miRTarBase - #MIRT564838 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZBTB16   
Synonyms PLZF, ZNF145
Description zinc finger and BTB domain containing 16
Transcript NM_001018011   
Other Transcripts NM_006006   
Expression
Putative miRNA Targets on ZBTB16
3'UTR of ZBTB16
(miRNA target sites are highlighted)
>ZBTB16|NM_001018011|3'UTR
   1 AGGGAGGCCCGCGGCGGTGGAGCCGAGCGGGGAGCCAGGAAAGAAGAGTTGGAGTGAGATGAAGGAAGGACTATGACAAA
  81 TAAAAAAGGAAAAGAAAAAAAAAAACAGAAGGAAAAGGAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuugguaauacaCGACGau 5'
                         || ||  
Target 5' -----agggaggcccGCGGCgg 3'
1 - 17 68.00 -5.60
2
miRNA  3' guguuugguaauacaCGACgau 5'
                         |:||   
Target 5' agccaggaaagaagaGTTGgag 3'
33 - 54 64.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30491070 2 COSMIC
COSN30104482 6 COSMIC
COSN31538856 12 COSMIC
COSN30731957 13 COSMIC
COSN20077525 18 COSMIC
COSN30128379 25 COSMIC
COSN30462282 26 COSMIC
COSN30143552 33 COSMIC
COSN30189148 35 COSMIC
COSN30164852 36 COSMIC
COSN20077332 47 COSMIC
COSN20081490 106 COSMIC
rs117407608 1252 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1425971776 4 dbSNP
rs764548670 9 dbSNP
rs377609979 11 dbSNP
rs1452260873 12 dbSNP
rs762709048 13 dbSNP
rs371293614 14 dbSNP
rs3088357 16 dbSNP
rs368652898 17 dbSNP
rs767542589 19 dbSNP
rs752566953 21 dbSNP
rs201739085 22 dbSNP
rs1306017472 23 dbSNP
rs115496918 25 dbSNP
rs373656983 26 dbSNP
rs753577072 27 dbSNP
rs553166852 29 dbSNP
rs754982750 30 dbSNP
rs111960851 33 dbSNP
rs1483337916 34 dbSNP
rs772030123 37 dbSNP
rs550619809 38 dbSNP
rs780674919 41 dbSNP
rs1161968516 42 dbSNP
rs1413293975 49 dbSNP
rs374340897 50 dbSNP
rs1348792215 61 dbSNP
rs58686003 61 dbSNP
rs554304805 65 dbSNP
rs1320940380 75 dbSNP
rs1043358358 83 dbSNP
rs113522699 95 dbSNP
rs540905485 95 dbSNP
rs925197374 95 dbSNP
rs1378724934 96 dbSNP
rs574397487 102 dbSNP
rs1219385780 105 dbSNP
rs1491560399 105 dbSNP
rs1491261723 106 dbSNP
rs11214915 107 dbSNP
rs1316436461 117 dbSNP
rs1265465352 122 dbSNP
rs950678394 126 dbSNP
rs1220184101 138 dbSNP
rs896300667 153 dbSNP
rs1273604917 158 dbSNP
rs1443693107 158 dbSNP
rs987326080 169 dbSNP
rs1335875750 173 dbSNP
rs1330241555 177 dbSNP
rs1463787260 185 dbSNP
rs1408022711 188 dbSNP
rs1295336844 189 dbSNP
rs78632056 192 dbSNP
rs964822129 198 dbSNP
rs12290993 202 dbSNP
rs905233637 207 dbSNP
rs915229418 214 dbSNP
rs1238935086 216 dbSNP
rs1456561900 217 dbSNP
rs545912674 218 dbSNP
rs1448612730 219 dbSNP
rs559206155 221 dbSNP
rs1312008091 222 dbSNP
rs1277085966 226 dbSNP
rs1226025316 231 dbSNP
rs1236611469 235 dbSNP
rs1307979773 247 dbSNP
rs1485800265 249 dbSNP
rs552407617 252 dbSNP
rs145139073 268 dbSNP
rs531260894 283 dbSNP
rs993688513 292 dbSNP
rs1303087600 294 dbSNP
rs112113380 296 dbSNP
rs1357250389 299 dbSNP
rs1161187486 300 dbSNP
rs1472008556 301 dbSNP
rs939605627 303 dbSNP
rs548801407 304 dbSNP
rs1030484626 312 dbSNP
rs1409398035 315 dbSNP
rs1158066235 319 dbSNP
rs745488838 330 dbSNP
rs562262687 352 dbSNP
rs531272196 363 dbSNP
rs35728782 364 dbSNP
rs895285113 373 dbSNP
rs570850654 374 dbSNP
rs1415779965 375 dbSNP
rs1315056197 379 dbSNP
rs192210767 383 dbSNP
rs1312944752 384 dbSNP
rs979519095 387 dbSNP
rs1409310699 396 dbSNP
rs1290348191 399 dbSNP
rs749305033 404 dbSNP
rs1400401655 405 dbSNP
rs1280170672 406 dbSNP
rs12291208 409 dbSNP
rs1417905877 419 dbSNP
rs1387214751 426 dbSNP
rs1217344937 427 dbSNP
rs1423526203 429 dbSNP
rs1411901504 442 dbSNP
rs1277809070 443 dbSNP
rs184373539 444 dbSNP
rs1263047645 447 dbSNP
rs994540115 449 dbSNP
rs988045570 457 dbSNP
rs1026380281 458 dbSNP
rs1319494965 467 dbSNP
rs535510835 480 dbSNP
rs1297308710 481 dbSNP
rs950651066 490 dbSNP
rs1339643259 493 dbSNP
rs1276202236 495 dbSNP
rs1249196035 500 dbSNP
rs1392964394 506 dbSNP
rs1294120286 508 dbSNP
rs1008810810 509 dbSNP
rs917792636 510 dbSNP
rs1234056437 516 dbSNP
rs1478334087 517 dbSNP
rs12277958 525 dbSNP
rs1171408261 530 dbSNP
rs1394977298 532 dbSNP
rs1481669321 533 dbSNP
rs528334867 542 dbSNP
rs974841587 547 dbSNP
rs536984176 555 dbSNP
rs905283508 562 dbSNP
rs891015564 564 dbSNP
rs915298040 566 dbSNP
rs968521802 567 dbSNP
rs1255991206 569 dbSNP
rs556815369 583 dbSNP
rs1038126926 586 dbSNP
rs1300530448 593 dbSNP
rs1386239962 597 dbSNP
rs1365630516 598 dbSNP
rs577040950 602 dbSNP
rs562460689 603 dbSNP
rs1429269201 608 dbSNP
rs897808533 612 dbSNP
rs12291309 614 dbSNP
rs993744011 628 dbSNP
rs1030536923 630 dbSNP
rs923931966 636 dbSNP
rs890667988 637 dbSNP
rs1176026414 645 dbSNP
rs939615419 651 dbSNP
rs1252121044 652 dbSNP
rs1056603164 653 dbSNP
rs1007689407 659 dbSNP
rs768418314 660 dbSNP
rs1434390059 666 dbSNP
rs545498230 670 dbSNP
rs916766153 675 dbSNP
rs964150545 677 dbSNP
rs979184823 685 dbSNP
rs1274236880 687 dbSNP
rs1371581454 691 dbSNP
rs559254074 694 dbSNP
rs1231038803 702 dbSNP
