miRTarBase - #MIRT560855 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OSBPL3   
Synonyms ORP-3, ORP3, OSBP3
Description oxysterol binding protein like 3
Transcript NM_015550   
Other Transcripts NM_145320 , NM_145321 , NM_145322   
Expression
Putative miRNA Targets on OSBPL3
3'UTR of OSBPL3
(miRNA target sites are highlighted)
>OSBPL3|NM_015550|3'UTR
   1 AAAAGTAAAGAAGAAAGATAACATTAGTGTATTTCTCCTGTGCTTGCCTTCTGAAGTGGCACAAACCTGTGTTTATATAT
  81 TTAAAAGATACTCTAGGATGATCACTTGTGCTTAGCTTAGCATTGTAACTCTTTAAGTCTATATTTTCCTCAGTGCGTTT
 161 CTTTACAATTTCAAATGTTACCCTGATTGTTTATATGAATGTAGAACACCTTGACATTTCTTTTTATATATAAACTATTT
 241 AATAAAAATGAAAGATTGAATGTTCATGTGTGGGTTAAAAAAAGAAGCTTTAACACTAATTTTCCAAAGGTTAGGGAAGA
 321 TTCCAATTAAATTTATGCCTTATAAAATTATGTTGTAGAAAAAAAATCAACCTCTCCCAGGTGCATTAAGAAATAAGAAT
 401 TCCCAGGGTTACTCACCCATGCGTAAGCTACCCAAGTTTAATTTGGTAGCTGAAATATCTTTTTGCCTCAGACAGCTCTT
 481 GAATTGCTCATACAGAACAATTCTGCTGGTGCTGGAGTCTGAAGAATATTTTCATTTGCATTTTAGTGGTTAGGGAGAGG
 561 ATATAAGATTAATGGAATGTATATTTTTATATAAGACGTATACGGCACCTTCTTGAAAAGGAAGCATTTGAACTTGTTCC
 641 TCCCTATAGTTCTATTGCCTTATATGCAAAATTGTACCCTGTTGCTCAGAGAAATTATTCATAAGAGAAAAGAATTCCAA
 721 TTAATTAAATATCACAATAGCATCCCAGAGAGACAGTAGGAAATTTCTCCTTAGTGAGAGCTGAGTCCTTGAGAAGTTAA
 801 GAGACTGTTTCCTGCTTCCCACCCCACCCCGTTTTTTGTCCCTCCGTTTGATCACCTCCCTGTTGAGTATGGAATGTCCC
 881 AGTTTAATATAAAACATACAGTTTATTCCACACAGCAGTTTGACTTTGTAAAAGTTTAGCAAAATAACTGATTGTTTTGG
 961 ATAACTCAACATGTTTTTCTTAAATGCTGTTTTAGTATTTTCTACCTCTTAATAAGCACCATATTTTAGATCTTGTATAA
1041 AAAGTTGCCATCTGCCTTATAGACAAATGTAGAGAATTGATGTTCTTGCTTTGTGTTGTGTTCTGGTAAAGCTTTAAGTG
1121 AGTGTCTTACCCCTTTCCTATACTTTCTTGTTATCCATATCATTCTTTTGTGAGTTTTGCAGCAGTCTTGAATAATACAG
1201 ATTATAACTACTGAAAGGGGAACCTTCGTCTTTTTAAATGTGTTATTTCACATTACAATAATATGTGTAGTAGTTGAATT
1281 GTGTTATCAAAGCATGTCCAACTTCTGTCCAGATGACATTAAAACCAAAGCCTAATTGTTAAGCCTCTTATTCTAAAGTC
1361 CATAGCAATGCTATGGAATATCAAGTATAATGATGTAGTAAAAAGATTTCTCCAGAAAACACTTTGAGATACTTAAAGAA
1441 ATTCAGAGCATATCGAATGTTATGAATGAAGAGTAAAATAATTACAGGAAAAGAATGCATGATTTTTCATTGTCACACCA
1521 AATAACCAGTTGGACAATATTGCATTTTCAAAATGGAGAGTTATTTAAAGTGGATGTGTAGCCTTCTGGAATCTGCACGT
1601 GACTGGCATTTTAAAACAACTCATTAAATATTGGATTCATTTTATCGAGATGCCAAGATGAACACAATGTGAATATCATT
1681 TCCATTTCTAAGCAGTTGAATGACACAGTCAGATTCTTTGGTGTATGCTTTGTTCTTTCCATCTCAAGCATTTATCCAAA
1761 TTCTGCTCACAGACATGAGGAAGCAGGCTGTAGATTTAAGGGCACTCAAGGGGAAAACAAATGTAGTTTCCACAGTGTGA
1841 GGATAAATGTAGAATCGTGGTAATATTGGCTGTTAAATTGGCCTGCTCCAGAGACTGGCTCAAAAAAGAAAGAAGCAACG
1921 AAAACAAAATGCACAGCCTGAATGGACGTAGCACTGTCATGTGGCATTTGGAAAATCTTTAATTATCCTAATGTTATTTC
2001 ACTTGCCCTTATGCTTTATTTTAGAGTCCCAGGGACAACTGGATGAAACATTACGTCTGTAGTCATCTTATTTGAGATGG
2081 GGGTGGGAACGAATTAAAATATGATAGAGAACTATATGCAGATTTTAAAATCTAGTCAGTACTAGCATCTATAAAGGGCT
2161 TTTCTGAAATTTAAACAGCTTGGTGATGCATCCTGATATTATAAGCTTAAAACTATCTTGAGGGGGAAATGACTTCTTTT
2241 CTCCTTCTGTCCCTTTTCTCAAAAGCATCTTTCCCCCAAATGTATGTCTCTAGGACATTTTATAGTTTTAAGAGGAAGAA
2321 AACAGAAACGTGGCATCATTTGGGAAGAACCAAGGTAGAATTTAATTTTCTGGACTTTAAATCTCCTGGTTAAATAATGC
2401 TAATCACTGTACCATTTGAGTTACATGTTTTAACCTCTTTTTTTTTTCTAATTATTCCATCCAAAATTTCTGGTGAATTA
