miRTarBase - #MIRT564954 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol XKR7   
Synonyms C20orf159, dJ310O13.4
Description XK related 7
Transcript NM_001011718   
Expression
Putative miRNA Targets on XKR7
3'UTR of XKR7
(miRNA target sites are highlighted)
>XKR7|NM_001011718|3'UTR
   1 GCTACAGTGTCCCAGCACAAAAGGGACAGGCTTGGCTGATCCCACATCCGCCGCAGTGTTGTGCCCCGAATTTCAGGGCC
  81 ACCAGGCTAAGGGGGAGTGGATCTGTTGGTCCAAGGGTAGAGTGGCCCCACTCTTGGGTTCTTTCAGGGGAGGGGGCAGC
 161 CTTGCGGAGGCCCCAGCCCTGGGCCCCGTTTTCAGCCTTGTGGCCCATTCCCTAAATTCCCCTGACCCAGGGCCTGGGGA
 241 ATCATCTGGTGCTACACTTTTCGAGCTGCCCTGCTTTCATGGGGCCTCCACACCTCTCCCCTGCCTGGCGTTGCCCATGT
 321 GTTGCCCCTGCTGGACTTGCCAGAGAAAGGGCACTGTCTGGGGTCCATGACCTAGACCCTGTGCTCCTCAGGGGTTGTGG
 401 AGAGTGGGCTGCCTCTATGGTGGGAAAAGATCTCTGAGAAGGATGGAGGTGGCCGTGGAAGGGATGGGGTGAGGTTGGAG
 481 CATTGTGTGGACAGGGATGGCGTGGCTCCTGTAGCATCTGAGGCCTGGAGCCAGGGCAAGAGGGAGCTGAAGAAGGGAGT
 561 TGGGGTGGGGCAGGGTGTTGGGGTGGGGGGCTGGCAGTGCTGGAGATGGATAGGAGAAAGAACTGGGGGGGGGGTCTAGG
 641 CTGGCAGAAGCATGGAGGGGTGGAAGACTTGGGGGAGGGGAACCTGCAATCCAGAGCATAGCGAACAAGAATGAACTCCT
 721 TAGGAGACGTCTCTTGTTGTGTTGTGGGCTCTGTGAAGGATGAAGTTCCACACACCTCAGGTGAAATGTTTGAAGGAGCC
 801 ATTTTTTGTTCTAGATGTGCACCTGGAACGTGGCTTCTAGATACAGGTCTTCAACACAGCAGATAAGATGTCTGGAAAGA
 881 TCTCTGGGCTCAAGTGCAGGTGAGGTTTTAGCACAGTTATCAGAGGAACTGATCCAGAAGCAGGCTTAGTTCTAGATTGA
 961 GTTCTAGAGTGCTAGGCTGATAAAATGTCCCAGGGAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|:|||    |||||| || 
Target 5' ccTAGACC---CTGTGCTCCTc 3'
371 - 389 125.00 -11.00
2
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  || || || |||| 
Target 5' cctggggaATCATCTGGTGCTa 3'
233 - 254 122.00 -10.40
3
miRNA  3' guguuugGUAA----UACACGACGau 5'
                 |:||    |||||:|||  
Target 5' tgcctggCGTTGCCCATGTGTTGCcc 3'
302 - 327 121.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31494464 14 COSMIC
COSN31511637 28 COSMIC
COSN32053756 35 COSMIC
COSN27005306 63 COSMIC
COSN31936250 76 COSMIC
COSN15701801 88 COSMIC
COSN31510162 125 COSMIC
COSN30175132 149 COSMIC
COSN31611072 157 COSMIC
COSN16642499 167 COSMIC
COSN20093747 200 COSMIC
COSN31520637 433 COSMIC
COSN28813781 503 COSMIC
COSN7089080 547 COSMIC
COSN25696468 657 COSMIC
COSN25231914 662 COSMIC
COSN8345796 664 COSMIC
COSN25171917 677 COSMIC
COSN6686515 765 COSMIC
COSN21755567 953 COSMIC
COSN21560492 990 COSMIC
COSN16522028 1116 COSMIC
COSN23628228 1512 COSMIC
COSN20964351 1549 COSMIC
COSN19566780 1562 COSMIC
COSN15707782 1608 COSMIC
COSN2516958 1682 COSMIC
COSN1247489 1691 COSMIC
COSN16341971 2309 COSMIC
COSN7089081 2374 COSMIC
COSN19556645 2504 COSMIC
COSN17583667 2736 COSMIC
COSN4969516 2845 COSMIC
COSN20622764 2872 COSMIC
COSN7089082 3283 COSMIC
COSN24578047 4129 COSMIC
COSN22191798 4367 COSMIC
COSN25784336 4945 COSMIC
COSN29091117 4947 COSMIC
COSN5442891 5003 COSMIC
COSN1869650 5059 COSMIC
COSN21955802 5192 COSMIC
COSN5968652 5246 COSMIC
COSN5968653 5247 COSMIC
COSN16742512 5337 COSMIC
COSN19309465 5377 COSMIC
COSN20719016 5763 COSMIC
COSN1247490 5766 COSMIC
COSN21897535 5818 COSMIC
COSN1247491 5825 COSMIC
COSN9125641 5917 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374217597 6 dbSNP
rs367762023 9 dbSNP
rs751965129 11 dbSNP
rs757494890 13 dbSNP
rs781736817 14 dbSNP
rs552618949 16 dbSNP
rs371434198 20 dbSNP
rs1211814967 23 dbSNP