rs572897127 706 dbSNP
rs748224605 709 dbSNP
rs1038931323 716 dbSNP
rs898936951 717 dbSNP
rs541935954 718 dbSNP
rs1376381000 720 dbSNP
rs143108928 725 dbSNP
rs1047423794 731 dbSNP
rs886069866 732 dbSNP
rs12793024 733 dbSNP
rs1018848795 735 dbSNP
rs1252943166 736 dbSNP
rs1382705979 741 dbSNP
rs1158660143 748 dbSNP
rs551164623 752 dbSNP
rs900348757 757 dbSNP
rs1438564259 762 dbSNP
rs1378055832 767 dbSNP
rs926454581 770 dbSNP
rs1455052000 774 dbSNP
rs996048981 786 dbSNP
rs1255281711 787 dbSNP
rs1198654369 800 dbSNP
rs111827366 816 dbSNP
rs1486775602 823 dbSNP
rs573702859 829 dbSNP
rs1022547391 831 dbSNP
rs1286683138 834 dbSNP
rs968196740 835 dbSNP
rs1195895547 836 dbSNP
rs1353132944 839 dbSNP
rs1307322457 840 dbSNP
rs978549741 853 dbSNP
rs1341443915 857 dbSNP
rs76164319 858 dbSNP
rs771833581 859 dbSNP
rs567848052 860 dbSNP
rs1418525772 867 dbSNP
rs1358125910 868 dbSNP
rs1164620852 888 dbSNP
rs1472958827 891 dbSNP
rs759674162 892 dbSNP
rs475084 915 dbSNP
rs546681771 929 dbSNP
rs12291483 930 dbSNP
rs1263780357 941 dbSNP
rs1215869159 942 dbSNP
rs375218308 950 dbSNP
rs1487996279 955 dbSNP
rs1325258998 957 dbSNP
rs1282330732 963 dbSNP
rs1395132857 974 dbSNP
rs1442937759 980 dbSNP
rs916859586 981 dbSNP
rs948287872 982 dbSNP
rs1279361160 988 dbSNP
rs1399986462 995 dbSNP
rs1227851613 1001 dbSNP
rs1271622745 1008 dbSNP
rs974307005 1013 dbSNP
rs1007740069 1019 dbSNP
rs1039632565 1021 dbSNP
rs920080662 1034 dbSNP
rs930418014 1038 dbSNP
rs1161141800 1039 dbSNP
rs1466974827 1040 dbSNP
rs1208753091 1044 dbSNP
rs1047894279 1046 dbSNP
rs529390257 1047 dbSNP
rs138686643 1062 dbSNP
rs886122245 1077 dbSNP
rs944325246 1078 dbSNP
rs1040047427 1082 dbSNP
rs758307814 1092 dbSNP
rs900461687 1095 dbSNP
rs369253795 1097 dbSNP
rs1022139562 1099 dbSNP
rs1032091131 1108 dbSNP
rs775378740 1114 dbSNP
rs903648215 1122 dbSNP
rs536869337 1131 dbSNP
rs1259179853 1132 dbSNP
rs1218412455 1133 dbSNP
rs1339013296 1133 dbSNP
rs1277154767 1136 dbSNP
rs1436538992 1136 dbSNP
rs999635237 1137 dbSNP
rs1448622165 1146 dbSNP
rs1031017069 1147 dbSNP
rs970651211 1154 dbSNP
rs980696823 1157 dbSNP
rs187182849 1159 dbSNP
rs1478383735 1165 dbSNP
rs992144449 1169 dbSNP
rs1375035407 1170 dbSNP
rs1191976114 1173 dbSNP
rs1459204012 1175 dbSNP
rs1023588395 1176 dbSNP
rs919349807 1177 dbSNP
rs1281327637 1178 dbSNP
rs1051731572 1180 dbSNP
rs929363930 1180 dbSNP
rs1300544857 1189 dbSNP
rs911872852 1189 dbSNP
rs1377123551 1190 dbSNP
rs969700699 1192 dbSNP
rs1318508718 1193 dbSNP
rs1330300165 1193 dbSNP
rs1444267918 1194 dbSNP
rs1384139169 1195 dbSNP
rs943645002 1201 dbSNP
rs1382590797 1205 dbSNP
rs1413900952 1208 dbSNP
rs1422973581 1208 dbSNP
rs1171776010 1214 dbSNP
rs1319990964 1215 dbSNP
rs974696367 1217 dbSNP
rs570656861 1220 dbSNP
rs1178314834 1226 dbSNP
rs920106463 1229 dbSNP
rs1479857352 1237 dbSNP
rs930110025 1238 dbSNP
rs983232463 1246 dbSNP
rs1053665284 1251 dbSNP
rs117407608 1252 dbSNP
rs1009296860 1258 dbSNP
rs1241631794 1258 dbSNP
rs1024670646 1263 dbSNP
rs1206097356 1275 dbSNP
rs970369730 1275 dbSNP
rs1284498889 1277 dbSNP
rs1264232027 1278 dbSNP
rs1441036895 1280 dbSNP
rs1300008907 1282 dbSNP
rs577738602 1284 dbSNP
rs1361318877 1286 dbSNP
rs1158275408 1289 dbSNP
rs1187591492 1290 dbSNP
rs1258455041 1291 dbSNP
rs1476258231 1295 dbSNP
rs1417487009 1298 dbSNP
rs1002569099 1302 dbSNP
rs944438539 1303 dbSNP
rs193004039 1304 dbSNP
rs1255985639 1312 dbSNP
rs547770459 1323 dbSNP
rs900137755 1335 dbSNP
rs1160095416 1338 dbSNP
rs1323083801 1339 dbSNP
rs1290172837 1357 dbSNP
rs1227487575 1363 dbSNP
rs1353386036 1367 dbSNP
rs963591597 1369 dbSNP
rs1339769530 1370 dbSNP
rs931922507 1372 dbSNP
rs1288304030 1375 dbSNP
rs554022283 1377 dbSNP
rs919065702 1384 dbSNP
rs903698609 1402 dbSNP
rs1405116107 1407 dbSNP
rs1356948489 1408 dbSNP
rs1196464274 1415 dbSNP
rs950824820 1417 dbSNP
rs987501577 1435 dbSNP
rs911925384 1436 dbSNP
rs943382643 1437 dbSNP
rs1265643216 1448 dbSNP
rs1316858845 1456 dbSNP
rs1039408885 1465 dbSNP
rs999795520 1466 dbSNP
rs1052203234 1468 dbSNP
rs1240460288 1472 dbSNP
rs1317173510 1483 dbSNP
rs1293390257 1485 dbSNP
rs1380574968 1487 dbSNP
rs1294324708 1504 dbSNP
rs1440527774 1506 dbSNP
rs896613473 1507 dbSNP
rs1013615370 1509 dbSNP
rs1392559699 1514 dbSNP
rs1263017706 1520 dbSNP
rs1343366534 1521 dbSNP
rs1023599760 1523 dbSNP
rs1258517832 1527 dbSNP
rs1434385694 1529 dbSNP
rs969755364 1533 dbSNP
rs1486752271 1535 dbSNP
rs541970882 1543 dbSNP
rs995788412 1544 dbSNP
rs1239644680 1551 dbSNP
rs1466820379 1551 dbSNP
rs184711244 1552 dbSNP
rs575373836 1553 dbSNP
rs1249520148 1557 dbSNP
rs2852423 1559 dbSNP
rs564657083 1560 dbSNP
rs1314017273 1565 dbSNP
rs1301986411 1573 dbSNP
rs912729020 1574 dbSNP
rs1368984677 1591 dbSNP
rs965795140 1592 dbSNP
rs975792640 1596 dbSNP
rs906234848 1613 dbSNP
rs921636932 1618 dbSNP
rs1296956377 1619 dbSNP
