dbSNP
rs935173593 2322 dbSNP
rs1038540596 2323 dbSNP
rs933169135 2326 dbSNP
rs1250177350 2327 dbSNP
rs941531521 2327 dbSNP
rs1471337783 2328 dbSNP
rs1231776961 2332 dbSNP
rs923096875 2336 dbSNP
rs546041506 2337 dbSNP
rs1402067078 2351 dbSNP
rs1162504100 2359 dbSNP
rs1349088788 2365 dbSNP
rs1458164456 2366 dbSNP
rs1039397458 2375 dbSNP
rs577352576 2380 dbSNP
rs1360365244 2385 dbSNP
rs934230065 2395 dbSNP
rs117598173 2396 dbSNP
rs1375874883 2398 dbSNP
rs1226817297 2408 dbSNP
rs984116287 2409 dbSNP
rs1322709236 2414 dbSNP
rs952813374 2425 dbSNP
rs1273145314 2428 dbSNP
rs967203301 2429 dbSNP
rs1203882151 2434 dbSNP
rs1251898893 2439 dbSNP
rs918702102 2440 dbSNP
rs990021469 2441 dbSNP
rs1412556384 2443 dbSNP
rs147741956 2444 dbSNP
rs1160944650 2449 dbSNP
rs1165201516 2456 dbSNP
rs566927553 2456 dbSNP
rs1429012989 2461 dbSNP
rs1308783597 2474 dbSNP
rs1356356900 2480 dbSNP
rs1412841898 2491 dbSNP
rs1001877166 2500 dbSNP
rs1182347883 2510 dbSNP
rs1248679422 2512 dbSNP
rs1295829592 2516 dbSNP
rs1035852391 2517 dbSNP
rs1206497760 2520 dbSNP
rs1275646974 2522 dbSNP
rs1439059572 2522 dbSNP
rs907080871 2524 dbSNP
rs1236573479 2537 dbSNP
rs980767731 2537 dbSNP
rs1185251839 2539 dbSNP
rs993842582 2546 dbSNP
rs1240421683 2547 dbSNP
rs1448578787 2550 dbSNP
rs1208265358 2553 dbSNP
rs555333279 2554 dbSNP
rs970295494 2555 dbSNP
rs540774137 2557 dbSNP
rs1021726525 2566 dbSNP
rs1360016635 2570 dbSNP
rs1212088478 2572 dbSNP
rs1011217102 2591 dbSNP
rs1319046448 2592 dbSNP
rs1364934289 2596 dbSNP
rs757665039 2601 dbSNP
rs754420337 2620 dbSNP
rs1272460471 2622 dbSNP
rs764497342 2631 dbSNP
rs1049895843 2632 dbSNP
rs1277274285 2633 dbSNP
rs1230512590 2634 dbSNP
rs934239061 2636 dbSNP
rs1360572181 2640 dbSNP
rs1297515792 2652 dbSNP
rs537394229 2661 dbSNP
rs1388762394 2667 dbSNP
rs756554780 2669 dbSNP
rs866157536 2671 dbSNP
rs1243816098 2680 dbSNP
rs1476988091 2682 dbSNP
rs533371962 2683 dbSNP
rs1172124084 2700 dbSNP
rs901685292 2709 dbSNP
rs1470960975 2722 dbSNP
rs1157238590 2730 dbSNP
rs1322092466 2734 dbSNP
rs1388124132 2737 dbSNP
rs1436326891 2738 dbSNP
rs1329913461 2742 dbSNP
rs564736309 2743 dbSNP
rs915357633 2745 dbSNP
rs943301136 2746 dbSNP
rs887673765 2749 dbSNP
rs113937192 2751 dbSNP
rs781027211 2751 dbSNP
rs959421617 2751 dbSNP
rs1286071626 2754 dbSNP
rs1049439762 2756 dbSNP
rs1425486985 2761 dbSNP
rs1449864897 2764 dbSNP
rs979927693 2775 dbSNP
rs1269442791 2779 dbSNP
rs867384298 2779 dbSNP
rs931339313 2790 dbSNP
rs1180063454 2800 dbSNP
rs971755849 2809 dbSNP
rs918587461 2813 dbSNP
rs1389030193 2815 dbSNP
rs1405076563 2824 dbSNP
rs972824043 2825 dbSNP
rs569749752 2829 dbSNP
rs994264682 2833 dbSNP
rs1191958507 2850 dbSNP
rs928796569 2855 dbSNP
rs551582609 2859 dbSNP
rs970727609 2860 dbSNP
rs1021906165 2870 dbSNP
rs990382398 2873 dbSNP
rs955725814 2898 dbSNP
rs1280863139 2903 dbSNP
rs1306140595 2904 dbSNP
rs1208970980 2910 dbSNP
rs1274489001 2910 dbSNP
rs1292453044 2911 dbSNP
rs1229829745 2915 dbSNP
rs1490813034 2918 dbSNP
rs767906270 2918 dbSNP
rs1251160172 2919 dbSNP
rs1365254022 2920 dbSNP
rs9478536 2923 dbSNP
rs1384704900 2924 dbSNP
rs1005276476 2929 dbSNP
rs1366553785 2930 dbSNP
rs571739084 2930 dbSNP
rs35488888 2931 dbSNP