rs780073677 24 dbSNP
rs1260050774 26 dbSNP
rs1055934216 30 dbSNP
rs1458307519 42 dbSNP
rs58631939 50 dbSNP
rs368168464 51 dbSNP
rs778939074 53 dbSNP
rs947202834 54 dbSNP
rs1208260399 59 dbSNP
rs1279169271 61 dbSNP
rs761895117 61 dbSNP
rs1485680738 63 dbSNP
rs1265428952 65 dbSNP
rs1041500161 66 dbSNP
rs191137324 68 dbSNP
rs147263352 69 dbSNP
rs947255416 79 dbSNP
rs1207035110 84 dbSNP
rs1475027246 91 dbSNP
rs1269160265 92 dbSNP
rs565826002 94 dbSNP
rs1391774084 98 dbSNP
rs536437655 121 dbSNP
rs1329800919 124 dbSNP
rs1387962583 134 dbSNP
rs1432704920 141 dbSNP
rs1319528882 144 dbSNP
rs889095960 145 dbSNP
rs1173172376 146 dbSNP
rs1007596272 148 dbSNP
rs924555397 149 dbSNP
rs73244842 151 dbSNP
rs1376304292 154 dbSNP
rs1158916200 155 dbSNP
rs1465496605 163 dbSNP
rs576307138 166 dbSNP
rs972150546 167 dbSNP
rs537324423 172 dbSNP
rs1247460750 174 dbSNP
rs1344726438 184 dbSNP
rs558592824 185 dbSNP
rs970903074 188 dbSNP
rs1343527169 189 dbSNP
rs577152458 200 dbSNP
rs926889870 204 dbSNP
rs1037909231 208 dbSNP
rs76400543 215 dbSNP
rs1234040279 224 dbSNP
rs1366843651 225 dbSNP
rs1466253345 233 dbSNP
rs182290360 235 dbSNP
rs1318763058 237 dbSNP
rs898101014 240 dbSNP
rs73903698 244 dbSNP
rs1174289613 258 dbSNP
rs1435258347 258 dbSNP
rs766906431 263 dbSNP
rs6121304 264 dbSNP
rs1281501058 286 dbSNP
rs74872036 288 dbSNP
rs1041469272 290 dbSNP
rs1216409306 295 dbSNP
rs372890965 304 dbSNP
rs758128197 309 dbSNP
rs924501769 310 dbSNP
rs531030649 311 dbSNP
rs546463244 318 dbSNP
rs889079314 322 dbSNP
rs750576157 349 dbSNP
rs564657388 351 dbSNP
rs1343884852 352 dbSNP
rs976415582 372 dbSNP
rs1007892619 378 dbSNP
rs1037674037 381 dbSNP
rs1243574709 382 dbSNP
rs922268751 382 dbSNP
rs187752724 392 dbSNP
rs932379235 395 dbSNP
rs142377339 405 dbSNP
rs547455575 406 dbSNP
rs1049465560 407 dbSNP
rs1306297956 409 dbSNP
rs866778173 410 dbSNP
rs1431646817 413 dbSNP
rs1420283883 419 dbSNP
rs909669882 420 dbSNP
rs1384326375 427 dbSNP
rs899174932 429 dbSNP
rs1401425478 434 dbSNP
rs1370618149 436 dbSNP
rs1189022763 437 dbSNP
rs1472553237 446 dbSNP
rs1250198619 448 dbSNP
rs1207893516 450 dbSNP
rs1483774144 451 dbSNP
rs1323072617 452 dbSNP
rs1392947314 453 dbSNP
rs993556901 455 dbSNP
rs1026423682 456 dbSNP
rs1285741984 457 dbSNP
rs1233636344 458 dbSNP
rs1037858388 459 dbSNP
rs1286429724 469 dbSNP
rs1411549202 470 dbSNP
rs898055473 476 dbSNP
rs994170268 482 dbSNP
rs1403825668 490 dbSNP
rs970871944 491 dbSNP
rs895809146 495 dbSNP
rs1277483252 500 dbSNP
rs714604 503 dbSNP
rs374905084 514 dbSNP
rs1470792332 515 dbSNP
rs1232968583 517 dbSNP
rs529766327 534 dbSNP
rs968811380 545 dbSNP
rs1269882775 552 dbSNP
rs558192832 559 dbSNP
rs1213902404 562 dbSNP
rs1328266187 563 dbSNP
rs1213031755 567 dbSNP
rs1373893733 568 dbSNP
rs3918440 574 dbSNP
rs1274340744 576 dbSNP
rs548325949 577 dbSNP
rs1000004304 578 dbSNP
rs1326876556 580 dbSNP
rs1253371261 582 dbSNP
rs1386982857 585 dbSNP
rs1456912264 585 dbSNP
rs1031520548 586 dbSNP
rs1179923061 590 dbSNP
rs1171513970 591 dbSNP
rs1476781359 598 dbSNP
rs569796284 612 dbSNP
rs1193949514 613 dbSNP
rs1464153419 615 dbSNP
rs1245980258 621 dbSNP
rs1217598935 624 dbSNP
rs1217376459 625 dbSNP
rs1317482399 625 dbSNP
rs545512545 625 dbSNP
rs56374932 625 dbSNP
rs1431867004 626 dbSNP
rs1470525820 626 dbSNP