rs1324664056 1621 dbSNP
rs781763662 1621 dbSNP
rs1001884364 1622 dbSNP
rs1172422003 1624 dbSNP
rs1452066655 1627 dbSNP
rs931612060 1631 dbSNP
rs533503618 1632 dbSNP
rs1033734808 1638 dbSNP
rs1201965764 1647 dbSNP
rs1373515429 1650 dbSNP
rs1483503512 1663 dbSNP
rs899100615 1664 dbSNP
rs141605916 1665 dbSNP
rs1309852535 1666 dbSNP
rs757743816 1669 dbSNP
rs1234064031 1670 dbSNP
rs935261815 1671 dbSNP
rs1026132210 1680 dbSNP
rs950545026 1692 dbSNP
rs1312852982 1697 dbSNP
rs1432305873 1698 dbSNP
rs1361965338 1704 dbSNP
rs987553995 1706 dbSNP
rs1350337481 1710 dbSNP
rs503768 1713 dbSNP
rs1250961915 1716 dbSNP
rs1189301063 1717 dbSNP
rs1424209749 1718 dbSNP
rs1481023461 1740 dbSNP
rs1256679449 1742 dbSNP
rs1185774974 1744 dbSNP
rs1197606732 1748 dbSNP
rs965123588 1753 dbSNP
rs1288170577 1754 dbSNP
rs1453655162 1757 dbSNP
rs1217455299 1767 dbSNP
rs896288455 1774 dbSNP
rs529228012 1778 dbSNP
rs1396721015 1788 dbSNP
rs1247405294 1789 dbSNP
rs1341500486 1793 dbSNP
rs1293200628 1794 dbSNP
rs1413543487 1797 dbSNP
rs1447430395 1798 dbSNP
rs1169361970 1800 dbSNP
rs118147017 1801 dbSNP
rs548938283 1805 dbSNP
rs1354734973 1810 dbSNP
rs569026910 1812 dbSNP
rs905204032 1813 dbSNP
rs1043838102 1819 dbSNP
rs531654535 1827 dbSNP
rs925399503 1828 dbSNP
rs572649390 1830 dbSNP
rs936292975 1836 dbSNP
rs1304785056 1839 dbSNP
rs145375039 1857 dbSNP
rs1373728690 1859 dbSNP
rs1213144751 1861 dbSNP
rs1263843530 1863 dbSNP
rs1193942780 1866 dbSNP
rs989051841 1868 dbSNP
rs913438202 1869 dbSNP
rs1211920824 1872 dbSNP
rs1308248607 1877 dbSNP
rs1206751160 1887 dbSNP
rs1231856429 1889 dbSNP
rs1271289921 1892 dbSNP
rs995939379 1893 dbSNP
rs1026967538 1900 dbSNP
rs1429375463 1907 dbSNP
rs750162586 1931 dbSNP
rs1045897584 1932 dbSNP
rs1386925946 1933 dbSNP
rs951753283 1934 dbSNP
rs1463419573 1936 dbSNP
rs560864695 1938 dbSNP
rs755708520 1948 dbSNP
rs1467020450 1949 dbSNP
rs1424217262 1951 dbSNP
rs937732288 1952 dbSNP
rs2096757 1953 dbSNP
rs1019798893 1954 dbSNP
rs1054823116 1960 dbSNP
rs965515739 1967 dbSNP
rs1469028398 1970 dbSNP
rs1419831381 1978 dbSNP
rs570614491 1979 dbSNP
rs372699593 1985 dbSNP
rs1276051880 1986 dbSNP
rs886319506 1995 dbSNP
rs529981160 2002 dbSNP
rs953138705 2009 dbSNP
rs979548466 2011 dbSNP
rs1323528525 2016 dbSNP
rs924963476 2016 dbSNP
rs935256008 2017 dbSNP
rs548459303 2032 dbSNP
rs917767445 2033 dbSNP
rs1288612192 2035 dbSNP
rs79816451 2040 dbSNP
rs975216436 2041 dbSNP
rs531376752 2042 dbSNP
rs1334313810 2043 dbSNP
rs1441914538 2049 dbSNP
rs905296726 2053 dbSNP
rs957594770 2054 dbSNP
rs989102902 2055 dbSNP
rs1233956264 2059 dbSNP
rs1210941108 2063 dbSNP
rs1346593072 2069 dbSNP
rs1300794394 2070 dbSNP
rs779628774 2073 dbSNP
rs535250424 2078 dbSNP
rs1278674942 2079 dbSNP
rs1439779693 2080 dbSNP
rs971608984 2082 dbSNP
rs1214814049 2096 dbSNP
rs981623314 2098 dbSNP
rs1374986747 2103 dbSNP
rs748677742 2106 dbSNP
rs1421679937 2108 dbSNP
rs1185432340 2122 dbSNP
rs137874881 2123 dbSNP
rs1004488860 2138 dbSNP
rs1019852105 2143 dbSNP
rs1239701469 2146 dbSNP
rs937804059 2160 dbSNP
rs901412019 2161 dbSNP
rs1277490515 2167 dbSNP
rs997042073 2181 dbSNP
rs1420689668 2182 dbSNP
rs1399394999 2188 dbSNP
rs555359308 2190 dbSNP
rs575412932 2199 dbSNP
rs953285337 2200 dbSNP
rs371045518 2202 dbSNP
rs754973692 2205 dbSNP
rs1433288746 2210 dbSNP
rs189568999 2211 dbSNP
rs1311345360 2212 dbSNP
rs886371842 2213 dbSNP
rs1353488058 2216 dbSNP
rs1355010613 2217 dbSNP
rs558111858 2219 dbSNP
rs1008746076 2220 dbSNP
rs1040230969 2221 dbSNP
rs1158718835 2222 dbSNP
rs900322385 2223 dbSNP
rs1166111943 2224 dbSNP
rs996311851 2224 dbSNP
rs979170094 2225 dbSNP
rs377093990 2226 dbSNP
rs1010253026 2229 dbSNP
rs956350325 2231 dbSNP
rs988029422 2232 dbSNP
rs1279188109 2237 dbSNP
rs540601951 2239 dbSNP
rs1323280312 2248 dbSNP
rs1273506491 2252 dbSNP
rs917859154 2253 dbSNP
rs1189449898 2257 dbSNP
rs1232469547 2259 dbSNP
rs949283855 2260 dbSNP
rs509103 2263 dbSNP
rs1469179706 2266 dbSNP
rs959123510 2267 dbSNP
rs1409325716 2271 dbSNP
rs1402834172 2283 dbSNP
rs1428816548 2286 dbSNP
rs1172124328 2291 dbSNP
rs943886281 2303 dbSNP
rs575001782 2309 dbSNP
rs1326942416 2319 dbSNP
rs1461275528 2320 dbSNP
rs920347982 2324 dbSNP
rs1173510637 2327 dbSNP
rs566575843 2329 dbSNP
rs1047403846 2330 dbSNP
rs1184259900 2333 dbSNP
rs1489223271 2353 dbSNP
rs1253275484 2358 dbSNP
rs543908191 2370 dbSNP
rs1467008647 2381 dbSNP
rs887122275 2382 dbSNP
rs868741228 2388 dbSNP
rs907530191 2392 dbSNP
rs879271628 2395 dbSNP
rs1294878377 2400 dbSNP
rs901464454 2400 dbSNP
rs1334124476 2401 dbSNP
rs1212908442 2404 dbSNP
rs1441522455 2406 dbSNP
rs997094591 2415 dbSNP
rs542623116 2418 dbSNP
rs1304492822 2420 dbSNP
rs2852424 2421 dbSNP
rs1375378777 2424 dbSNP
rs1300412109 2427 dbSNP
rs1040688595 2437 dbSNP
rs904649896 2438 dbSNP
rs531730779 2439 dbSNP
rs533971955 2441 dbSNP
rs772978231 2443 dbSNP