rs1017870080 2932 dbSNP
rs1050354594 2932 dbSNP
rs1308729396 2932 dbSNP
rs66916242 2932 dbSNP
rs934166411 2934 dbSNP
rs1243853762 2936 dbSNP
rs1315451604 2937 dbSNP
rs1007423194 2944 dbSNP
rs11451881 2945 dbSNP
rs118140991 2945 dbSNP
rs1226086211 2945 dbSNP
rs536103035 2945 dbSNP
rs1368502445 2947 dbSNP
rs1042626534 2950 dbSNP
rs1167847463 2951 dbSNP
rs1184659733 2960 dbSNP
rs887591442 2964 dbSNP
rs766516180 2971 dbSNP
rs762753520 2975 dbSNP
rs1430384751 2979 dbSNP
rs1447974478 2982 dbSNP
rs1168527226 2991 dbSNP
rs1049009085 3004 dbSNP
rs945581632 3017 dbSNP
rs1171924266 3019 dbSNP
rs1462080324 3021 dbSNP
rs1299356672 3022 dbSNP
rs915264640 3041 dbSNP
rs528452642 3050 dbSNP
rs1395084350 3062 dbSNP
rs1336900887 3064 dbSNP
rs1432676158 3072 dbSNP
rs561305171 3075 dbSNP
rs185272264 3077 dbSNP
rs897167872 3078 dbSNP
rs1344662407 3084 dbSNP
rs926721699 3088 dbSNP
rs1479840219 3089 dbSNP
rs1463844444 3103 dbSNP
rs1251599228 3117 dbSNP
rs1206471870 3118 dbSNP
rs1345014422 3120 dbSNP
rs1036956081 3131 dbSNP
rs145691963 3138 dbSNP
rs1430794718 3140 dbSNP
rs1171982876 3151 dbSNP
rs971238495 3161 dbSNP
rs1230358013 3162 dbSNP
rs1176734328 3164 dbSNP
rs555834634 3170 dbSNP
rs1301483404 3171 dbSNP
rs879615218 3173 dbSNP
rs1348368348 3177 dbSNP
rs6931149 3183 dbSNP
rs1410353883 3194 dbSNP
rs1372258293 3195 dbSNP
rs1299021608 3200 dbSNP
rs1330612736 3202 dbSNP
rs948939577 3204 dbSNP
rs570755194 3205 dbSNP
rs1327305720 3210 dbSNP
rs990408627 3211 dbSNP
rs1208552082 3216 dbSNP
rs1378313562 3218 dbSNP
rs1261671352 3221 dbSNP
rs1178468303 3224 dbSNP
rs1016556033 3225 dbSNP
rs1267211368 3232 dbSNP
rs1471762633 3243 dbSNP
rs1479841643 3246 dbSNP
rs956236105 3250 dbSNP
rs1005140802 3257 dbSNP
rs1455304184 3259 dbSNP
rs1158192541 3279 dbSNP
rs924290912 3280 dbSNP
rs1455101034 3283 dbSNP
rs868496583 3288 dbSNP
rs953963321 3289 dbSNP
rs768242624 3292 dbSNP
rs1183441476 3293 dbSNP
rs1285250828 3299 dbSNP
rs975715961 3313 dbSNP
rs1348932516 3314 dbSNP
rs545548655 3337 dbSNP
rs966084609 3339 dbSNP
rs1017376041 3351 dbSNP
rs1028070053 3364 dbSNP
rs148559186 3366 dbSNP
rs1490649932 3369 dbSNP
rs1200413039 3372 dbSNP
rs951944015 3374 dbSNP
rs1027413983 3375 dbSNP
rs1176283567 3389 dbSNP
rs1408202735 3390 dbSNP
rs1420690819 3392 dbSNP
rs779381497 3403 dbSNP
rs1384590787 3413 dbSNP
rs1425212250 3441 dbSNP
rs1304804718 3449 dbSNP
rs1009826013 3453 dbSNP
rs757939054 3457 dbSNP
rs897724548 3469 dbSNP
rs1037008418 3473 dbSNP
rs1298989769 3474 dbSNP
rs552603477 3482 dbSNP
rs1227011659 3486 dbSNP
rs907180430 3487 dbSNP
rs1314778750 3491 dbSNP
rs1044525974 3493 dbSNP
rs894030165 3494 dbSNP
rs1326717109 3501 dbSNP
rs948807714 3502 dbSNP
rs914745815 3505 dbSNP
rs1053822892 3509 dbSNP
rs937993339 3516 dbSNP
rs1481399466 3528 dbSNP
rs1054604460 3549 dbSNP
rs926725529 3552 dbSNP
rs1046466041 3556 dbSNP
rs1165416076 3565 dbSNP
rs9383706 3580 dbSNP
rs924885451 3592 dbSNP
rs573293056 3596 dbSNP
rs1356555541 3599 dbSNP
rs1446086389 3604 dbSNP
rs1336248410 3609 dbSNP
rs1384005723 3613 dbSNP
rs555389688 3618 dbSNP
rs1402975413 3622 dbSNP
rs965777471 3627 dbSNP
rs910199334 3630 dbSNP
rs961284070 3633 dbSNP
rs985908580 3639 dbSNP
rs1273086102 3645 dbSNP
rs1308964267 3656 dbSNP