rs1332820783 627 dbSNP
rs1416654838 627 dbSNP
rs1161504474 628 dbSNP
rs1236675907 628 dbSNP
rs1415823491 629 dbSNP
rs761609991 630 dbSNP
rs977076512 631 dbSNP
rs1393325028 632 dbSNP
rs1390037597 633 dbSNP
rs1172170348 634 dbSNP
rs774566250 634 dbSNP
rs1258074969 636 dbSNP
rs1326382986 636 dbSNP
rs1204317962 639 dbSNP
rs1482135072 641 dbSNP
rs949211745 643 dbSNP
rs1334822583 651 dbSNP
rs1046154328 654 dbSNP
rs536883489 656 dbSNP
rs1235483098 657 dbSNP
rs761831853 660 dbSNP
rs866498008 662 dbSNP
rs1001834817 671 dbSNP
rs1408505819 672 dbSNP
rs1370614821 673 dbSNP
rs1232588457 677 dbSNP
rs953835868 683 dbSNP
rs1266029672 703 dbSNP
rs959608717 712 dbSNP
rs990144528 715 dbSNP
rs985120835 724 dbSNP
rs557363863 727 dbSNP
rs780534949 729 dbSNP
rs941132888 730 dbSNP
rs1250034536 734 dbSNP
rs1438580783 739 dbSNP
rs1488297611 743 dbSNP
rs1263855238 756 dbSNP
rs1184672669 762 dbSNP
rs714605 765 dbSNP
rs977129959 766 dbSNP
rs1227105034 769 dbSNP
rs1166205536 779 dbSNP
rs1308551867 782 dbSNP
rs1391413539 783 dbSNP
rs769708317 789 dbSNP
rs1460739475 795 dbSNP
rs1442638017 799 dbSNP
rs933153883 800 dbSNP
rs1158075288 801 dbSNP
rs1167724995 802 dbSNP
rs1365429285 803 dbSNP
rs1159956619 808 dbSNP
rs1432726349 811 dbSNP
rs1265321844 812 dbSNP
rs1195807929 823 dbSNP
rs1397706081 824 dbSNP
rs59937477 830 dbSNP
rs545930469 843 dbSNP
rs943271482 856 dbSNP
rs1413634790 858 dbSNP
rs1353495894 861 dbSNP
rs1313267433 862 dbSNP
rs948680047 867 dbSNP
rs1038040457 869 dbSNP
rs1300614552 870 dbSNP
rs1044432821 880 dbSNP
rs1342228628 882 dbSNP
rs1371195252 883 dbSNP
rs7509036 884 dbSNP
rs1319684114 886 dbSNP
rs1380264817 888 dbSNP
rs1386843820 895 dbSNP
rs1289414507 897 dbSNP
rs1393361965 898 dbSNP
rs1175524211 906 dbSNP
rs904577233 909 dbSNP
rs749020596 913 dbSNP
rs1231709812 920 dbSNP
rs1389729364 926 dbSNP
rs1186882015 942 dbSNP
rs552904366 947 dbSNP
rs574515220 951 dbSNP
rs1250531173 954 dbSNP
rs865808514 955 dbSNP
rs1262856993 958 dbSNP
rs1031463670 972 dbSNP
rs993525482 976 dbSNP
rs891619784 985 dbSNP
rs1277584311 986 dbSNP
rs1047833672 992 dbSNP
rs1342682742 999 dbSNP
rs376936793 1002 dbSNP
rs998063408 1007 dbSNP
rs1224753020 1018 dbSNP
rs1328051360 1020 dbSNP
rs1296011865 1025 dbSNP
rs1278466283 1038 dbSNP
rs1395387211 1039 dbSNP
rs79718817 1043 dbSNP
rs1188779554 1049 dbSNP
rs1258818774 1051 dbSNP
rs1435468293 1052 dbSNP
rs1427224088 1059 dbSNP
rs1193154056 1060 dbSNP
rs192838018 1064 dbSNP
rs985068531 1077 dbSNP
rs1016569137 1084 dbSNP
rs1374011153 1092 dbSNP
rs150917689 1093 dbSNP
rs1422616887 1095 dbSNP
rs1260173288 1109 dbSNP
rs768773980 1110 dbSNP
rs1485737141 1114 dbSNP
rs774584568 1115 dbSNP
rs1033816345 1116 dbSNP
rs1340957622 1119 dbSNP
rs959817161 1122 dbSNP
rs139405821 1123 dbSNP
rs1373254253 1126 dbSNP
rs1243731506 1139 dbSNP
rs1353306479 1147 dbSNP
rs111763508 1154 dbSNP
rs1295095315 1165 dbSNP
rs879760715 1169 dbSNP
rs1433505805 1170 dbSNP
rs564789727 1173 dbSNP
rs1326866106 1174 dbSNP
rs1411875098 1182 dbSNP
rs1397437016 1186 dbSNP
rs1163068186 1188 dbSNP
rs968348635 1194 dbSNP
rs977097440 1208 dbSNP
rs368826639 1211 dbSNP
rs1403782142 1219 dbSNP
rs924283984 1248 dbSNP
rs6121305 1251 dbSNP
rs184793125 1255 dbSNP
rs1472544008 1258 dbSNP
rs1231827882 1259 dbSNP
rs540928872 1270 dbSNP
rs11381427 1273 dbSNP