2481 CACAGAAATTTTTGGAAATGGGACTTTGTGCAGGTAACCACCCTGCACTTCAGGTAATGTTCCTGTCACAGCTGTCGACT
2561 ACCCCACGCTGCAGGAAATCCATTCAGAAATGAGCTAACAGTCTCCAGTGTAGCAGGAGAGCCAGTCACTTCCCTCCCCA
2641 GGCCCCAAAGCACCCCAAGGCTGGTATTCCTTGAGTCATAGGTATTAATAATAAAAGCCTCAATGCAGCTTCTCCATGTA
2721 GTTCCTCTCCTACAAGCCAGGTGGATTCTGGTCCTAACTAAAGAGATGGGAGTTCACCTGAGGGCAAGAAGTACCCAGGA
2801 TGCCCAAACAGCCGCACAGGTGTCCTGTGCTTCCTGTGAGACTTCCTGGGGGAAATATACAAACTAATATATTTTTTAAT
2881 GTTTACGTCATTTACACTGCTGCTTTTCTCATATTCTGCTTTTAATTACTTGTAGTAAATCATTTGTTTGGGCTTCAAGC
2961 ACTGTCTTCCATCTGCATCTTCCAGATTTATCATGAGTGATCTTGTTCTACTGTTAAAGATGTCAAGCCTAAAAAGTAAT
3041 AAAGTTTTTATTTGGCTGTTGAACCTTGATGTAGCCCCTACTACATACACTACAAGTTATGCCTTCTGGCTACTACAGAA
3121 TCTCCGCAGACCTTTTAGTTATGAGTAGAAGCAATAAGAAGGTGTCCTTATGGTCTTAGGAATAATAGTTCCAATGTATT
3201 GGCATAATTTGTTTGAATGTCTTTATTTTGATATTAACACCGGCATAAATCTATTTTTGCTACCAGATGATAGCTATTTT
3281 CATTTGCTCTATTTTCCTCTGCATTGTACTAATCTGTTACTCAGTGTTAGTCTTCATTTTTCTGTGTTGGAAACCTGCGT
3361 CATGTAAATATCTGCAAATCATGACAGTCTAAAGTGCAAACCATTTTCAGAGACTTTGGGGAATGCAGTGATCAGAAGTG
3441 GCTAATTTATTTTATTTCTGATTATTTTATCCAGAGGGTACTTTTTTAATGGATATTTGTAAATCTTCCACTTAACCACT
3521 GAAAATTATTTTGTTTTAATCCCACCCTTCCATCCATACCTCTGCCTCCCCAAAAAGCTCCTATTAATTTGCTTATCCCC
3601 CTCATGTAGCTAGTTGAATGTGAATAAATAACATGGAAAAAAAGGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGU-AAU-ACACGACGAu 5'
            :| ::|| |||   ||||||| 
Target 5' ttTACGTCATTTACACTGCTGCTt 3'
2882 - 2905 148.00 -13.00
2
miRNA  3' guGUUUGGUAAUA---CACGACGAu 5'
            ||||  |||:|    ||:|||| 
Target 5' tgCAAA--ATTGTACCCTGTTGCTc 3'
665 - 687 140.00 -7.63
3
miRNA  3' guGU-UUGGUAAUAC-ACGACGAu 5'
            || ||| ||| || || |||| 
Target 5' taCAGAACAATTCTGCTGGTGCTg 3'
491 - 514 136.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19731603 4 COSMIC
COSN30145100 6 COSMIC
COSN30514993 13 COSMIC
COSN31525220 17 COSMIC
COSN30158732 29 COSMIC
COSN30539463 36 COSMIC
COSN15664246 42 COSMIC
COSN30112067 46 COSMIC
COSN26556289 51 COSMIC
COSN9940097 52 COSMIC
COSN30162993 66 COSMIC
COSN18732214 90 COSMIC
COSN31520994 224 COSMIC
COSN31608304 330 COSMIC
COSN9983334 505 COSMIC
COSN32064784 677 COSMIC
COSN15903953 960 COSMIC
COSN31527509 1021 COSMIC
COSN30538248 1048 COSMIC
COSN31555636 1093 COSMIC
COSN32065046 1198 COSMIC
COSN31582636 1202 COSMIC
COSN31549534 1204 COSMIC
COSN31608306 1407 COSMIC
COSN30538315 1468 COSMIC
COSN7975553 1482 COSMIC
COSN30014460 1668 COSMIC
COSN30258449 2333 COSMIC
COSN27483342 2437 COSMIC
COSN2216932 2596 COSMIC
COSN21952647 2653 COSMIC
COSN16309988 2912 COSMIC
COSN17872028 3637 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1056958740 5 dbSNP
rs757228117 6 dbSNP
rs752111860 10 dbSNP
rs1433801418 11 dbSNP
rs999217782 12 dbSNP
rs764695475 18 dbSNP
rs375794053 21 dbSNP
rs775963819 22 dbSNP
rs765655842 27 dbSNP
rs1463795193 28 dbSNP
rs144498124 29 dbSNP
rs1168187354 40 dbSNP
rs1454805417 42 dbSNP
rs1254936557 46 dbSNP
rs772679257 49 dbSNP
rs1449816180 51 dbSNP
rs577505367 52 dbSNP
rs1394256989 55 dbSNP
rs1330785239 59 dbSNP
rs917026651 69 dbSNP
rs3088014 90 dbSNP
rs1287970802 91 dbSNP
rs1327271646 100 dbSNP