rs1201396003 3657 dbSNP
rs117540033 3659 dbSNP
rs1461627048 3663 dbSNP
rs1185165027 3665 dbSNP
rs1160205205 3666 dbSNP
rs1473751476 3671 dbSNP
rs1027465058 3672 dbSNP
rs953719244 3679 dbSNP
rs993264194 3681 dbSNP
rs747072018 3690 dbSNP
rs1412777137 3704 dbSNP
rs1034924731 3709 dbSNP
rs997963853 3718 dbSNP
rs1187428841 3729 dbSNP
rs569971269 3734 dbSNP
rs965462174 3735 dbSNP
rs1326420414 3740 dbSNP
rs1432109808 3749 dbSNP
rs117317412 3754 dbSNP
rs1044750986 3755 dbSNP
rs1221109632 3756 dbSNP
rs1262160294 3768 dbSNP
rs1243648669 3771 dbSNP
rs1319403600 3773 dbSNP
rs894103717 3776 dbSNP
rs1205391048 3801 dbSNP
rs1281878792 3804 dbSNP
rs1446144526 3806 dbSNP
rs1013020636 3807 dbSNP
rs893196228 3812 dbSNP
rs767744639 3823 dbSNP
rs1477100522 3836 dbSNP
rs1463169160 3845 dbSNP
rs1430309263 3859 dbSNP
rs1481535467 3860 dbSNP
rs75051818 3864 dbSNP
rs751834107 3876 dbSNP
rs1401595696 3878 dbSNP
rs1320884867 3880 dbSNP
rs1208998736 3883 dbSNP
rs1402609783 3886 dbSNP
rs1282073473 3887 dbSNP
rs1046803495 3889 dbSNP
rs1330911594 3895 dbSNP
rs949497313 3896 dbSNP
rs924769405 3897 dbSNP
rs1349718683 3901 dbSNP
rs144808792 3904 dbSNP
rs1286310851 3921 dbSNP
rs531033300 3938 dbSNP
rs1221922466 3943 dbSNP
rs149787961 3943 dbSNP
rs1490843046 3947 dbSNP
rs567529823 3950 dbSNP
rs1179948963 3952 dbSNP
rs910224509 3954 dbSNP
rs1363394711 3956 dbSNP
rs1470738452 3960 dbSNP
rs986178954 3973 dbSNP
rs139778505 3975 dbSNP
rs920375862 3985 dbSNP
rs1412336047 3994 dbSNP
rs376194895 3997 dbSNP
rs766315132 4005 dbSNP
rs763028608 4007 dbSNP
rs530826239 4012 dbSNP
rs961893412 4016 dbSNP
rs1304211662 4026 dbSNP
rs1034808627 4036 dbSNP
rs750358046 4038 dbSNP
rs1326482182 4039 dbSNP
rs1334775399 4040 dbSNP
rs969686740 4041 dbSNP
rs1281061664 4059 dbSNP
rs932537994 4066 dbSNP
rs563979395 4067 dbSNP
rs1245161234 4069 dbSNP
rs530707092 4076 dbSNP
rs1388031765 4077 dbSNP
rs545381480 4080 dbSNP
rs1321424499 4084 dbSNP
rs1250135517 4090 dbSNP
rs1438594039 4092 dbSNP
rs1184503346 4097 dbSNP
rs1459063244 4101 dbSNP
rs146051173 4106 dbSNP
rs559563099 4114 dbSNP
rs1013360972 4116 dbSNP
rs1163106039 4117 dbSNP
rs965193310 4121 dbSNP
rs1020715453 4126 dbSNP
rs893122647 4143 dbSNP
rs571126666 4144 dbSNP
rs988333439 4147 dbSNP
rs1187250999 4148 dbSNP
rs1033132722 4149 dbSNP
rs1380330043 4150 dbSNP
rs1447088626 4155 dbSNP
rs1246925170 4166 dbSNP
rs998930857 4168 dbSNP
rs1315687788 4179 dbSNP
rs1448312320 4188 dbSNP
rs79362293 4190 dbSNP
rs1340074981 4197 dbSNP
rs142779529 4202 dbSNP
rs1261442767 4205 dbSNP
rs116958296 4208 dbSNP
rs776450757 4214 dbSNP
rs897952899 4215 dbSNP
rs1050687292 4233 dbSNP
rs768518014 4235 dbSNP
rs1462003662 4236 dbSNP
rs9397715 4239 dbSNP
rs139548305 4244 dbSNP
rs1469142702 4256 dbSNP
rs369837572 4256 dbSNP
rs1384986079 4258 dbSNP
rs1380461041 4268 dbSNP
rs1437558463 4272 dbSNP
rs1294696030 4284 dbSNP
rs1329638408 4294 dbSNP
rs1327125331 4296 dbSNP
rs888292827 4300 dbSNP
rs775211838 4303 dbSNP
rs1323063890 4311 dbSNP
rs568498185 4313 dbSNP
rs1265382789 4319 dbSNP
rs1485060730 4324 dbSNP
rs539782644 4327 dbSNP
rs1262987385 4331 dbSNP
rs1428631474 4353 dbSNP
rs932593737 4365 dbSNP
rs1479901983 4369 dbSNP
rs1176619765 4372 dbSNP
rs367682139 4377 dbSNP