rs397831021 1282 dbSNP
rs910362126 1289 dbSNP
rs1332491384 1292 dbSNP
rs936026209 1295 dbSNP
rs369272804 1296 dbSNP
rs1037609853 1315 dbSNP
rs1230359057 1320 dbSNP
rs920541944 1326 dbSNP
rs1301469583 1327 dbSNP
rs1277890438 1328 dbSNP
rs1444408770 1330 dbSNP
rs1347462423 1331 dbSNP
rs1323188654 1334 dbSNP
rs929287842 1335 dbSNP
rs1397219035 1342 dbSNP
rs1166033863 1345 dbSNP
rs762101283 1345 dbSNP
rs188550948 1346 dbSNP
rs373054681 1347 dbSNP
rs906538042 1350 dbSNP
rs548291546 1351 dbSNP
rs576650915 1364 dbSNP
rs1451657333 1367 dbSNP
rs998414394 1383 dbSNP
rs1254653244 1389 dbSNP
rs1214052454 1392 dbSNP
rs1446385711 1398 dbSNP
rs1282128869 1401 dbSNP
rs1225367841 1402 dbSNP
rs1055644549 1403 dbSNP
rs895305544 1409 dbSNP
rs1232388922 1413 dbSNP
rs1373385611 1418 dbSNP
rs1327020162 1424 dbSNP
rs1434891637 1426 dbSNP
rs1343770989 1430 dbSNP
rs1192174168 1431 dbSNP
rs1401777954 1432 dbSNP
rs1428472702 1443 dbSNP
rs1317968684 1450 dbSNP
rs889675661 1451 dbSNP
rs150051287 1454 dbSNP
rs1452223830 1456 dbSNP
rs1016519854 1462 dbSNP
rs1022543543 1475 dbSNP
rs1485447077 1484 dbSNP
rs902734783 1493 dbSNP
rs1378859820 1497 dbSNP
rs999740919 1498 dbSNP
rs1031269473 1499 dbSNP
rs962343582 1512 dbSNP
rs761331578 1514 dbSNP
rs369233167 1520 dbSNP
rs1025794637 1526 dbSNP
rs115189320 1527 dbSNP
rs993384423 1532 dbSNP
rs1432114927 1536 dbSNP
rs1323603675 1548 dbSNP
rs1311773602 1566 dbSNP
rs1370037127 1567 dbSNP
rs1432385484 1567 dbSNP
rs1376714083 1569 dbSNP
rs917426096 1569 dbSNP
rs948917286 1570 dbSNP
rs201208097 1571 dbSNP
rs980342879 1571 dbSNP
rs11477689 1572 dbSNP
rs113316932 1573 dbSNP
rs1185668016 1573 dbSNP
rs773904845 1577 dbSNP
rs1238435641 1579 dbSNP
rs867820190 1579 dbSNP
rs1020440093 1580 dbSNP
rs750312160 1580 dbSNP
rs1292027101 1581 dbSNP
rs1269264734 1582 dbSNP
rs1466663782 1584 dbSNP
rs964567946 1584 dbSNP
rs552046400 1585 dbSNP
rs1352364365 1586 dbSNP
rs145353353 1586 dbSNP
rs778543411 1587 dbSNP
rs967491734 1587 dbSNP
rs866134561 1588 dbSNP
rs1252748657 1590 dbSNP
rs1489051185 1592 dbSNP
rs1191349118 1594 dbSNP
rs983378999 1595 dbSNP
rs1269042151 1596 dbSNP
rs1416745439 1598 dbSNP
rs1157776389 1602 dbSNP
rs55960001 1608 dbSNP
rs1458725632 1609 dbSNP
rs889623288 1628 dbSNP
rs939379777 1629 dbSNP
rs1205453652 1632 dbSNP
rs1055209857 1636 dbSNP
rs895262521 1637 dbSNP
rs1336018294 1645 dbSNP
rs377036716 1648 dbSNP
rs1390265073 1651 dbSNP
rs1370496420 1655 dbSNP
rs1436935187 1661 dbSNP
rs1299592259 1667 dbSNP
rs1447045673 1674 dbSNP
rs1295447537 1684 dbSNP
rs1393473783 1685 dbSNP
rs1371482673 1695 dbSNP
rs994212379 1698 dbSNP
rs1418421724 1702 dbSNP
rs1390851560 1710 dbSNP
rs1044250036 1712 dbSNP
rs1158257156 1725 dbSNP
rs1417451858 1725 dbSNP
rs1410251633 1727 dbSNP
rs1289042924 1728 dbSNP
rs1331384144 1736 dbSNP
rs902703659 1740 dbSNP
rs1231994685 1750 dbSNP
rs999709568 1751 dbSNP
rs1025329455 1762 dbSNP
rs1322640148 1767 dbSNP
rs552867613 1773 dbSNP
rs1215902042 1780 dbSNP
rs369759273 1783 dbSNP
rs1479308289 1785 dbSNP
rs1029893420 1787 dbSNP
rs890106097 1790 dbSNP
rs1009013227 1797 dbSNP
rs111588450 1805 dbSNP
rs964776089 1812 dbSNP
rs1314677142 1819 dbSNP
rs1308444282 1822 dbSNP
rs1240423267 1827 dbSNP
rs1369730604 1834 dbSNP
rs1323669327 1841 dbSNP
rs1442890226 1844 dbSNP
rs1391147655 1853 dbSNP