rs113929276 106 dbSNP
rs1225567687 110 dbSNP
rs1264720086 115 dbSNP
rs562699726 120 dbSNP
rs1344720423 124 dbSNP
rs1169833707 125 dbSNP
rs1199298377 134 dbSNP
rs1015235444 142 dbSNP
rs1437941173 149 dbSNP
rs531358882 153 dbSNP
rs1267440946 156 dbSNP
rs1050623956 157 dbSNP
rs1428397937 162 dbSNP
rs1464312983 167 dbSNP
rs1169608746 173 dbSNP
rs1397039943 194 dbSNP
rs562499348 202 dbSNP
rs1307563088 215 dbSNP
rs1348704521 220 dbSNP
rs1281463814 227 dbSNP
rs1028649834 228 dbSNP
rs1456590886 235 dbSNP
rs923465766 241 dbSNP
rs1253604329 242 dbSNP
rs1340752509 245 dbSNP
rs1384320723 262 dbSNP
rs192462909 266 dbSNP
rs962290347 267 dbSNP
rs900992715 271 dbSNP
rs1266177197 274 dbSNP
rs1299372262 279 dbSNP
rs1041138508 284 dbSNP
rs528993229 288 dbSNP
rs984810548 320 dbSNP
rs1166607931 325 dbSNP
rs373818840 326 dbSNP
rs969403317 330 dbSNP
rs1023625252 333 dbSNP
rs1304015553 343 dbSNP
rs1455944843 345 dbSNP
rs1390208441 351 dbSNP
rs936662746 353 dbSNP
rs559944169 355 dbSNP
rs1298271765 356 dbSNP
rs926937453 357 dbSNP
rs1014121361 358 dbSNP
rs1158773317 359 dbSNP
rs949561243 367 dbSNP
rs1361012830 369 dbSNP
rs1222496768 371 dbSNP
rs1477529974 373 dbSNP
rs1264505691 378 dbSNP
rs187555886 380 dbSNP
rs1206524947 387 dbSNP
rs1262218710 401 dbSNP
rs992596882 407 dbSNP
rs577782641 412 dbSNP
rs3735546 419 dbSNP
rs115354522 422 dbSNP
rs1206789619 423 dbSNP
rs1367958802 430 dbSNP
rs903120616 431 dbSNP
rs764913731 435 dbSNP
rs952477635 447 dbSNP
rs1011429607 450 dbSNP
rs1284769869 454 dbSNP
rs1205942097 463 dbSNP
rs1385539061 465 dbSNP
rs1344502215 469 dbSNP
rs888810596 473 dbSNP
rs544481893 477 dbSNP
rs1240805441 478 dbSNP
rs369708433 486 dbSNP
rs1050084924 498 dbSNP
rs1328264523 503 dbSNP
rs1206519992 514 dbSNP
rs1028261668 537 dbSNP
rs996704482 556 dbSNP
rs933102526 560 dbSNP
rs1181175208 564 dbSNP
rs965195536 577 dbSNP
rs575281400 578 dbSNP
rs183550450 593 dbSNP
rs776473071 597 dbSNP
rs766109400 598 dbSNP
rs1297477835 599 dbSNP
rs1457057097 600 dbSNP
rs1157478751 603 dbSNP
rs1408752719 604 dbSNP
rs192730710 609 dbSNP
rs1302756482 610 dbSNP
rs1376371680 615 dbSNP
rs1392589091 619 dbSNP
rs985072041 620 dbSNP
rs1433595500 623 dbSNP
rs114792956 632 dbSNP
rs892587070 639 dbSNP
rs1414271095 640 dbSNP
rs1054279771 646 dbSNP
rs1000897800 654 dbSNP
rs905178911 667 dbSNP
rs1178964651 676 dbSNP
rs916608574 678 dbSNP
rs1252611038 683 dbSNP
rs992133481 694 dbSNP
rs961083886 700 dbSNP
rs140636244 701 dbSNP
rs1175162624 710 dbSNP
rs377761532 710 dbSNP
rs772983234 712 dbSNP
rs949593050 713 dbSNP
rs1176019015 718 dbSNP
rs553166523 725 dbSNP
rs1357867696 729 dbSNP
rs1463086146 730 dbSNP
rs577174995 732 dbSNP
rs1476391990 734 dbSNP
rs1298314845 737 dbSNP
rs896658333 747 dbSNP
rs977242813 749 dbSNP
rs1407660969 754 dbSNP
rs1284749869 757 dbSNP
rs967206945 758 dbSNP
rs1021400584 769 dbSNP
rs866223756 773 dbSNP
rs1218356785 775 dbSNP
rs1036496201 778 dbSNP
rs940830704 779 dbSNP
rs188435106 787 dbSNP
rs1163967958 789 dbSNP
rs1275493944 793 dbSNP
rs908326317 815 dbSNP
rs774079627 825 dbSNP
rs201163774 828 dbSNP
rs1213347797 831 dbSNP