rs141654946 2446 dbSNP
rs1348169439 2452 dbSNP
rs996415798 2455 dbSNP
rs1270412482 2459 dbSNP
rs1054266506 2466 dbSNP
rs1239706089 2472 dbSNP
rs1436771877 2475 dbSNP
rs564153357 2482 dbSNP
rs1204549558 2484 dbSNP
rs1196178607 2486 dbSNP
rs956441549 2489 dbSNP
rs1010305295 2492 dbSNP
rs866656820 2500 dbSNP
rs1024591845 2501 dbSNP
rs533170410 2503 dbSNP
rs746119673 2504 dbSNP
rs971379937 2509 dbSNP
rs1003165182 2514 dbSNP
rs1233927776 2515 dbSNP
rs546440461 2522 dbSNP
rs970651879 2523 dbSNP
rs1392356039 2539 dbSNP
rs980675764 2539 dbSNP
rs958950939 2543 dbSNP
rs926469947 2544 dbSNP
rs769845974 2554 dbSNP
rs180761162 2555 dbSNP
rs908651894 2556 dbSNP
rs1394571634 2559 dbSNP
rs1409472104 2566 dbSNP
rs940084968 2567 dbSNP
rs1418323839 2573 dbSNP
rs1248294356 2575 dbSNP
rs1183584597 2581 dbSNP
rs1486690673 2583 dbSNP
rs983151284 2584 dbSNP
rs76827432 2590 dbSNP
rs922564220 2599 dbSNP
rs932898095 2609 dbSNP
rs1240181837 2612 dbSNP
rs112193460 2626 dbSNP
rs1305489164 2630 dbSNP
rs1417093239 2632 dbSNP
rs1049985316 2638 dbSNP
rs1356678041 2644 dbSNP
rs1438549913 2659 dbSNP
rs904702590 2662 dbSNP
rs1386647182 2663 dbSNP
rs1158832300 2664 dbSNP
rs1452766176 2665 dbSNP
rs975736719 2676 dbSNP
rs1000398328 2680 dbSNP
rs1053196578 2681 dbSNP
rs1166828305 2683 dbSNP
rs576923263 2685 dbSNP
rs549047984 2690 dbSNP
rs1256746254 2691 dbSNP
rs1187260286 2692 dbSNP
rs1236196883 2709 dbSNP
rs1440819668 2721 dbSNP
rs892253655 2723 dbSNP
rs551916926 2724 dbSNP
rs768831644 2725 dbSNP
rs1350236237 2728 dbSNP
rs775035445 2730 dbSNP
rs545873918 2734 dbSNP
rs184760156 2748 dbSNP
rs1002546191 2754 dbSNP
rs1033633062 2755 dbSNP
rs537580921 2760 dbSNP
rs952721856 2766 dbSNP
rs984013083 2772 dbSNP
rs768051448 2776 dbSNP
rs750695354 2782 dbSNP
rs1327736402 2787 dbSNP
rs772677589 2788 dbSNP
rs976792278 2791 dbSNP
rs922614169 2798 dbSNP
rs773799883 2801 dbSNP
rs557815205 2803 dbSNP
rs932637902 2807 dbSNP
rs1382340518 2808 dbSNP
rs946147420 2829 dbSNP
rs1041820532 2834 dbSNP
rs907246552 2835 dbSNP
rs1162779368 2840 dbSNP
rs1050176315 2847 dbSNP
rs1374799568 2848 dbSNP
rs1003291893 2853 dbSNP
rs1194009930 2853 dbSNP
rs760899640 2855 dbSNP
rs1469227259 2858 dbSNP
rs926248936 2859 dbSNP
rs1208644949 2860 dbSNP
rs1246458255 2860 dbSNP
rs3842271 2860 dbSNP
rs765136047 2860 dbSNP
rs1342089463 2866 dbSNP
rs577636506 2866 dbSNP
rs1226083917 2867 dbSNP
rs1324278875 2875 dbSNP
rs1201394126 2876 dbSNP
rs1371585893 2882 dbSNP
rs1441350415 2889 dbSNP
rs1034326405 2894 dbSNP
rs1475168686 2903 dbSNP
rs1168583031 2904 dbSNP
rs936247968 2908 dbSNP
rs766769969 2909 dbSNP
rs114163581 2914 dbSNP
rs1009290686 2915 dbSNP
rs1454975506 2916 dbSNP
rs553908183 2916 dbSNP
rs906262705 2917 dbSNP
rs1001900800 2921 dbSNP
rs1440010738 2928 dbSNP
rs1033762877 2933 dbSNP
rs952697464 2948 dbSNP
rs1274359098 2952 dbSNP
rs1315882504 2956 dbSNP
rs1014631692 2957 dbSNP
rs1339515641 2961 dbSNP
rs373416790 2962 dbSNP
rs1005848908 2963 dbSNP
rs1234481069 2964 dbSNP
rs1325505975 2966 dbSNP
rs1472743921 2967 dbSNP
rs576242616 2973 dbSNP
rs1015440658 2975 dbSNP
rs1336249701 2984 dbSNP
rs961175350 2985 dbSNP
rs976844590 2986 dbSNP
rs4335580 2992 dbSNP
rs965792011 2998 dbSNP
rs753507966 3001 dbSNP
rs922709189 3004 dbSNP
rs1232122468 3012 dbSNP
rs189164167 3024 dbSNP
rs114841704 3025 dbSNP
rs985518085 3036 dbSNP
rs1189802188 3049 dbSNP
rs990073020 3058 dbSNP
rs925937357 3063 dbSNP
rs571428719 3074 dbSNP
rs1446772642 3088 dbSNP
rs576363364 3090 dbSNP
rs1482363068 3091 dbSNP
rs566735124 3096 dbSNP
rs989000072 3105 dbSNP
rs1211009132 3106 dbSNP
rs907298987 3109 dbSNP
rs1276118228 3135 dbSNP
rs913417164 3140 dbSNP
rs950248590 3144 dbSNP
rs1351210599 3145 dbSNP
rs1194248146 3147 dbSNP
rs1045857810 3150 dbSNP
rs906324444 3161 dbSNP
rs1357301116 3180 dbSNP
rs868797552 3181 dbSNP
rs1314771398 3183 dbSNP
rs559626651 3199 dbSNP
rs1375038858 3200 dbSNP
rs1054808632 3208 dbSNP
rs888072379 3212 dbSNP
rs778390946 3214 dbSNP
rs545045478 3215 dbSNP
rs1471869564 3217 dbSNP
rs1459329925 3219 dbSNP
rs1027192651 3220 dbSNP
rs1156734147 3224 dbSNP
rs1384064570 3227 dbSNP
rs1015489710 3231 dbSNP
rs897060027 3235 dbSNP
rs1299702698 3240 dbSNP
rs1353127141 3242 dbSNP
rs1447217529 3245 dbSNP
rs1283219307 3246 dbSNP
rs1413661350 3247 dbSNP
rs1293293729 3249 dbSNP
rs1336802429 3250 dbSNP
rs1356670901 3256 dbSNP
rs1004346781 3270 dbSNP
rs1233950606 3273 dbSNP
rs12573952 3278 dbSNP
rs527742128 3288 dbSNP
rs1301172755 3292 dbSNP
rs1433087172 3293 dbSNP
rs73564884 3296 dbSNP
rs1206039061 3298 dbSNP
rs1406591814 3298 dbSNP
rs997260999 3313 dbSNP
rs35020578 3314 dbSNP
rs1420629319 3318 dbSNP
rs1029107781 3332 dbSNP
rs1474594653 3334 dbSNP
rs953070414 3339 dbSNP
rs1187774471 3340 dbSNP
rs1475508082 3346 dbSNP
rs758277121 3348 dbSNP
rs567546047 3349 dbSNP
rs989775842 3363 dbSNP
rs1288467762 3366 dbSNP
rs150510748 3367 dbSNP