rs1451296108 4378 dbSNP
rs1288248388 4379 dbSNP
rs921172904 4386 dbSNP
rs940411504 4393 dbSNP
rs976485808 4398 dbSNP
rs868636311 4400 dbSNP
rs1281441960 4405 dbSNP
rs943685729 4416 dbSNP
rs529670711 4417 dbSNP
rs1285370378 4423 dbSNP
rs982324590 4429 dbSNP
rs1315532950 4430 dbSNP
rs1238737719 4435 dbSNP
rs1261871979 4447 dbSNP
rs1487127268 4450 dbSNP
rs146265263 4452 dbSNP
rs1429619053 4465 dbSNP
rs1266153027 4466 dbSNP
rs987904669 4467 dbSNP
rs1199722776 4478 dbSNP
rs554036448 4479 dbSNP
rs1158076561 4481 dbSNP
rs1023996202 4483 dbSNP
rs989409077 4504 dbSNP
rs1301145114 4506 dbSNP
rs1365054088 4512 dbSNP
rs957391149 4518 dbSNP
rs535105675 4520 dbSNP
rs1244676712 4522 dbSNP
rs981311810 4530 dbSNP
rs567715011 4531 dbSNP
rs1319326378 4542 dbSNP
rs903247497 4543 dbSNP
rs549004043 4544 dbSNP
rs1291571927 4546 dbSNP
rs1358247550 4548 dbSNP
rs181422335 4563 dbSNP
rs1247897075 4574 dbSNP
rs1270722315 4582 dbSNP
rs1013610144 4585 dbSNP
rs1251146167 4595 dbSNP
rs1441529044 4598 dbSNP
rs528884985 4602 dbSNP
rs1384420076 4609 dbSNP
rs1014848904 4610 dbSNP
rs1341293741 4616 dbSNP
rs1275261436 4618 dbSNP
rs1009510291 4623 dbSNP
rs207467534 4634 dbSNP
rs889273954 4643 dbSNP
rs1441563811 4654 dbSNP
rs887829410 4660 dbSNP
rs1051157940 4664 dbSNP
rs1451148632 4668 dbSNP
rs1314749357 4669 dbSNP
rs188484312 4675 dbSNP
rs569959794 4676 dbSNP
rs1291584085 4678 dbSNP
rs1305473787 4685 dbSNP
rs3822927 4687 dbSNP
rs1306497489 4697 dbSNP
rs940457479 4713 dbSNP
rs927731505 4714 dbSNP
rs1310371750 4717 dbSNP
rs1459008455 4717 dbSNP
rs1181706497 4719 dbSNP
rs1242248741 4721 dbSNP
rs1411198821 4725 dbSNP
rs1183452854 4726 dbSNP
rs899772776 4727 dbSNP
rs1041349023 4728 dbSNP
rs1171190258 4730 dbSNP
rs533493977 4750 dbSNP
rs1422402522 4752 dbSNP
rs1171665621 4755 dbSNP
rs3734274 4758 dbSNP
rs1407213678 4759 dbSNP
rs3734275 4762 dbSNP
rs916407167 4765 dbSNP
rs529482270 4775 dbSNP
rs1359399218 4778 dbSNP
rs989401895 4786 dbSNP
rs1278230315 4788 dbSNP
rs936411921 4800 dbSNP
rs1201622430 4810 dbSNP
rs1179834816 4812 dbSNP
rs1461760265 4814 dbSNP
rs1482599665 4817 dbSNP
rs1240183791 4818 dbSNP
rs561796153 4824 dbSNP
rs925014846 4842 dbSNP
rs1425794818 4844 dbSNP
rs1479500305 4849 dbSNP
rs1175876063 4852 dbSNP
rs981004399 4854 dbSNP
rs1416699147 4857 dbSNP
rs957898674 4860 dbSNP
rs1345002063 4861 dbSNP
rs1206502568 4862 dbSNP
rs918205121 4863 dbSNP
rs1440801625 4874 dbSNP
rs1342066829 4877 dbSNP
rs186996501 4878 dbSNP
rs992834346 4882 dbSNP
rs3734276 4887 dbSNP
rs544902912 4888 dbSNP
rs1325844439 4901 dbSNP
rs1014886403 4906 dbSNP
rs563970807 4908 dbSNP
rs1006169815 4911 dbSNP
rs952169280 4915 dbSNP
rs977393173 4917 dbSNP
rs967392791 4925 dbSNP
rs1351459975 4928 dbSNP
rs1157359125 4940 dbSNP
rs1407635950 4951 dbSNP
rs1401651618 4953 dbSNP
rs1019473310 4955 dbSNP
rs1008981550 4956 dbSNP
rs1402764383 4966 dbSNP
rs996719491 4970 dbSNP
rs1331203944 4974 dbSNP
rs71573681 4980 dbSNP
rs953708413 4984 dbSNP
rs1277708578 4997 dbSNP
rs1349951877 5003 dbSNP
rs1029128783 5007 dbSNP
rs1240584924 5012 dbSNP
rs751669206 5013 dbSNP
rs1357510230 5018 dbSNP
rs1356949171 5021 dbSNP
rs1268082744 5022 dbSNP
rs1453410736 5025 dbSNP
rs1332860660 5031 dbSNP
rs1040858121 5035 dbSNP