rs931020022 831 dbSNP
rs761850224 845 dbSNP
rs1274097187 846 dbSNP
rs1226279940 851 dbSNP
rs182997297 862 dbSNP
rs997155648 863 dbSNP
rs1447712984 865 dbSNP
rs1427215318 869 dbSNP
rs975317929 871 dbSNP
rs1435289419 875 dbSNP
rs1272924423 876 dbSNP
rs965235377 877 dbSNP
rs1314308861 885 dbSNP
rs1296722311 896 dbSNP
rs1019484047 899 dbSNP
rs1226192357 900 dbSNP
rs1415081510 901 dbSNP
rs987977079 910 dbSNP
rs774567202 914 dbSNP
rs1452471253 915 dbSNP
rs1036139455 923 dbSNP
rs1245389359 935 dbSNP
rs1487023404 936 dbSNP
rs1189806420 960 dbSNP
rs940410856 962 dbSNP
rs1390024531 972 dbSNP
rs769056371 980 dbSNP
rs749462538 985 dbSNP
rs1164994387 987 dbSNP
rs1413881417 988 dbSNP
rs1411170975 989 dbSNP
rs1321152768 997 dbSNP
rs1346769379 1004 dbSNP
rs1435496962 1009 dbSNP
rs780569468 1016 dbSNP
rs1001328616 1021 dbSNP
rs905212284 1028 dbSNP
rs1162628670 1031 dbSNP
rs1344897718 1032 dbSNP
rs1227980283 1037 dbSNP
rs1287938090 1041 dbSNP
rs1319108313 1050 dbSNP
rs571443037 1052 dbSNP
rs1049256367 1056 dbSNP
rs1259419347 1060 dbSNP
rs1185931906 1061 dbSNP
rs1237598120 1069 dbSNP
rs948288530 1072 dbSNP
rs189836100 1087 dbSNP
rs1409621797 1091 dbSNP
rs1378373890 1099 dbSNP
rs1457587741 1111 dbSNP
rs1158223869 1121 dbSNP
rs770010250 1142 dbSNP
rs916805818 1146 dbSNP
rs530434597 1150 dbSNP
rs1177995351 1168 dbSNP
rs538128747 1169 dbSNP
rs992582499 1171 dbSNP
rs185018663 1174 dbSNP
rs939342576 1185 dbSNP
rs1447296796 1199 dbSNP
rs746405744 1204 dbSNP
rs548965257 1211 dbSNP
rs923918749 1212 dbSNP
rs1352621825 1217 dbSNP
rs978175236 1220 dbSNP
rs528853895 1223 dbSNP
rs757749052 1227 dbSNP
rs1354672554 1228 dbSNP
rs1279906767 1230 dbSNP
rs1441340989 1240 dbSNP
rs1295571903 1242 dbSNP
rs1234105353 1246 dbSNP
rs931030642 1250 dbSNP
rs768607628 1252 dbSNP
rs1021449845 1258 dbSNP
rs1409550466 1262 dbSNP
rs560210147 1263 dbSNP
rs1173091229 1267 dbSNP
rs112935197 1274 dbSNP
rs575872479 1277 dbSNP
rs1332349439 1285 dbSNP
rs1372450712 1299 dbSNP
rs943706255 1307 dbSNP
rs778383080 1311 dbSNP
rs912505510 1312 dbSNP
rs1305825133 1313 dbSNP
rs1443699482 1316 dbSNP
rs1235798664 1318 dbSNP
rs988006425 1319 dbSNP
rs754642442 1338 dbSNP
rs1199244043 1353 dbSNP
rs533377519 1359 dbSNP
rs1028880075 1361 dbSNP
rs997827007 1373 dbSNP
rs1204038011 1383 dbSNP
rs1419945667 1388 dbSNP
rs901539946 1396 dbSNP
rs1376849343 1398 dbSNP
rs141714951 1400 dbSNP
rs1165304976 1405 dbSNP
rs1014592960 1411 dbSNP
rs1004676948 1422 dbSNP
rs148456924 1440 dbSNP
rs1430442265 1441 dbSNP
rs1307662147 1448 dbSNP
rs1368887569 1450 dbSNP
rs144272840 1452 dbSNP
rs1324701543 1454 dbSNP
rs1330857640 1455 dbSNP
rs183334978 1459 dbSNP
rs1300388769 1465 dbSNP
rs1342255840 1477 dbSNP
rs1226946754 1493 dbSNP
rs895406987 1496 dbSNP
rs75716948 1499 dbSNP
rs1210031012 1503 dbSNP
rs573137187 1512 dbSNP
rs939585380 1516 dbSNP
rs1005514972 1527 dbSNP
rs887968862 1537 dbSNP
rs190785606 1542 dbSNP
rs978060583 1556 dbSNP
rs946802757 1559 dbSNP
rs1221469970 1569 dbSNP
rs1388399771 1571 dbSNP
rs546313229 1572 dbSNP
rs760338429 1573 dbSNP
rs1390498173 1576 dbSNP
rs899633536 1578 dbSNP