rs1187332890 3368 dbSNP
rs977271993 3372 dbSNP
rs1310604445 3379 dbSNP
rs1258391608 3383 dbSNP
rs1216436240 3398 dbSNP
rs777552209 3402 dbSNP
rs1297207019 3404 dbSNP
rs928470664 3405 dbSNP
rs957573331 3406 dbSNP
rs556301308 3408 dbSNP
rs1457789910 3409 dbSNP
rs1179631214 3418 dbSNP
rs1055876221 3442 dbSNP
rs1363133325 3455 dbSNP
rs915939444 3460 dbSNP
rs139944707 3464 dbSNP
rs548379486 3465 dbSNP
rs777960008 3467 dbSNP
rs780184825 3472 dbSNP
rs981612680 3474 dbSNP
rs927421207 3501 dbSNP
rs937779567 3505 dbSNP
rs1041224792 3507 dbSNP
rs1055261567 3514 dbSNP
rs901330635 3533 dbSNP
rs35577066 3537 dbSNP
rs68049927 3538 dbSNP
rs397798164 3541 dbSNP
rs1305523860 3542 dbSNP
rs200102240 3542 dbSNP
rs537872444 3543 dbSNP
rs941032897 3547 dbSNP
rs1366069385 3548 dbSNP
rs551055399 3563 dbSNP
rs1462036538 3571 dbSNP
rs1028744302 3579 dbSNP
rs1166178955 3580 dbSNP
rs1311847012 3590 dbSNP
rs1346155123 3592 dbSNP
rs1431279755 3593 dbSNP
rs953214127 3593 dbSNP
rs1252565220 3594 dbSNP
rs1177780147 3595 dbSNP
rs1480273322 3603 dbSNP
rs1251104332 3604 dbSNP
rs1011259403 3610 dbSNP
rs1021276567 3612 dbSNP
rs1281354906 3612 dbSNP
rs1232958180 3616 dbSNP
rs897112329 3617 dbSNP
rs967312515 3620 dbSNP
rs1281273753 3622 dbSNP
rs34762933 3624 dbSNP
rs1350424993 3628 dbSNP
rs1365262265 3628 dbSNP
rs144303191 3628 dbSNP
rs1464355313 3628 dbSNP
rs977324670 3628 dbSNP
rs571328861 3630 dbSNP
rs991694497 3630 dbSNP
rs533606962 3632 dbSNP
rs149435285 3636 dbSNP
rs1258474434 3637 dbSNP
rs59053527 3643 dbSNP
rs1200162978 3648 dbSNP
rs1482402521 3650 dbSNP
rs1249767479 3651 dbSNP
rs1262805314 3653 dbSNP
rs1006989537 3669 dbSNP
rs1048402352 3670 dbSNP
rs1287056882 3674 dbSNP
rs1234577516 3677 dbSNP
rs1033540323 3681 dbSNP
rs1332932511 3688 dbSNP
rs1393871021 3690 dbSNP
rs957434204 3691 dbSNP
rs1289193690 3694 dbSNP
rs1456548535 3697 dbSNP
rs1167088919 3703 dbSNP
rs1476226417 3705 dbSNP
rs530067068 3705 dbSNP
rs1393101421 3711 dbSNP
rs1422235097 3724 dbSNP
rs1264171557 3740 dbSNP
rs988812181 3741 dbSNP
rs1020237319 3742 dbSNP
rs1173921920 3745 dbSNP
rs113274835 3746 dbSNP
rs749492138 3750 dbSNP
rs1283035155 3753 dbSNP
rs377542406 3754 dbSNP
rs901380170 3759 dbSNP
rs997032756 3761 dbSNP
rs1434077145 3765 dbSNP
rs1297045026 3783 dbSNP
rs1327677121 3787 dbSNP
rs982064146 3794 dbSNP
rs186040470 3795 dbSNP
rs959096714 3796 dbSNP
rs1189525402 3797 dbSNP
rs984962039 3798 dbSNP
rs1246509817 3804 dbSNP
rs1195915669 3809 dbSNP
rs34346696 3810 dbSNP
rs1448246911 3812 dbSNP
rs888889391 3815 dbSNP
rs909645040 3819 dbSNP
rs147502721 3824 dbSNP
rs1036732761 3829 dbSNP
rs1251526580 3838 dbSNP
rs751525067 3839 dbSNP
rs1021331045 3841 dbSNP
rs1362601328 3848 dbSNP
rs1330426350 3850 dbSNP
rs200413487 3850 dbSNP
rs902843400 3850 dbSNP
rs918221926 3850 dbSNP
rs1233997603 3856 dbSNP
rs1385151120 3857 dbSNP
rs1398639935 3868 dbSNP
rs1169315222 3874 dbSNP
rs1429288348 3882 dbSNP
rs1388579203 3883 dbSNP
rs1302268670 3885 dbSNP
rs532992495 3887 dbSNP
rs1478591357 3897 dbSNP
rs1035617076 3903 dbSNP
rs1225337127 3922 dbSNP
rs774556811 3923 dbSNP
rs1440064870 3932 dbSNP
rs1244434884 3936 dbSNP
rs1251837935 3939 dbSNP
rs1480991621 3945 dbSNP
rs762423209 3946 dbSNP
rs1219571901 3962 dbSNP
rs960197437 3966 dbSNP
rs772640643 3969 dbSNP
rs576622286 3970 dbSNP
rs1200523348 3978 dbSNP
rs991352307 3982 dbSNP
rs566775 3984 dbSNP
rs952824946 3985 dbSNP
rs984160816 3989 dbSNP
rs565084296 3999 dbSNP
rs1054294001 4000 dbSNP
rs922891405 4009 dbSNP
rs893256126 4010 dbSNP
rs1471415227 4028 dbSNP
rs572546450 4029 dbSNP
rs1169296662 4033 dbSNP
rs1180786931 4034 dbSNP
rs369168370 4037 dbSNP
rs781040508 4038 dbSNP
rs1210299933 4045 dbSNP
rs140116343 4046 dbSNP
rs11600671 4048 dbSNP
rs1003141928 4056 dbSNP
rs1035041724 4059 dbSNP
rs1329736761 4062 dbSNP
rs529080976 4063 dbSNP
rs947155638 4067 dbSNP
rs1042826152 4068 dbSNP
rs538698937 4069 dbSNP
rs1358828824 4071 dbSNP
rs759367209 4073 dbSNP
rs146552673 4080 dbSNP
rs796726134 4080 dbSNP
rs1035738152 4082 dbSNP
rs895753117 4088 dbSNP
rs1390000412 4107 dbSNP
rs1013233637 4109 dbSNP
rs766736965 4111 dbSNP
rs572315017 4114 dbSNP
rs753503226 4116 dbSNP
rs1022830079 4124 dbSNP
rs562817755 4129 dbSNP
rs1181957536 4138 dbSNP
rs962460639 4139 dbSNP
rs1472236327 4148 dbSNP
rs1235418540 4152 dbSNP
rs1217646594 4153 dbSNP
rs1465229322 4155 dbSNP
rs1295120339 4161 dbSNP
rs1267427409 4162 dbSNP
rs983877826 4172 dbSNP
rs1318743766 4174 dbSNP
rs1292056013 4176 dbSNP
rs1228996096 4185 dbSNP
rs115219101 4188 dbSNP
rs78688254 4189 dbSNP
rs555224267 4192 dbSNP
rs976796645 4195 dbSNP
rs1333989418 4201 dbSNP
rs1366294274 4204 dbSNP
rs933674305 4205 dbSNP
rs922575856 4206 dbSNP
rs1456065119 4208 dbSNP
rs1050765962 4210 dbSNP
rs1164823266 4215 dbSNP
rs145434423 4229 dbSNP
rs527414621 4234 dbSNP
rs915452351 4236 dbSNP
rs942625711 4241 dbSNP