rs531270238 5039 dbSNP
rs562057180 5040 dbSNP
rs1004527071 5053 dbSNP
rs906196193 5056 dbSNP
rs1472166352 5071 dbSNP
rs758461378 5078 dbSNP
rs1052136560 5079 dbSNP
rs1412387200 5080 dbSNP
rs947794560 5090 dbSNP
rs750551768 5111 dbSNP
rs546096714 5112 dbSNP
rs1045203571 5113 dbSNP
rs1245442396 5114 dbSNP
rs1266264134 5123 dbSNP
rs1358813788 5139 dbSNP
rs1194132852 5140 dbSNP
rs572402870 5142 dbSNP
rs947802236 5149 dbSNP
rs181511639 5151 dbSNP
rs1181079722 5154 dbSNP
rs751129329 5155 dbSNP
rs1241624418 5166 dbSNP
rs73790958 5167 dbSNP
rs190165737 5174 dbSNP
rs141385621 5179 dbSNP
rs1266522049 5185 dbSNP
rs1473602848 5187 dbSNP
rs967823393 5188 dbSNP
rs753827583 5189 dbSNP
rs911890449 5201 dbSNP
rs1395181181 5206 dbSNP
rs1466029469 5215 dbSNP
rs148243480 5216 dbSNP
rs1333295292 5240 dbSNP
rs987969492 5244 dbSNP
rs759920860 5256 dbSNP
rs953449666 5259 dbSNP
rs1403538683 5271 dbSNP
rs984779079 5278 dbSNP
rs1313229147 5279 dbSNP
rs1342458437 5288 dbSNP
rs1330276754 5291 dbSNP
rs1309535439 5298 dbSNP
rs1029136378 5301 dbSNP
rs1379168286 5302 dbSNP
rs570031517 5308 dbSNP
rs963494628 5311 dbSNP
rs1015168006 5314 dbSNP
rs1461311130 5327 dbSNP
rs952032659 5329 dbSNP
rs1384327430 5333 dbSNP
rs1005082063 5335 dbSNP
rs1318167184 5347 dbSNP
rs906197372 5355 dbSNP
rs763728759 5356 dbSNP
rs1190602694 5362 dbSNP
rs1046023242 5376 dbSNP
rs1477862095 5381 dbSNP
rs371983588 5386 dbSNP
rs1012425632 5404 dbSNP
rs1403386711 5405 dbSNP
rs1413050084 5409 dbSNP
rs1028963537 5411 dbSNP
rs1303175060 5414 dbSNP
rs551391253 5420 dbSNP
rs539730462 5423 dbSNP
rs1053523046 5427 dbSNP
rs966113389 5433 dbSNP
rs1341435308 5434 dbSNP
rs1220529285 5450 dbSNP
rs1019876409 5454 dbSNP
rs1281508319 5454 dbSNP
rs566001845 5454 dbSNP
rs1258082815 5455 dbSNP
rs7754055 5459 dbSNP
rs1202928641 5461 dbSNP
rs1246218624 5462 dbSNP
rs892429444 5463 dbSNP
rs185701476 5466 dbSNP
rs1465464166 5467 dbSNP
rs1195177303 5469 dbSNP
rs1262713633 5480 dbSNP
rs562181830 5496 dbSNP
rs903530699 5498 dbSNP
rs549842705 5501 dbSNP
rs1042362741 5506 dbSNP
rs1176726217 5509 dbSNP
rs1219903078 5511 dbSNP
rs1451356532 5518 dbSNP
rs1157888999 5520 dbSNP
rs1361387008 5524 dbSNP
rs1301325549 5525 dbSNP
rs1367022752 5542 dbSNP
rs1044712984 5545 dbSNP
rs947798877 5546 dbSNP
rs1315726470 5565 dbSNP
rs896228995 5568 dbSNP
rs1287242511 5577 dbSNP
rs1353929314 5578 dbSNP
rs1056596732 5580 dbSNP
rs908161714 5581 dbSNP
rs1291276532 5582 dbSNP
rs943937535 5583 dbSNP
rs911883715 5584 dbSNP
rs771896331 5592 dbSNP
rs931962202 5595 dbSNP
rs930885539 5598 dbSNP
rs1421699730 5602 dbSNP
rs921928392 5608 dbSNP
rs1349300654 5614 dbSNP
rs974734906 5616 dbSNP
rs922043856 5620 dbSNP
rs966562920 5621 dbSNP
rs1371778505 5622 dbSNP
rs76723968 5623 dbSNP
rs1477605828 5627 dbSNP
rs879867369 5628 dbSNP
rs956515111 5644 dbSNP
rs986658002 5644 dbSNP
rs1320805743 5653 dbSNP
rs1221635173 5654 dbSNP
rs564054170 5665 dbSNP
rs1197955748 5669 dbSNP
rs1434090131 5671 dbSNP
rs903729784 5673 dbSNP
rs1441315671 5681 dbSNP
rs369083031 5688 dbSNP
rs1413325696 5689 dbSNP
rs1165432024 5690 dbSNP
rs970978522 5692 dbSNP
rs1166956051 5694 dbSNP
rs1352862441 5703 dbSNP
rs1465514404 5704 dbSNP
rs773954152 5705 dbSNP
rs1332640335 5708 dbSNP