rs1214655507 1580 dbSNP
rs1366630396 1593 dbSNP
rs1039412841 1596 dbSNP
rs915290419 1598 dbSNP
rs142872538 1599 dbSNP
rs1245095276 1606 dbSNP
rs953262654 1619 dbSNP
rs912200927 1620 dbSNP
rs375919094 1623 dbSNP
rs921750528 1632 dbSNP
rs976062126 1634 dbSNP
rs1433692090 1644 dbSNP
rs1186563888 1646 dbSNP
rs966356892 1647 dbSNP
rs1014601085 1654 dbSNP
rs925149788 1659 dbSNP
rs1004518267 1661 dbSNP
rs951788950 1662 dbSNP
rs1456568076 1665 dbSNP
rs767395902 1667 dbSNP
rs916689711 1682 dbSNP
rs1457220394 1688 dbSNP
rs1396534162 1695 dbSNP
rs1319070743 1705 dbSNP
rs1380748981 1707 dbSNP
rs992230759 1708 dbSNP
rs1311589192 1715 dbSNP
rs1338397516 1716 dbSNP
rs761794977 1721 dbSNP
rs1014908889 1725 dbSNP
rs557992189 1755 dbSNP
rs1386250513 1758 dbSNP
rs1257618735 1768 dbSNP
rs537992504 1779 dbSNP
rs1157179524 1784 dbSNP
rs186772387 1787 dbSNP
rs1182573289 1790 dbSNP
rs774583785 1790 dbSNP
rs952434504 1791 dbSNP
rs1012389678 1796 dbSNP
rs1184599820 1797 dbSNP
rs181629007 1809 dbSNP
rs1472431381 1810 dbSNP
rs535468318 1811 dbSNP
rs1057025506 1818 dbSNP
rs1255401732 1821 dbSNP
rs1466985312 1826 dbSNP
rs1003838500 1832 dbSNP
rs902731371 1847 dbSNP
rs1042376503 1848 dbSNP
rs900669082 1850 dbSNP
rs1194855134 1854 dbSNP
rs574394809 1856 dbSNP
rs1288520922 1857 dbSNP
rs1349653462 1866 dbSNP
rs1259406919 1868 dbSNP
rs1218385430 1869 dbSNP
rs915343321 1877 dbSNP
rs1303112324 1878 dbSNP
rs1312745904 1879 dbSNP
rs1049831134 1897 dbSNP
rs1007910062 1901 dbSNP
rs541985406 1906 dbSNP
rs890795773 1911 dbSNP
rs1277503238 1919 dbSNP
rs932721785 1929 dbSNP
rs935004221 1934 dbSNP
rs925230088 1946 dbSNP
rs554634298 1947 dbSNP
rs1434359605 1948 dbSNP
rs1392737075 1954 dbSNP
rs976283492 1957 dbSNP
rs1431028661 1959 dbSNP
rs1308287939 1960 dbSNP
rs775802316 1963 dbSNP
rs1407587112 1977 dbSNP
rs770031515 1981 dbSNP
rs947910251 1988 dbSNP
rs1362763423 1997 dbSNP
rs1368028464 2000 dbSNP
rs916386705 2001 dbSNP
rs992260220 2003 dbSNP
rs965996788 2006 dbSNP
rs1230639642 2008 dbSNP
rs907765354 2009 dbSNP
rs546336900 2012 dbSNP
rs1345965349 2013 dbSNP
rs951717236 2028 dbSNP
rs1488976726 2029 dbSNP
rs1027309227 2036 dbSNP
rs952062922 2049 dbSNP
rs1012031986 2054 dbSNP
rs746255826 2055 dbSNP
rs10486432 2056 dbSNP
rs1166403475 2080 dbSNP
rs1449318034 2089 dbSNP
rs771402453 2090 dbSNP
rs1260273334 2091 dbSNP
rs747461222 2101 dbSNP
rs778403179 2104 dbSNP
rs568634369 2107 dbSNP
rs117637656 2109 dbSNP
rs1435684408 2115 dbSNP
rs1298506251 2117 dbSNP
rs753511083 2120 dbSNP
rs1019032391 2122 dbSNP
rs1292208114 2123 dbSNP
rs550767655 2129 dbSNP
rs1221227438 2134 dbSNP
rs530986168 2145 dbSNP
rs755761627 2149 dbSNP
rs1246898826 2151 dbSNP
rs562422107 2154 dbSNP
rs542135032 2173 dbSNP
rs1414009465 2178 dbSNP
rs1349404073 2179 dbSNP
rs922646812 2187 dbSNP
rs111231126 2188 dbSNP
rs1390554229 2192 dbSNP
rs1457756438 2209 dbSNP
rs1319738449 2215 dbSNP
rs559770996 2216 dbSNP
rs1428671550 2223 dbSNP
rs907693182 2236 dbSNP
rs894981832 2238 dbSNP
rs1297670299 2243 dbSNP
rs1232900277 2248 dbSNP
rs570099056 2261 dbSNP
rs1331603504 2270 dbSNP