rs973182825 1855 dbSNP
rs1181068753 1856 dbSNP
rs192160836 1861 dbSNP
rs112053406 1865 dbSNP
rs369854344 1866 dbSNP
rs1185622346 1872 dbSNP
rs1347055843 1890 dbSNP
rs983356442 1892 dbSNP
rs927902149 1893 dbSNP
rs1159837328 1900 dbSNP
rs1454023548 1902 dbSNP
rs1393452405 1909 dbSNP
rs1195712041 1914 dbSNP
rs763681968 1915 dbSNP
rs1412993103 1921 dbSNP
rs575686550 1926 dbSNP
rs991191009 1927 dbSNP
rs1487097904 1932 dbSNP
rs1166692280 1935 dbSNP
rs916594718 1940 dbSNP
rs1346486886 1941 dbSNP
rs1300854055 1942 dbSNP
rs989193699 1946 dbSNP
rs946763232 1948 dbSNP
rs1331528935 1953 dbSNP
rs913233417 1956 dbSNP
rs1294519163 1959 dbSNP
rs1043808471 1967 dbSNP
rs1461659645 1968 dbSNP
rs1308937964 1975 dbSNP
rs1051179088 1987 dbSNP
rs924094213 1991 dbSNP
rs935529916 2000 dbSNP
rs114201825 2010 dbSNP
rs891415982 2017 dbSNP
rs374037022 2020 dbSNP
rs531141561 2024 dbSNP
rs1007144868 2036 dbSNP
rs1039074388 2037 dbSNP
rs942516713 2041 dbSNP
rs1038192735 2042 dbSNP
rs1293164886 2044 dbSNP
rs900177501 2045 dbSNP
rs898396536 2048 dbSNP
rs994968814 2049 dbSNP
rs1187820380 2051 dbSNP
rs994103843 2053 dbSNP
rs1047137405 2054 dbSNP
rs1380572547 2055 dbSNP
rs1345210502 2060 dbSNP
rs896147273 2061 dbSNP
rs1013709190 2065 dbSNP
rs1403537828 2069 dbSNP
rs1327959067 2073 dbSNP
rs558020205 2074 dbSNP
rs1027427632 2086 dbSNP
rs1230574922 2090 dbSNP
rs573496726 2099 dbSNP
rs1023371981 2105 dbSNP
rs1307339229 2108 dbSNP
rs751263361 2110 dbSNP
rs969155789 2113 dbSNP
rs540893861 2124 dbSNP
rs1203990149 2128 dbSNP
rs767075452 2131 dbSNP
rs1004760544 2135 dbSNP
rs1164905520 2138 dbSNP
rs1474481740 2142 dbSNP
rs1208128100 2150 dbSNP
rs146449029 2151 dbSNP
rs957816101 2163 dbSNP
rs749934538 2167 dbSNP
rs960875323 2169 dbSNP
rs756053858 2177 dbSNP
rs990766413 2178 dbSNP
rs1232607274 2192 dbSNP
rs955397669 2198 dbSNP
rs1295220911 2200 dbSNP
rs767899926 2200 dbSNP
rs1417125014 2204 dbSNP
rs376178391 2207 dbSNP
rs968100022 2210 dbSNP
rs979473116 2226 dbSNP
rs1393350138 2238 dbSNP
rs184464298 2240 dbSNP
rs935498689 2243 dbSNP
rs986784867 2245 dbSNP
rs374064062 2246 dbSNP
rs942808841 2253 dbSNP
rs541892999 2256 dbSNP
rs1169402611 2268 dbSNP
rs1051166111 2272 dbSNP
rs929833928 2273 dbSNP
rs560071699 2275 dbSNP
rs942917057 2276 dbSNP
rs1039972427 2278 dbSNP
rs1212788072 2282 dbSNP
rs1466950735 2296 dbSNP
rs1275014376 2300 dbSNP
rs1450796719 2300 dbSNP
rs900146770 2305 dbSNP
rs779909992 2308 dbSNP
rs896418360 2310 dbSNP
rs949068310 2314 dbSNP
rs1361614466 2315 dbSNP
rs1048842498 2317 dbSNP
rs904920125 2330 dbSNP
rs1000620392 2345 dbSNP
rs1343895235 2346 dbSNP
rs886151847 2350 dbSNP
rs1004644416 2358 dbSNP
rs1442561380 2363 dbSNP
rs1212069764 2367 dbSNP
rs563306204 2373 dbSNP
rs1397104173 2376 dbSNP
rs1324861109 2378 dbSNP
rs530477199 2381 dbSNP
rs1033144232 2383 dbSNP
rs1383622366 2386 dbSNP
rs1034822943 2395 dbSNP
rs1010859458 2400 dbSNP
rs1240299351 2401 dbSNP
rs1464235846 2402 dbSNP
rs1380575682 2412 dbSNP
rs1192579006 2422 dbSNP
rs1189016057 2423 dbSNP
rs1020515112 2430 dbSNP
rs1222239368 2433 dbSNP
rs955841516 2434 dbSNP
rs960592002 2436 dbSNP
rs1452789018 2442 dbSNP
rs986732590 2456 dbSNP
rs140827507 2460 dbSNP
rs561057724 2463 dbSNP
rs964066477 2465 dbSNP
rs564093696 2471 dbSNP
rs1232367451 2483 dbSNP
rs1012560389 2488 dbSNP