rs9371341 5710 dbSNP
rs1388409182 5713 dbSNP
rs1168120064 5718 dbSNP
rs1377951152 5722 dbSNP
rs748611111 5727 dbSNP
rs1228562256 5728 dbSNP
rs149477027 5733 dbSNP
rs1315546803 5739 dbSNP
rs1264190461 5749 dbSNP
rs557567231 5762 dbSNP
rs541768685 5764 dbSNP
rs537739260 5781 dbSNP
rs1247606922 5782 dbSNP
rs1483675235 5786 dbSNP
rs1225386044 5789 dbSNP
rs574565475 5800 dbSNP
rs575192610 5806 dbSNP
rs1049177210 5812 dbSNP
rs1171548240 5813 dbSNP
rs1307540354 5822 dbSNP
rs1468741022 5825 dbSNP
rs1297322663 5830 dbSNP
rs930896629 5833 dbSNP
rs902356990 5837 dbSNP
rs1448226551 5839 dbSNP
rs1304231514 5840 dbSNP
rs1338048442 5843 dbSNP
rs922202328 5845 dbSNP
rs1278330093 5872 dbSNP
rs1366669425 5883 dbSNP
rs1042207012 5892 dbSNP
rs557192151 5893 dbSNP
rs774371740 5893 dbSNP
rs1312565786 5896 dbSNP
rs1240562623 5901 dbSNP
rs1488114659 5910 dbSNP
rs1406545136 5916 dbSNP
rs943971348 5917 dbSNP
rs1307315681 5925 dbSNP
rs6917661 5931 dbSNP
rs1426231289 5938 dbSNP
rs912010056 5942 dbSNP
rs535395402 5943 dbSNP
rs1358204695 5945 dbSNP
rs932040335 5960 dbSNP
rs1174250904 5962 dbSNP
rs921927802 5963 dbSNP
rs973465923 5965 dbSNP
rs923772422 5968 dbSNP
rs1274182852 5971 dbSNP
rs1368294934 5972 dbSNP
rs1220718079 5973 dbSNP
rs1202127937 5983 dbSNP
rs114278254 5985 dbSNP
rs908066663 5986 dbSNP
rs566366156 5991 dbSNP
rs557847445 5996 dbSNP
rs1217652259 6002 dbSNP
rs1288180533 6003 dbSNP
rs138031066 6004 dbSNP
rs546651514 6010 dbSNP
rs757332434 6011 dbSNP
rs991478898 6013 dbSNP
rs1175814026 6014 dbSNP
rs1380107651 6016 dbSNP
rs1012353676 6028 dbSNP
rs1158881665 6039 dbSNP
rs959063349 6039 dbSNP
rs1403087324 6041 dbSNP
rs1252501978 6048 dbSNP
rs539573808 6049 dbSNP
rs1311179670 6060 dbSNP
rs1000620716 6072 dbSNP
rs192463895 6073 dbSNP
rs1375893517 6076 dbSNP
rs1241056664 6082 dbSNP
rs1225171795 6086 dbSNP
rs188344146 6087 dbSNP
rs1287683261 6093 dbSNP
rs571045167 6097 dbSNP
rs1398743672 6099 dbSNP
rs1453791009 6100 dbSNP
rs535816316 6103 dbSNP
rs1301097330 6111 dbSNP
rs886152718 6112 dbSNP
rs1237886495 6119 dbSNP
rs1440698216 6121 dbSNP
rs1407187458 6124 dbSNP
rs755841453 6130 dbSNP
rs752573858 6134 dbSNP
rs1471629354 6140 dbSNP
rs6911606 6165 dbSNP
rs1411634290 6166 dbSNP
rs146967060 6171 dbSNP
rs1421333682 6177 dbSNP
rs1399543609 6178 dbSNP
rs1447228009 6180 dbSNP
rs997131606 6189 dbSNP
rs1333177435 6192 dbSNP
rs531947837 6202 dbSNP
rs944926229 6210 dbSNP
rs911915813 6212 dbSNP
rs570532655 6222 dbSNP
rs1358570415 6226 dbSNP
rs1216953019 6237 dbSNP
rs934741268 6241 dbSNP
rs1458647091 6242 dbSNP
rs942130627 6251 dbSNP
rs979698413 6255 dbSNP
rs1440293328 6270 dbSNP
rs183470045 6287 dbSNP
rs1368470955 6295 dbSNP
rs1475899259 6297 dbSNP
rs1167988527 6299 dbSNP
rs1205134240 6300 dbSNP
rs527242502 6308 dbSNP
rs1466110729 6309 dbSNP
rs1333068394 6315 dbSNP
rs1048261558 6317 dbSNP
rs1326844236 6320 dbSNP
rs1267198326 6321 dbSNP
rs1395609233 6324 dbSNP
rs949619658 6325 dbSNP
rs916369795 6327 dbSNP
rs918072928 6329 dbSNP
rs1398209292 6330 dbSNP
rs990768327 6334 dbSNP
rs1337537531 6339 dbSNP
rs774164202 6342 dbSNP
rs765924997 6345 dbSNP
rs1221029096 6358 dbSNP
rs1254573211 6359 dbSNP
rs1383573044 6363 dbSNP
rs1338979001 6364 dbSNP