rs77175151 2273 dbSNP
rs1302464532 2277 dbSNP
rs576623541 2278 dbSNP
rs73088329 2282 dbSNP
rs930654912 2284 dbSNP
rs557461201 2293 dbSNP
rs1413917964 2294 dbSNP
rs920296472 2301 dbSNP
rs1371805266 2304 dbSNP
rs1158371952 2310 dbSNP
rs1382629184 2311 dbSNP
rs990849250 2319 dbSNP
rs1336322965 2321 dbSNP
rs959160262 2323 dbSNP
rs1035153381 2329 dbSNP
rs189944498 2330 dbSNP
rs1413599898 2339 dbSNP
rs1352750254 2342 dbSNP
rs1229344480 2343 dbSNP
rs1185343167 2372 dbSNP
rs1349213822 2375 dbSNP
rs966872073 2380 dbSNP
rs764287093 2381 dbSNP
rs1011153499 2389 dbSNP
rs1441275997 2396 dbSNP
rs1208282838 2402 dbSNP
rs1253473533 2412 dbSNP
rs186749078 2413 dbSNP
rs1031196318 2415 dbSNP
rs1361812892 2422 dbSNP
rs1479003238 2424 dbSNP
rs1173035222 2425 dbSNP
rs1425967427 2426 dbSNP
rs999254271 2438 dbSNP
rs903532373 2447 dbSNP
rs1021920811 2448 dbSNP
rs1328684893 2448 dbSNP
rs796421344 2448 dbSNP
rs1252972561 2450 dbSNP
rs1228131635 2451 dbSNP
rs1439235744 2452 dbSNP
rs1320881964 2454 dbSNP
rs1028332172 2456 dbSNP
rs997226700 2461 dbSNP
rs539777662 2462 dbSNP
rs555663054 2464 dbSNP
rs901278120 2467 dbSNP
rs1276126031 2473 dbSNP
rs116726320 2475 dbSNP
rs940075163 2494 dbSNP
rs886305565 2507 dbSNP
rs367809858 2512 dbSNP
rs1199533685 2513 dbSNP
rs1234915786 2517 dbSNP
rs930547775 2525 dbSNP
rs1056378714 2528 dbSNP
rs1313748941 2532 dbSNP
rs1171894961 2533 dbSNP
rs552560783 2537 dbSNP
rs990514043 2539 dbSNP
rs1167498026 2542 dbSNP
rs886247660 2553 dbSNP
rs539003243 2556 dbSNP
rs1463006803 2557 dbSNP
rs1370967232 2565 dbSNP
rs763170755 2567 dbSNP
rs1439298696 2568 dbSNP
rs1349815712 2569 dbSNP
rs1299257357 2570 dbSNP
rs181198943 2578 dbSNP
rs765441642 2583 dbSNP
rs927632520 2598 dbSNP
rs550229381 2599 dbSNP
rs1418079015 2600 dbSNP
rs1210264940 2632 dbSNP
rs1181068692 2635 dbSNP
rs974749460 2648 dbSNP
rs1467135899 2660 dbSNP
rs1190420435 2669 dbSNP
rs943372373 2679 dbSNP
rs1252124733 2680 dbSNP
rs1192786164 2681 dbSNP
rs1371502066 2684 dbSNP
rs759793685 2691 dbSNP
rs1164237593 2693 dbSNP
rs1195875712 2696 dbSNP
rs987669242 2697 dbSNP
rs879295864 2699 dbSNP
rs956220414 2704 dbSNP
rs966431813 2706 dbSNP
rs1323064696 2712 dbSNP
rs111825509 2719 dbSNP
rs1292796393 2721 dbSNP
rs989574574 2723 dbSNP
rs978245811 2725 dbSNP
rs958297965 2734 dbSNP
rs1028972313 2742 dbSNP
rs1292511880 2743 dbSNP
rs1335281254 2744 dbSNP
rs1022453895 2745 dbSNP
rs188407522 2747 dbSNP
rs548901738 2750 dbSNP
rs1210517720 2751 dbSNP
rs1268641361 2766 dbSNP
rs1486247223 2776 dbSNP
rs959016143 2779 dbSNP
rs1034950360 2782 dbSNP
rs901200059 2789 dbSNP
rs1003440614 2803 dbSNP
rs1188902002 2809 dbSNP
rs1019602905 2813 dbSNP
rs1004338617 2814 dbSNP
rs1390087342 2815 dbSNP
rs1453638070 2822 dbSNP
rs1403705700 2827 dbSNP
rs1396264103 2829 dbSNP
rs1353361227 2830 dbSNP
rs1229947730 2831 dbSNP
rs1288722013 2833 dbSNP
rs1316307334 2847 dbSNP
rs1236782303 2850 dbSNP
rs1259095739 2856 dbSNP
rs1047523471 2858 dbSNP
rs183655880 2866 dbSNP
rs1047600462 2868 dbSNP
rs1309152153 2872 dbSNP
rs899287747 2873 dbSNP
rs1409168668 2885 dbSNP
rs771264279 2886 dbSNP
rs899100491 2887 dbSNP