rs1373724850 2492 dbSNP
rs974122014 2503 dbSNP
rs920046223 2504 dbSNP
rs6142589 2507 dbSNP
rs929809578 2513 dbSNP
rs1360599359 2529 dbSNP
rs528306207 2531 dbSNP
rs917813538 2537 dbSNP
rs1191516256 2542 dbSNP
rs1475056633 2542 dbSNP
rs1240335245 2549 dbSNP
rs979440696 2563 dbSNP
rs923945289 2567 dbSNP
rs1369305291 2568 dbSNP
rs1209001519 2569 dbSNP
rs949300801 2572 dbSNP
rs1214395794 2574 dbSNP
rs1337819373 2575 dbSNP
rs866989199 2585 dbSNP
rs1231620626 2588 dbSNP
rs1401127950 2589 dbSNP
rs1273885852 2591 dbSNP
rs1345037091 2592 dbSNP
rs1044711787 2605 dbSNP
rs1360487329 2609 dbSNP
rs904866374 2612 dbSNP
rs986858076 2624 dbSNP
rs376164663 2627 dbSNP
rs1172808076 2628 dbSNP
rs1282010941 2631 dbSNP
rs1256935843 2646 dbSNP
rs1300531173 2650 dbSNP
rs546469885 2658 dbSNP
rs1185830651 2659 dbSNP
rs892232008 2660 dbSNP
rs1010388715 2662 dbSNP
rs6061083 2663 dbSNP
rs1260329066 2666 dbSNP
rs1209327941 2667 dbSNP
rs1219787014 2668 dbSNP
rs1334725626 2672 dbSNP
rs891341079 2677 dbSNP
rs1249644849 2679 dbSNP
rs754764437 2682 dbSNP
rs1226167576 2686 dbSNP
rs141501857 2686 dbSNP
rs1303140300 2688 dbSNP
rs546222668 2689 dbSNP
rs1247528160 2690 dbSNP
rs1352560562 2693 dbSNP
rs1333069488 2702 dbSNP
rs535449982 2707 dbSNP
rs1417137900 2713 dbSNP
rs550657568 2723 dbSNP
rs1156931687 2724 dbSNP
rs1411380080 2733 dbSNP
rs1240450367 2739 dbSNP
rs920231008 2740 dbSNP
rs931559174 2741 dbSNP
rs964012946 2749 dbSNP
rs986140917 2759 dbSNP
rs1392652962 2761 dbSNP
rs909227958 2778 dbSNP
rs1224429306 2781 dbSNP
rs1323062628 2783 dbSNP
rs1386576686 2789 dbSNP
rs143024977 2801 dbSNP
rs1374134232 2815 dbSNP
rs1331356861 2820 dbSNP
rs1027059018 2821 dbSNP
rs539519143 2822 dbSNP
rs951559865 2825 dbSNP
rs982613157 2830 dbSNP
rs940399286 2841 dbSNP
rs558247335 2843 dbSNP
rs1459326187 2845 dbSNP
rs1350544283 2848 dbSNP
rs1158424894 2850 dbSNP
rs917744306 2853 dbSNP
rs1382453380 2865 dbSNP
rs1179462504 2867 dbSNP
rs1454161528 2872 dbSNP
rs751840416 2874 dbSNP
rs1251512500 2880 dbSNP
rs200678585 2880 dbSNP
rs73102671 2882 dbSNP
rs1012117002 2883 dbSNP
rs1023971435 2884 dbSNP
rs1350818212 2886 dbSNP
rs575539034 2896 dbSNP
rs903740269 2897 dbSNP
rs1369993949 2900 dbSNP
rs1000744882 2903 dbSNP
rs867244598 2905 dbSNP
rs1388476566 2906 dbSNP
rs1053889939 2907 dbSNP
rs1368155305 2914 dbSNP
rs913619535 2915 dbSNP
rs773428797 2921 dbSNP
rs1290814168 2923 dbSNP
rs1453514982 2928 dbSNP
rs534423000 2929 dbSNP
rs1362534762 2933 dbSNP
rs1159544462 2939 dbSNP
rs1434283086 2942 dbSNP
rs1393665894 2956 dbSNP
rs1201413016 2957 dbSNP
rs1434097161 2961 dbSNP
rs74925843 2967 dbSNP
rs1185279377 2968 dbSNP
rs1487053462 2973 dbSNP
rs747027033 2974 dbSNP
rs986825987 2978 dbSNP
rs1041857568 2984 dbSNP
rs375824547 2994 dbSNP
rs1235207610 3010 dbSNP
rs891288438 3020 dbSNP
rs771583394 3028 dbSNP
rs964560108 3030 dbSNP
rs1164166340 3032 dbSNP
rs1008391477 3040 dbSNP
rs975571233 3042 dbSNP
rs920097231 3045 dbSNP
rs1400279894 3055 dbSNP
rs114331659 3056 dbSNP
rs983050797 3065 dbSNP
rs573589679 3066 dbSNP
rs1406723197 3067 dbSNP
rs1372850724 3068 dbSNP
rs189246962 3073 dbSNP
rs777234525 3078 dbSNP
rs940367131 3086 dbSNP
rs1425188244 3088 dbSNP
rs995440137 3092 dbSNP
rs149375882 3093 dbSNP
rs200054547 3095 dbSNP
rs1349267746 3099 dbSNP
rs1056609451 3110 dbSNP