rs560232209 6364 dbSNP
rs924960818 6367 dbSNP
rs1201450167 6370 dbSNP
rs979063214 6372 dbSNP
rs1256404104 6383 dbSNP
rs1455795108 6384 dbSNP
rs1388379686 6393 dbSNP
rs960571230 6395 dbSNP
rs745741126 6400 dbSNP
rs1261871123 6402 dbSNP
rs1159437564 6404 dbSNP
rs1478077306 6406 dbSNP
rs1172459251 6411 dbSNP
rs1375927898 6413 dbSNP
rs1465350492 6414 dbSNP
rs1172999052 6419 dbSNP
rs1455665647 6429 dbSNP
rs1169818216 6433 dbSNP
rs966354241 6446 dbSNP
rs1020741023 6452 dbSNP
rs1377476166 6456 dbSNP
rs1008384771 6458 dbSNP
rs1297605196 6465 dbSNP
rs1341225543 6471 dbSNP
rs1402328737 6483 dbSNP
rs1299812981 6484 dbSNP
rs1331092299 6488 dbSNP
rs780783001 6491 dbSNP
rs6912303 6494 dbSNP
rs529974679 6496 dbSNP
rs1243167403 6501 dbSNP
rs950512999 6512 dbSNP
rs1187825042 6513 dbSNP
rs1265160754 6514 dbSNP
rs898386670 6534 dbSNP
rs776993040 6537 dbSNP
rs1247028899 6538 dbSNP
rs1396685491 6543 dbSNP
rs1205559380 6550 dbSNP
rs1158280929 6559 dbSNP
rs1361489459 6575 dbSNP
rs368645152 6576 dbSNP
rs1263651879 6582 dbSNP
rs995444052 6590 dbSNP
rs1243924215 6591 dbSNP
rs1390607918 6594 dbSNP
rs769257749 6595 dbSNP
rs1387892157 6597 dbSNP
rs1006204158 6600 dbSNP
rs1360282157 6603 dbSNP
rs886438356 6606 dbSNP
rs562688755 6613 dbSNP
rs1047845201 6615 dbSNP
rs191726099 6622 dbSNP
rs747306172 6628 dbSNP
rs918095361 6634 dbSNP
rs187845506 6644 dbSNP
rs576653055 6645 dbSNP
rs374104586 6649 dbSNP
rs545930570 6651 dbSNP
rs78031426 6655 dbSNP
rs185374021 6656 dbSNP
rs1381124393 6667 dbSNP
rs986569376 6681 dbSNP
rs1162717647 6682 dbSNP
rs926055459 6687 dbSNP
rs1458813651 6689 dbSNP
rs1163217409 6697 dbSNP
rs568625231 6701 dbSNP
rs76537774 6711 dbSNP
rs777553572 6721 dbSNP
rs548618847 6728 dbSNP
rs948790791 6731 dbSNP
rs1225139275 6734 dbSNP
rs1309893175 6735 dbSNP
rs528460481 6736 dbSNP
rs779172169 6737 dbSNP
rs538007696 6738 dbSNP
rs1456423960 6743 dbSNP
rs991025846 6746 dbSNP
rs192957531 6749 dbSNP
rs1193410916 6751 dbSNP
rs1424468566 6768 dbSNP
rs75147750 6771 dbSNP
rs1465591381 6781 dbSNP
rs749432431 6791 dbSNP
rs886452226 6792 dbSNP
rs1264941030 6793 dbSNP
rs1026696108 6796 dbSNP
rs777538005 6797 dbSNP
rs1013690154 6801 dbSNP
rs1490472643 6811 dbSNP
rs896533911 6817 dbSNP
rs950376617 6818 dbSNP
rs754224260 6820 dbSNP
rs1294637083 6826 dbSNP
rs188596527 6835 dbSNP
rs938184820 6836 dbSNP
rs973197410 6844 dbSNP
rs1273376044 6846 dbSNP
rs1329869754 6851 dbSNP
rs964777868 6855 dbSNP
rs904013972 6861 dbSNP
rs1237103564 6869 dbSNP
rs1009472507 6886 dbSNP
rs1190108301 6892 dbSNP
rs1261153829 6898 dbSNP
rs1477747495 6904 dbSNP
rs1044008811 6905 dbSNP
rs183536068 6910 dbSNP
rs913586440 6912 dbSNP
rs1413112303 6916 dbSNP
rs890750630 6917 dbSNP
rs7772882 6918 dbSNP
rs933655902 6919 dbSNP
rs114992395 6925 dbSNP
rs1323230297 6926 dbSNP
rs1337788557 6926 dbSNP
rs975132086 6926 dbSNP
rs1270692843 6927 dbSNP
rs1364061378 6927 dbSNP
rs751256232 6931 dbSNP
rs570793960 6936 dbSNP
rs766195020 6938 dbSNP
rs982667727 6943 dbSNP
rs1277695399 6949 dbSNP
rs1368073007 6952 dbSNP
rs1348811779 6957 dbSNP
rs369922084 6963 dbSNP
rs1026327171 6967 dbSNP
rs1488003471 6975 dbSNP
rs529710611 6976 dbSNP
rs6557350 6983 dbSNP
rs1418115648 6985 dbSNP
rs948838284 6987 dbSNP
rs6905966 6991 dbSNP