rs1324513059 2895 dbSNP
rs1378865546 2898 dbSNP
rs1055475089 2908 dbSNP
rs1434754511 2923 dbSNP
rs560040696 2925 dbSNP
rs1373289292 2932 dbSNP
rs547028888 2936 dbSNP
rs1372325632 2941 dbSNP
rs1051985919 2944 dbSNP
rs927659598 2948 dbSNP
rs1314048232 2951 dbSNP
rs1235187515 2953 dbSNP
rs1395741427 2962 dbSNP
rs532513639 2969 dbSNP
rs1346072569 2971 dbSNP
rs1207545328 2978 dbSNP
rs1046007800 2982 dbSNP
rs1233833314 2985 dbSNP
rs1480473637 2987 dbSNP
rs924779056 2991 dbSNP
rs1270031784 2999 dbSNP
rs1455067277 3011 dbSNP
rs1172519374 3019 dbSNP
rs1392714506 3022 dbSNP
rs1451088935 3029 dbSNP
rs945137224 3031 dbSNP
rs1181835761 3037 dbSNP
rs1170634075 3050 dbSNP
rs1432121035 3052 dbSNP
rs563805778 3054 dbSNP
rs1295051340 3064 dbSNP
rs989628698 3075 dbSNP
rs969287691 3076 dbSNP
rs915023416 3085 dbSNP
rs1368806020 3092 dbSNP
rs1468738214 3102 dbSNP
rs958225463 3106 dbSNP
rs867894321 3109 dbSNP
rs1203168302 3111 dbSNP
rs1202924923 3124 dbSNP
rs990541137 3125 dbSNP
rs543531227 3126 dbSNP
rs575444557 3130 dbSNP
rs1250609519 3142 dbSNP
rs1239813954 3143 dbSNP
rs1034645413 3157 dbSNP
rs1003471745 3164 dbSNP
rs1418415053 3169 dbSNP
rs976105686 3181 dbSNP
rs950699016 3185 dbSNP
rs145654343 3198 dbSNP
rs530099157 3202 dbSNP
rs1394928624 3211 dbSNP
rs541968161 3224 dbSNP
rs1020034545 3229 dbSNP
rs1460870455 3234 dbSNP
rs569684071 3241 dbSNP
rs1432916147 3242 dbSNP
rs761200332 3242 dbSNP
rs951453456 3243 dbSNP
rs1361576224 3246 dbSNP
rs552822477 3251 dbSNP
rs539064429 3253 dbSNP
rs1335832694 3254 dbSNP
rs1039106572 3262 dbSNP
rs1318000296 3267 dbSNP
rs1380903088 3276 dbSNP
rs1271776743 3281 dbSNP
rs796882703 3289 dbSNP
rs1007573475 3290 dbSNP
rs1241015641 3291 dbSNP
rs995571988 3312 dbSNP
rs1183181673 3318 dbSNP
rs1418313094 3325 dbSNP
rs1051681436 3329 dbSNP
rs867209882 3353 dbSNP
rs1386626060 3355 dbSNP
rs576416733 3357 dbSNP
rs1414154899 3358 dbSNP
rs1433538162 3359 dbSNP
rs556682487 3366 dbSNP
rs1344669248 3371 dbSNP
rs924927351 3375 dbSNP
rs1314924784 3380 dbSNP
rs1356534674 3381 dbSNP
rs1233113328 3382 dbSNP
rs1002534776 3391 dbSNP
rs906417502 3394 dbSNP
rs568749408 3396 dbSNP
rs1353559877 3404 dbSNP
rs1175433275 3418 dbSNP
rs1454609058 3426 dbSNP
rs1247359758 3441 dbSNP
rs947593112 3453 dbSNP
rs1211841553 3456 dbSNP
rs1257721551 3460 dbSNP
rs536736555 3464 dbSNP
rs945022393 3465 dbSNP
rs1185579389 3477 dbSNP
rs913553277 3487 dbSNP
rs376082395 3488 dbSNP
rs1470505141 3514 dbSNP
rs1157864184 3517 dbSNP
rs568104647 3521 dbSNP
rs1398980346 3523 dbSNP
rs1175779649 3534 dbSNP
rs1376337836 3547 dbSNP
rs79107368 3558 dbSNP
rs1311509003 3559 dbSNP
rs921470402 3560 dbSNP
rs755553364 3566 dbSNP
rs1443569298 3568 dbSNP
rs535191521 3571 dbSNP
rs975566484 3572 dbSNP
rs1279449255 3577 dbSNP
rs1347951586 3578 dbSNP
rs1235916468 3589 dbSNP
rs1280376993 3595 dbSNP
rs927692668 3597 dbSNP
rs1208262037 3605 dbSNP
rs1253718743 3624 dbSNP
rs779614098 3625 dbSNP
rs1347231560 3634 dbSNP
rs1231053712 3635 dbSNP
rs966019659 3637 dbSNP
rs1195653965 3638 dbSNP
rs1236600560 3644 dbSNP