rs1054706264 4243 dbSNP
rs1247124001 4243 dbSNP
rs892934592 4244 dbSNP
rs1469734475 4252 dbSNP
rs902951226 4253 dbSNP
rs1010296379 4257 dbSNP
rs1222371182 4257 dbSNP
rs1041757345 4258 dbSNP
rs1230811698 4259 dbSNP
rs1478531586 4260 dbSNP
rs1433397175 4261 dbSNP
rs1370330080 4262 dbSNP
rs12285298 4266 dbSNP
rs1003308125 4272 dbSNP
rs1435129684 4280 dbSNP
rs1034349338 4281 dbSNP
rs1347548298 4285 dbSNP
rs1461323820 4287 dbSNP
rs1166087907 4290 dbSNP
rs1389202657 4294 dbSNP
rs1429942469 4294 dbSNP
rs1166453531 4296 dbSNP
rs959245429 4298 dbSNP
rs1006438807 4308 dbSNP
rs1016444235 4311 dbSNP
rs1288560959 4322 dbSNP
rs1341307356 4328 dbSNP
rs1487472490 4329 dbSNP
rs1401927892 4335 dbSNP
rs1245003597 4336 dbSNP
rs1207419507 4338 dbSNP
rs1012873518 4339 dbSNP
rs1483485289 4344 dbSNP
rs1291454289 4346 dbSNP
rs1226628281 4352 dbSNP
rs1314380844 4353 dbSNP
rs1354887803 4356 dbSNP
rs1044291046 4361 dbSNP
rs962180194 4363 dbSNP
rs755809444 4380 dbSNP
rs1025423896 4381 dbSNP
rs147704662 4387 dbSNP
rs1409948623 4397 dbSNP
rs955149308 4398 dbSNP
rs1286321129 4399 dbSNP
rs1489026488 4400 dbSNP
rs986905376 4406 dbSNP
rs910855648 4407 dbSNP
rs1175117462 4409 dbSNP
rs1256259215 4423 dbSNP
rs942617692 4427 dbSNP
rs990004587 4428 dbSNP
rs914421046 4437 dbSNP
rs945914412 4443 dbSNP
rs1041511605 4444 dbSNP
rs1472990335 4447 dbSNP
rs1251350132 4448 dbSNP
rs1416562414 4456 dbSNP
rs1417727444 4459 dbSNP
rs907335423 4461 dbSNP
rs1256909951 4463 dbSNP
rs191531227 4468 dbSNP
rs1421816742 4475 dbSNP
rs568623720 4477 dbSNP
rs1228458839 4478 dbSNP
rs1349412721 4484 dbSNP
rs915504933 4487 dbSNP
rs1397368272 4490 dbSNP
rs894436768 4491 dbSNP
rs1402507272 4495 dbSNP
rs1374970975 4496 dbSNP
rs537631424 4498 dbSNP
rs777525879 4500 dbSNP
rs1159902975 4505 dbSNP
rs1371046343 4510 dbSNP
rs898066173 4511 dbSNP
rs375884985 4512 dbSNP
rs1257174736 4513 dbSNP
rs1222998623 4515 dbSNP
rs934458519 4518 dbSNP
rs751496388 4520 dbSNP
rs1270573325 4525 dbSNP
rs570331143 4536 dbSNP
rs575927431 4538 dbSNP
rs1265651197 4539 dbSNP
rs948396372 4539 dbSNP
rs986530054 4541 dbSNP
rs1442542265 4552 dbSNP
rs1044009307 4554 dbSNP
rs1311634451 4554 dbSNP
rs888381207 4571 dbSNP
rs1367007335 4577 dbSNP
rs1239753496 4590 dbSNP
rs1320997147 4593 dbSNP
rs1456597042 4594 dbSNP
rs1005405880 4603 dbSNP
rs1178557013 4605 dbSNP
rs1459554253 4628 dbSNP
rs1381392535 4642 dbSNP
rs1441897819 4644 dbSNP
rs538959406 4650 dbSNP
rs1394656594 4651 dbSNP
rs963719455 4656 dbSNP
rs896972793 4659 dbSNP
rs998320400 4667 dbSNP
rs1464816519 4673 dbSNP
rs201811327 4680 dbSNP
rs1237605298 4682 dbSNP
rs1260321141 4683 dbSNP
rs1441457661 4683 dbSNP
rs951160417 4685 dbSNP
rs1378884946 4686 dbSNP
rs989763923 4689 dbSNP
rs558949530 4690 dbSNP
rs914512094 4696 dbSNP
rs1362918759 4698 dbSNP
rs572335615 4704 dbSNP
rs977257575 4711 dbSNP
rs1391457659 4726 dbSNP
rs557536808 4751 dbSNP
rs1422930425 4752 dbSNP
rs928452419 4778 dbSNP
rs1169598314 4781 dbSNP
rs1449299678 4787 dbSNP
rs1371839278 4794 dbSNP
rs200769754 4811 dbSNP
rs1452703993 4814 dbSNP
rs1270344388 4825 dbSNP
rs938767150 4842 dbSNP
rs1198616626 4847 dbSNP
rs1227380148 4851 dbSNP
rs201391002 4861 dbSNP
rs1239299646 4863 dbSNP
rs1276403423 4863 dbSNP
rs1233812191 4865 dbSNP
rs3839948 4865 dbSNP
rs61676551 4865 dbSNP
rs759170633 4865 dbSNP
rs773535468 4865 dbSNP
rs567166657 4867 dbSNP
rs115272620 4869 dbSNP
rs1055859872 4875 dbSNP
rs541567381 4876 dbSNP
rs1478443515 4878 dbSNP
rs1174527044 4882 dbSNP
rs1417546170 4883 dbSNP
rs1429348939 4893 dbSNP
rs200521721 4899 dbSNP
rs894479645 4902 dbSNP
rs1174697463 4909 dbSNP
rs1478621922 4911 dbSNP
rs555124065 4916 dbSNP
rs1465143861 4917 dbSNP
rs1252083563 4918 dbSNP
rs1171360024 4921 dbSNP
rs574951322 4922 dbSNP
rs1435732215 4925 dbSNP
rs1438481261 4926 dbSNP
rs1200863457 4932 dbSNP
rs140849571 4933 dbSNP
rs1281365188 4935 dbSNP
rs1221754946 4942 dbSNP
rs1352338711 4943 dbSNP
rs1331459947 4944 dbSNP
rs201392323 4948 dbSNP
rs1438252449 4959 dbSNP
rs140707307 4963 dbSNP
rs961160381 4964 dbSNP
rs562500347 4973 dbSNP
rs1459289112 4975 dbSNP
rs553056256 4977 dbSNP
rs1411985802 4985 dbSNP
rs71486256 4992 dbSNP
rs993717037 4995 dbSNP
rs142247252 4996 dbSNP
rs890607479 4997 dbSNP
rs181524303 4998 dbSNP
rs1187982913 5011 dbSNP
rs1018053828 5017 dbSNP
rs964117892 5018 dbSNP
rs941315814 5021 dbSNP
rs1036907154 5024 dbSNP
rs1268805961 5027 dbSNP
rs1452548411 5031 dbSNP
rs1201333789 5037 dbSNP
rs1011235200 5046 dbSNP
rs1371430696 5049 dbSNP
rs1021236977 5053 dbSNP
rs1449209165 5054 dbSNP
rs1382408550 5059 dbSNP
rs564921296 5068 dbSNP
rs1437843257 5075 dbSNP
rs1390068717 5077 dbSNP
rs1157743237 5085 dbSNP
rs496235 5088 dbSNP
rs527308758 5089 dbSNP
rs1398509341 5092 dbSNP
rs1050919937 5098 dbSNP
rs1194429099 5099 dbSNP
rs546951862 5102 dbSNP
rs1006962677 5110 dbSNP
rs1459863571 5111 dbSNP
rs1247401030 5115 dbSNP