rs1253692892 3111 dbSNP
rs1201816226 3113 dbSNP
rs1483488897 3122 dbSNP
rs1250497781 3126 dbSNP
rs1409920942 3131 dbSNP
rs563110779 3135 dbSNP
rs1027418736 3142 dbSNP
rs182003725 3146 dbSNP
rs766337688 3146 dbSNP
rs1244027753 3152 dbSNP
rs951457855 3155 dbSNP
rs759925723 3156 dbSNP
rs1396228294 3157 dbSNP
rs764661832 3167 dbSNP
rs1194291894 3171 dbSNP
rs970546225 3172 dbSNP
rs1000712274 3183 dbSNP
rs1164798364 3185 dbSNP
rs1274208181 3188 dbSNP
rs1400107813 3190 dbSNP
rs972361310 3193 dbSNP
rs1472217878 3200 dbSNP
rs373588071 3202 dbSNP
rs1483394521 3206 dbSNP
rs1189206825 3217 dbSNP
rs1366189025 3217 dbSNP
rs1423967861 3218 dbSNP
rs775707550 3223 dbSNP
rs1255543083 3226 dbSNP
rs892451236 3232 dbSNP
rs1008260044 3234 dbSNP
rs1458911724 3242 dbSNP
rs1258703240 3243 dbSNP
rs1212971118 3246 dbSNP
rs980622495 3248 dbSNP
rs6087809 3251 dbSNP
rs1474636182 3253 dbSNP
rs1335345146 3260 dbSNP
rs957951981 3261 dbSNP
rs1264544377 3279 dbSNP
rs184275618 3281 dbSNP
rs372232365 3282 dbSNP
rs528269432 3283 dbSNP
rs952882343 3295 dbSNP
rs913568344 3306 dbSNP
rs749953001 3309 dbSNP
rs1399498728 3313 dbSNP
rs1164456703 3314 dbSNP
rs1458118094 3315 dbSNP
rs983019801 3321 dbSNP
rs1176387133 3323 dbSNP
rs1441373825 3326 dbSNP
rs1238497541 3327 dbSNP
rs1198080564 3329 dbSNP
rs945098847 3330 dbSNP
rs571028583 3335 dbSNP
rs961704559 3336 dbSNP
rs991798651 3338 dbSNP
rs76950117 3339 dbSNP
rs947801017 3340 dbSNP
rs1242571049 3345 dbSNP
rs1378128938 3352 dbSNP
rs1045232758 3354 dbSNP
rs1434992437 3356 dbSNP
rs1341981695 3359 dbSNP
rs1225928441 3374 dbSNP
rs1297089025 3378 dbSNP
rs766335242 3380 dbSNP
rs1405489775 3384 dbSNP
rs1343096751 3390 dbSNP
rs1359332365 3397 dbSNP
rs1230947307 3401 dbSNP
rs1254315115 3404 dbSNP
rs1483003422 3406 dbSNP
rs900070547 3409 dbSNP
rs561552532 3413 dbSNP
rs1248422240 3420 dbSNP
rs1199486215 3421 dbSNP
rs529102345 3429 dbSNP
rs76616353 3431 dbSNP
rs1004255586 3433 dbSNP
rs1354639245 3438 dbSNP
rs1217887669 3446 dbSNP
rs1347543972 3451 dbSNP
rs1276017442 3452 dbSNP
rs1445594049 3452 dbSNP
rs569120281 3454 dbSNP
rs778833526 3464 dbSNP
rs1008572989 3465 dbSNP
rs1360824497 3473 dbSNP
rs1041023119 3483 dbSNP
rs1412609454 3486 dbSNP
rs1426993862 3490 dbSNP
rs1033528082 3493 dbSNP
rs1421617944 3497 dbSNP
rs957899996 3497 dbSNP
rs867231006 3500 dbSNP
rs747830981 3502 dbSNP
rs748025433 3508 dbSNP
rs996923147 3512 dbSNP
rs1375425912 3519 dbSNP
rs539855418 3521 dbSNP
rs1465112911 3529 dbSNP
rs1208280449 3536 dbSNP
rs989797782 3550 dbSNP
rs1027100842 3556 dbSNP
rs1218595992 3564 dbSNP
rs1316541850 3572 dbSNP
rs151231946 3575 dbSNP
rs1004424077 3576 dbSNP
rs34934894 3578 dbSNP
rs1219979374 3580 dbSNP
rs1015772664 3584 dbSNP
rs1432860295 3593 dbSNP
rs960283800 3600 dbSNP
rs1365731769 3602 dbSNP
rs1360690220 3607 dbSNP
rs567017757 3609 dbSNP
rs993500256 3611 dbSNP
rs1465063338 3617 dbSNP
rs1398091741 3619 dbSNP
rs917566693 3622 dbSNP
rs1172698690 3623 dbSNP
rs1478229762 3633 dbSNP
rs987184955 3636 dbSNP
rs969482448 3646 dbSNP
rs1180337032 3649 dbSNP
rs534382366 3650 dbSNP
rs943141875 3651 dbSNP
rs568648060 3654 dbSNP
rs921442094 3656 dbSNP
rs140397211 3661 dbSNP
rs1307585393 3662 dbSNP
rs1311304532 3664 dbSNP
rs1380828805 3676 dbSNP
rs1052188362 3678 dbSNP
rs913752501 3679 dbSNP
rs1187840366 3685 dbSNP