rs1395757721 3644 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguAAU-ACACGACGAu 5'
                   |||   ||||||| 
Target 5' -------auUUACACUGCUGCUu 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000313367.2 | 3UTR | AUUUACACUGCUGCUUUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000313367.2 | 3UTR | UUACACUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.545 6.3e-4 0.056 3.8e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.419 2.3e-2 -0.150 2.5e-1 23 Click to see details
GSE17498 Multiple myeloma -0.28 4.0e-2 -0.292 3.4e-2 40 Click to see details
GSE19783 ER- ER- breast cancer -0.19 4.7e-2 -0.210 3.2e-2 79 Click to see details
GSE27834 Pluripotent stem cells 0.374 7.7e-2 0.282 1.4e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.323 8.2e-2 0.421 3.2e-2 20 Click to see details
GSE19536 Breast cancer -0.125 1.1e-1 -0.079 2.2e-1 100 Click to see details
GSE14794 Lymphoblastoid cells 0.117 1.4e-1 0.086 2.1e-1 90 Click to see details
GSE28544 Breast cancer -0.193 1.8e-1 -0.487 7.9e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.197 2.0e-1 0.426 3.1e-2 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.169 2.1e-1 -0.163 2.2e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.195 2.6e-1 -0.077 4.0e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.112 3.0e-1 0.169 2.1e-1 24 Click to see details
GSE21032 Prostate cancer 0.049 3.3e-1 -0.009 4.7e-1 83 Click to see details
GSE17306 Multiple myeloma -0.056 3.5e-1 -0.127 1.9e-1 49 Click to see details
GSE21849 B cell lymphoma -0.035 4.3e-1 -0.195 1.6e-1 29 Click to see details
GSE21687 Ependynoma primary tumors -0.021 4.3e-1 -0.151 1.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.05 4.4e-1 -0.238 2.3e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.017 4.7e-1 0.090 3.3e-1 25 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 -0.174 2.3e-1 21 Click to see details
GSE38226 Liver fibrosis -0.003 4.9e-1 -0.174 2.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.663 0 0.656 0 32 Click to see details
KIRC -0.399 0 -0.343 0 68 Click to see details
BLCA 0.667 0 0.544 0.01 18 Click to see details
BRCA -0.242 0.01 -0.238 0.01 84 Click to see details
HNSC 0.342 0.01 0.317 0.02 42 Click to see details
UCEC -0.433 0.03 -0.354 0.07 19 Click to see details
PAAD 0.916 0.04 1.000 0.5 4 Click to see details
LUAD 0.473 0.06 0.406 0.1 12 Click to see details
LUSC -0.186 0.13 -0.216 0.1 38 Click to see details
PRAD 0.13 0.18 0.066 0.32 50 Click to see details
COAD 0.28 0.25 0.071 0.43 8 Click to see details
ESCA 0.225 0.25 0.045 0.45 11 Click to see details
CHOL -0.239 0.27 -0.467 0.1 9 Click to see details
KICH 0.093 0.33 0.061 0.39 25 Click to see details
LIHC -0.057 0.35 0.019 0.45 49 Click to see details
KIRP -0.048 0.4 0.002 0.5 32 Click to see details
CESC 0.288 0.41 0.500 0.33 3 Click to see details
PCPG -0.247 0.42 -0.500 0.33 3 Click to see details
THCA 0.021 0.44 -0.059 0.33 59 Click to see details
THCA 0.021 0.44 -0.059 0.33 59 Click to see details
THCA 0.021 0.44 -0.059 0.33 59 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*