rs1215145872 5116 dbSNP
rs1292122813 5117 dbSNP
rs1181970294 5122 dbSNP
rs573111310 5123 dbSNP
rs1391236045 5126 dbSNP
rs186275633 5127 dbSNP
rs771400306 5128 dbSNP
rs916020918 5129 dbSNP
rs1325444271 5130 dbSNP
rs1400081644 5140 dbSNP
rs942085896 5142 dbSNP
rs191126460 5145 dbSNP
rs1353012460 5147 dbSNP
rs1232075453 5157 dbSNP
rs1284095973 5160 dbSNP
rs1357555918 5161 dbSNP
rs1323666838 5162 dbSNP
rs1383042216 5163 dbSNP
rs10576984 5164 dbSNP
rs1170231185 5164 dbSNP
rs1248480340 5164 dbSNP
rs1489431627 5164 dbSNP
rs558332580 5164 dbSNP
rs71063555 5164 dbSNP
rs766098471 5164 dbSNP
rs767117033 5164 dbSNP
rs776090967 5164 dbSNP
rs796545936 5164 dbSNP
rs1222446444 5165 dbSNP
rs1211956092 5166 dbSNP
rs1282461569 5167 dbSNP
rs1289938413 5168 dbSNP
rs1231065300 5169 dbSNP
rs1343234555 5171 dbSNP
rs1295319977 5177 dbSNP
rs903850296 5178 dbSNP
rs1791801 5179 dbSNP
rs201816653 5181 dbSNP
rs919221231 5182 dbSNP
rs929564676 5184 dbSNP
rs1051995250 5186 dbSNP
rs1309544946 5187 dbSNP
rs1430010873 5188 dbSNP
rs1474248807 5188 dbSNP
rs1168088554 5190 dbSNP
rs1003897902 5191 dbSNP
rs999485271 5192 dbSNP
rs182151103 5195 dbSNP
rs1368932361 5201 dbSNP
rs1266869838 5213 dbSNP
rs1473672353 5215 dbSNP
rs1483515401 5215 dbSNP
rs1156520461 5225 dbSNP
rs1202909873 5231 dbSNP
rs1007752215 5248 dbSNP
rs779138506 5259 dbSNP
rs1314433372 5261 dbSNP
rs1280025760 5271 dbSNP
rs619710 5281 dbSNP
rs1222373318 5285 dbSNP
rs187937742 5288 dbSNP
rs45478598 5302 dbSNP
rs45481404 5305 dbSNP
rs899612900 5308 dbSNP
rs190853290 5314 dbSNP
rs1372198263 5323 dbSNP
rs1299651907 5330 dbSNP
rs1056201 5332 dbSNP
rs970239345 5344 dbSNP
rs1011245028 5345 dbSNP
rs979813591 5346 dbSNP
rs775917000 5349 dbSNP
rs1312664963 5363 dbSNP
rs1468180470 5366 dbSNP
rs1427223863 5376 dbSNP
rs1184472804 5390 dbSNP
rs1473021991 5391 dbSNP
rs1250136466 5395 dbSNP
rs558965564 5397 dbSNP
rs1175837804 5399 dbSNP
rs1484483476 5409 dbSNP
rs1341554654 5413 dbSNP
rs1203530044 5422 dbSNP
rs909591571 5423 dbSNP
rs1228515602 5429 dbSNP
rs941033488 5431 dbSNP
rs1304501111 5432 dbSNP
rs1353430981 5432 dbSNP
rs1397418839 5435 dbSNP
rs1241200650 5457 dbSNP
rs566336477 5458 dbSNP
rs998741937 5462 dbSNP
rs1161431869 5463 dbSNP
rs1363435721 5463 dbSNP
rs1454423800 5463 dbSNP
rs1157108837 5466 dbSNP
rs1199899687 5466 dbSNP
rs1183403464 5467 dbSNP
rs1244077562 5467 dbSNP
rs1035639952 5468 dbSNP
rs1243560507 5468 dbSNP
rs1256658973 5468 dbSNP
rs1491056107 5468 dbSNP
rs375975960 5468 dbSNP
rs564255218 5468 dbSNP
rs61107073 5468 dbSNP
rs752208978 5468 dbSNP
rs796439358 5468 dbSNP
rs918513129 5469 dbSNP
rs1321218568 5470 dbSNP
rs933901683 5470 dbSNP
rs1384274233 5471 dbSNP
rs1179552479 5472 dbSNP
rs1163320979 5473 dbSNP
rs1379533239 5473 dbSNP
rs1392419398 5474 dbSNP
rs960210379 5474 dbSNP
rs889617080 5475 dbSNP
rs991373339 5475 dbSNP
rs1043834550 5476 dbSNP
rs915695950 5476 dbSNP
rs1298080163 5477 dbSNP
rs535033175 5477 dbSNP
rs999538990 5477 dbSNP
rs1030976543 5478 dbSNP
rs866898446 5478 dbSNP
rs1366416813 5479 dbSNP
rs1491435014 5479 dbSNP
rs45535537 5479 dbSNP
rs202140184 5480 dbSNP
rs372062595 5480 dbSNP
rs77004081 5480 dbSNP
rs2511235 5481 dbSNP
rs377572913 5481 dbSNP
rs777030586 5481 dbSNP
rs202166564 5482 dbSNP
rs929323563 5483 dbSNP
rs1392827868 5484 dbSNP
rs1273397591 5485 dbSNP
rs45440104 5489 dbSNP
rs200528829 5490 dbSNP
rs1337346608 5497 dbSNP
rs1302852194 5500 dbSNP
rs1403556686 5502 dbSNP
rs1398366641 5504 dbSNP
rs1329868634 5506 dbSNP
rs1052182698 5511 dbSNP
rs748196132 5514 dbSNP
rs912187536 5529 dbSNP
rs1352600991 5556 dbSNP
rs1329938197 5560 dbSNP
rs943608828 5561 dbSNP
rs1311777360 5562 dbSNP
rs1409810447 5567 dbSNP
rs1310592418 5571 dbSNP
rs1232637550 5574 dbSNP
rs183361753 5578 dbSNP
rs543932580 5579 dbSNP
rs1194050662 5580 dbSNP
rs1196691767 5583 dbSNP
rs58885922 5584 dbSNP
rs984885844 5588 dbSNP
rs576132770 5589 dbSNP
rs1180810929 5593 dbSNP
rs1435934519 5600 dbSNP
rs1204163569 5602 dbSNP
rs772726690 5603 dbSNP
rs1458065995 5616 dbSNP
rs140863720 5622 dbSNP
rs565045538 5629 dbSNP
rs571965868 5631 dbSNP
rs1280425390 5643 dbSNP
rs895741611 5644 dbSNP
rs918242675 5657 dbSNP
rs1013210687 5674 dbSNP
rs1336583447 5675 dbSNP
rs986730513 5678 dbSNP
rs911087280 5683 dbSNP
rs1173609627 5688 dbSNP
rs540628520 5700 dbSNP
rs1043548267 5702 dbSNP
rs1378899833 5705 dbSNP
rs963180780 5708 dbSNP
rs973221704 5709 dbSNP
rs1468299263 5711 dbSNP
rs543846634 5716 dbSNP
rs1169189549 5722 dbSNP
rs1026426951 5723 dbSNP
rs1460796920 5724 dbSNP
rs950778170 5739 dbSNP
rs1241261583 5745 dbSNP
rs561557921 5759 dbSNP
rs1400155629 5762 dbSNP
rs987521623 5763 dbSNP
rs773633605 5765 dbSNP
rs1052892179 5766 dbSNP
rs1223384417 5769 dbSNP
rs896477342 5780 dbSNP
rs1317575774 5781 dbSNP
rs1247235932 5783 dbSNP
rs1333714136 5794 dbSNP
rs374168949 5801 dbSNP
rs1014292768 5802 dbSNP
rs45564431 5806 dbSNP