rs1418545838 7001 dbSNP
rs1375722727 7009 dbSNP
rs74477116 7013 dbSNP
rs1002253845 7016 dbSNP
rs927917419 7017 dbSNP
rs1371466112 7020 dbSNP
rs1236311176 7030 dbSNP
rs369230998 7036 dbSNP
rs1307336067 7044 dbSNP
rs1202894558 7048 dbSNP
rs1353325284 7049 dbSNP
rs1205760384 7059 dbSNP
rs904025375 7060 dbSNP
rs1221490453 7063 dbSNP
rs1273736191 7071 dbSNP
rs564782133 7073 dbSNP
rs1177222862 7077 dbSNP
rs761195846 7090 dbSNP
rs1438736452 7091 dbSNP
rs141102371 7095 dbSNP
rs920278071 7097 dbSNP
rs892737080 7098 dbSNP
rs1274474598 7105 dbSNP
rs1051333704 7108 dbSNP
rs964527821 7121 dbSNP
rs1442803594 7126 dbSNP
rs1329100483 7130 dbSNP
rs1376382684 7131 dbSNP
rs537262637 7136 dbSNP
rs1281293494 7146 dbSNP
rs775980682 7158 dbSNP
rs1347738493 7177 dbSNP
rs920923347 7185 dbSNP
rs1287035181 7195 dbSNP
rs975141940 7202 dbSNP
rs1274340245 7205 dbSNP
rs1337644758 7210 dbSNP
rs1353427258 7214 dbSNP
rs572238417 7215 dbSNP
rs1436808740 7229 dbSNP
rs909738939 7243 dbSNP
rs982551400 7246 dbSNP
rs1234321315 7249 dbSNP
rs1031818468 7254 dbSNP
rs1399685107 7255 dbSNP
rs947433193 7257 dbSNP
rs1470155993 7260 dbSNP
rs999109533 7262 dbSNP
rs1418449452 7272 dbSNP
rs1431096603 7274 dbSNP
rs1315667284 7275 dbSNP
rs1399289041 7275 dbSNP
rs1462979939 7275 dbSNP
rs746545116 7275 dbSNP
rs1331121940 7276 dbSNP
rs1338984704 7279 dbSNP
rs73009460 7280 dbSNP
rs1294024075 7288 dbSNP
rs1217352779 7289 dbSNP
rs1257752828 7297 dbSNP
rs1340494360 7298 dbSNP
rs951233110 7298 dbSNP
rs1197990101 7299 dbSNP
rs768865150 7303 dbSNP
rs1440379963 7314 dbSNP
rs1186558683 7316 dbSNP
rs1021660049 7317 dbSNP
rs1024666706 7321 dbSNP
rs992757166 7322 dbSNP
rs1233381847 7327 dbSNP
rs960997953 7331 dbSNP
rs752036890 7334 dbSNP
rs1002307666 7335 dbSNP
rs1169477896 7338 dbSNP
rs541828242 7342 dbSNP
rs1262795885 7343 dbSNP
rs147112108 7344 dbSNP
rs1357453980 7348 dbSNP
rs1057460030 7351 dbSNP
rs1010170843 7353 dbSNP
rs1327583125 7356 dbSNP
rs556539086 7364 dbSNP
rs892631777 7365 dbSNP
rs1266562130 7367 dbSNP
rs1051819560 7375 dbSNP
rs1273477404 7385 dbSNP
rs998415380 7411 dbSNP
rs1342381181 7413 dbSNP
rs1223714958 7418 dbSNP
rs1280331232 7419 dbSNP
rs899513954 7424 dbSNP
rs1213893833 7454 dbSNP
rs906395967 7455 dbSNP
rs746288030 7460 dbSNP
rs140612084 7466 dbSNP
rs577510323 7467 dbSNP
rs1443799906 7474 dbSNP
rs6906365 7475 dbSNP
rs920501262 7480 dbSNP
rs868625007 7482 dbSNP
rs929838735 7483 dbSNP
rs533858414 7485 dbSNP
rs1469948309 7492 dbSNP
rs1299569064 7497 dbSNP
rs771221290 7498 dbSNP
rs910190273 7503 dbSNP
rs958588043 7508 dbSNP
rs926623040 7512 dbSNP
rs980794384 7513 dbSNP
rs1160196208 7514 dbSNP
rs954404743 7520 dbSNP
rs924779413 7521 dbSNP
rs968020001 7528 dbSNP
rs1022426229 7529 dbSNP
rs1194083063 7534 dbSNP
rs1242557436 7535 dbSNP
rs1438104317 7540 dbSNP
rs1184455304 7542 dbSNP
rs1462771369 7546 dbSNP
rs1009644719 7547 dbSNP
rs1215588575 7551 dbSNP
rs957102231 7552 dbSNP
rs1029792716 7558 dbSNP
rs1012950403 7560 dbSNP
rs78587823 7563 dbSNP
rs1227059113 7564 dbSNP
rs1372671545 7570 dbSNP
rs1356666190 7580 dbSNP
rs548289959 7582 dbSNP
rs900067277 7589 dbSNP
rs1305598731 7594 dbSNP
rs1316984744 7596 dbSNP
rs547988012 7605 dbSNP
rs1452728104 7618 dbSNP
rs1039920849 7620