rs1345209365 5828 dbSNP
rs943636089 5828 dbSNP
rs560542881 5829 dbSNP
rs79232157 5833 dbSNP
rs1163966808 5834 dbSNP
rs1443849399 5837 dbSNP
rs376203798 5841 dbSNP
rs1190367574 5842 dbSNP
rs1475714238 5848 dbSNP
rs747548610 5849 dbSNP
rs1445473531 5859 dbSNP
rs1223688352 5868 dbSNP
rs563936840 5876 dbSNP
rs962461571 5880 dbSNP
rs530660811 5884 dbSNP
rs1428107403 5888 dbSNP
rs934372330 5894 dbSNP
rs188821341 5902 dbSNP
rs1303309544 5903 dbSNP
rs564745684 5914 dbSNP
rs1363428167 5915 dbSNP
rs552703942 5916 dbSNP
rs1410436076 5920 dbSNP
rs895449742 5923 dbSNP
rs1191460743 5927 dbSNP
rs1185991649 5928 dbSNP
rs192872548 5933 dbSNP
rs986836286 5935 dbSNP
rs776997824 5940 dbSNP
rs377061496 5974 dbSNP
rs566385318 5989 dbSNP
rs1022919238 5990 dbSNP
rs1290002201 5998 dbSNP
rs899065102 6005 dbSNP
rs994714700 6006 dbSNP
rs759194866 6008 dbSNP
rs535292232 6012 dbSNP
rs548652302 6019 dbSNP
rs764832199 6020 dbSNP
rs568458264 6021 dbSNP
rs1163741603 6025 dbSNP
rs1018963093 6026 dbSNP
rs965041098 6043 dbSNP
rs376636239 6050 dbSNP
rs1343299850 6053 dbSNP
rs974757704 6058 dbSNP
rs1462358182 6059 dbSNP
rs1348539192 6071 dbSNP
rs949420944 6073 dbSNP
rs1168156225 6076 dbSNP
rs556945872 6082 dbSNP
rs557194462 6083 dbSNP
rs905471441 6090 dbSNP
rs532193575 6091 dbSNP
rs924072997 6095 dbSNP
rs1481125498 6103 dbSNP
rs1006411934 6119 dbSNP
rs934445626 6126 dbSNP
rs1341197988 6134 dbSNP
rs1202974597 6147 dbSNP
rs1326318338 6154 dbSNP
rs1037864756 6158 dbSNP
rs1222425055 6162 dbSNP
rs544000400 6164 dbSNP
rs577231009 6165 dbSNP
rs1372276299 6166 dbSNP
rs763625165 6188 dbSNP
rs114749149 6189 dbSNP
rs1044085250 6191 dbSNP
rs1337451933 6210 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguUUGGUAAUACACGACGAu 5'
              || :|| || ||||||| 
Target 5' ----AAAUAUCAU-UGCUGCUu 3'
1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000335953.4 | 3UTR | AAAUAUCAUUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000335953.4 | 3UTR | UAAAUAUCAUUGCUGCUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21032 Prostate cancer -0.317 1.8e-3 -0.211 2.8e-2 83 Click to see details
GSE32688 Pancreatic cancer -0.487 2.4e-3 -0.243 9.0e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.595 2.8e-3 -0.741 9.3e-5 20 Click to see details
GSE14794 Lymphoblastoid cells 0.244 1.0e-2 0.255 7.6e-3 90 Click to see details
GSE38226 Liver fibrosis -0.49 1.2e-2 -0.352 5.9e-2 21 Click to see details
GSE17306 Multiple myeloma -0.303 1.7e-2 -0.344 7.8e-3 49 Click to see details
GSE42095 Differentiated embryonic stem cells -0.327 6.4e-2 -0.191 1.9e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.29 8.5e-2 0.307 7.2e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.226 1.4e-1 -0.257 1.1e-1 25 Click to see details
GSE28260 Renal cortex and medulla 0.315 1.5e-1 0.335 1.3e-1 13 Click to see details
GSE28544 Breast cancer -0.176 2.1e-1 -0.333 5.6e-2 24 Click to see details
GSE19350 CNS germ cell tumors 0.209 2.6e-1 0.161 3.1e-1 12 Click to see details
GSE17498 Multiple myeloma 0.101 2.7e-1 0.015 4.6e-1 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.13 2.9e-1 0.023 4.6e-1 20 Click to see details
GSE21849 B cell lymphoma 0.082 3.4e-1 0.157 2.1e-1 29 Click to see details
GSE21687 Ependynoma primary tumors 0.053 3.4e-1 0.001 5.0e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.037 3.7e-1 0.086 2.3e-1 79 Click to see details
GSE19536 Breast cancer 0.021 4.2e-1 0.083 2.1e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.014 4.7e-1 -0.031 4.4e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.002 5.0e-1 -0.085 3.8e-1 16 Click to see details
GSE27834 Pluripotent stem cells -0.002 5.0e-1 -0.085 3.8e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.737 0 -0.764 0 32 Click to see details
BLCA -0.529 0.01 -0.556 0.01 18 Click to see details
KIRC -0.249 0.02 -0.287 0.01 68 Click to see details
HNSC -0.253 0.05 -0.332 0.02 42 Click to see details
THCA -0.174 0.09 -0.231 0.04 59 Click to see details
CHOL -0.444 0.12 -0.400 0.14 9 Click to see details
LUSC 0.15 0.18 0.093 0.29 38 Click to see details
BRCA 0.086 0.22 0.078 0.24 84 Click to see details
COAD 0.322 0.22 0.143 0.37 8 Click to see details
PRAD 0.109 0.23 0.113 0.22 50 Click to see details
UCEC -0.168 0.25 -0.042 0.43 19 Click to see details
KICH -0.121 0.28 -0.085 0.34 25 Click to see details
PCPG 0.6 0.3 0.500 0.33 3 Click to see details
LUAD -0.124 0.35 -0.203 0.26 12 Click to see details
PAAD -0.297 0.35 0.200 0.4 4 Click to see details
CESC -0.278 0.41 -0.500 0.33 3 Click to see details
LIHC 0.026 0.43 -0.009 0.48 49 Click to see details
ESCA -0.057 0.43 0.109 0.37 11 Click to see details
KIRP -0.006 0.49 -0.065 0.36 32 Click to see details
KIRP -0.006 0.49 -0.065 0.36 32 Click to see details
KIRP -0.006 0.49 -0.065 0.36 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1