rs943947650 3689 dbSNP
rs550471078 3690 dbSNP
rs1432051334 3691 dbSNP
rs1466013693 3695 dbSNP
rs1349398155 3709 dbSNP
rs1188476609 3730 dbSNP
rs568924551 3739 dbSNP
rs1176115784 3742 dbSNP
rs1414848500 3749 dbSNP
rs1178251906 3754 dbSNP
rs771172489 3761 dbSNP
rs1438289777 3762 dbSNP
rs567881677 3763 dbSNP
rs6121306 3764 dbSNP
rs1455562842 3767 dbSNP
rs1158419167 3768 dbSNP
rs1218808140 3769 dbSNP
rs1389014326 3773 dbSNP
rs997289655 3777 dbSNP
rs6121307 3780 dbSNP
rs1238963815 3793 dbSNP
rs374229056 3796 dbSNP
rs1367213572 3810 dbSNP
rs1351235750 3819 dbSNP
rs1311124758 3832 dbSNP
rs906590158 3833 dbSNP
rs1366881449 3834 dbSNP
rs888493817 3837 dbSNP
rs1438781421 3842 dbSNP
rs1350528485 3845 dbSNP
rs1004307595 3856 dbSNP
rs1418024466 3858 dbSNP
rs1015740201 3861 dbSNP
rs1382586975 3864 dbSNP
rs1228314945 3869 dbSNP
rs1269327144 3871 dbSNP
rs1265934619 3873 dbSNP
rs960502449 3875 dbSNP
rs1014487922 3880 dbSNP
rs1023665562 3881 dbSNP
rs575111653 3888 dbSNP
rs1489211502 3900 dbSNP
rs1219864437 3902 dbSNP
rs1215478553 3916 dbSNP
rs1265267591 3920 dbSNP
rs545832699 3922 dbSNP
rs770200651 3924 dbSNP
rs1239549456 3935 dbSNP
rs1311383310 3936 dbSNP
rs115475259 3943 dbSNP
rs1270405334 3946 dbSNP
rs879232369 3947 dbSNP
rs572566126 3957 dbSNP
rs893629662 3958 dbSNP
rs957757195 3971 dbSNP
rs987871009 3972 dbSNP
rs1465914975 3975 dbSNP
rs913719152 3977 dbSNP
rs1458585179 3983 dbSNP
rs1010764974 4012 dbSNP
rs377400990 4013 dbSNP
rs542933493 4022 dbSNP
rs1487002798 4023 dbSNP
rs370686341 4032 dbSNP
rs1264964886 4033 dbSNP
rs539940514 4036 dbSNP
rs1482812660 4040 dbSNP
rs773154299 4040 dbSNP
rs561516204 4045 dbSNP
rs1295579643 4057 dbSNP
rs976688919 4059 dbSNP
rs921220353 4069 dbSNP
rs932588797 4077 dbSNP
rs775930282 4081 dbSNP
rs763173502 4083 dbSNP
rs1352834859 4092 dbSNP
rs529099504 4097 dbSNP
rs1296636280 4100 dbSNP
rs940063608 4104 dbSNP
rs772813205 4116 dbSNP
rs1395615860 4118 dbSNP
rs1400527490 4126 dbSNP
rs1037140718 4130 dbSNP
rs1470492557 4131 dbSNP
rs895970821 4141 dbSNP
rs1476586933 4145 dbSNP
rs1014867844 4149 dbSNP
rs974455407 4153 dbSNP
rs920384183 4156 dbSNP
rs1322765720 4158 dbSNP
rs1221758753 4164 dbSNP
rs1253846119 4169 dbSNP
rs1202018096 4174 dbSNP
rs1293504158 4185 dbSNP
rs1023212906 4187 dbSNP
rs1203855938 4197 dbSNP
rs544161507 4202 dbSNP
rs1251964634 4206 dbSNP
rs562828131 4210 dbSNP
rs1244357657 4220 dbSNP
rs1471108817 4221 dbSNP
rs931453523 4231 dbSNP
rs984333466 4237 dbSNP
rs1180107245 4238 dbSNP
rs1329925382 4239 dbSNP
rs1031946552 4244 dbSNP
rs957727001 4255 dbSNP
rs1398048329 4258 dbSNP
rs908757141 4261 dbSNP
rs533169429 4276 dbSNP
rs1412796617 4278 dbSNP
rs1424182241 4281 dbSNP
rs772527674 4284 dbSNP
rs1423082408 4286 dbSNP
rs906538077 4309 dbSNP
rs1165640665 4313 dbSNP
rs1459007201 4317 dbSNP
rs938035687 4318 dbSNP
rs1354327269 4319 dbSNP
rs1267514663 4323 dbSNP
rs1246910576 4325 dbSNP
rs6142590 4343 dbSNP
rs1353441446 4348 dbSNP
rs1055198095 4351 dbSNP
rs114689180 4352 dbSNP
rs527757859 4354 dbSNP
rs1336922603 4365 dbSNP
rs1372550284 4371 dbSNP
rs1323441875 4376 dbSNP
rs1385801763 4384 dbSNP
rs965238933 4386 dbSNP
rs976954158 4387 dbSNP
rs921115806 4391 dbSNP
rs1165102687 4393 dbSNP
rs1011129777 4399 dbSNP
rs932525945 4402 dbSNP
rs1380272159 4415 dbSNP
rs984055240 4432 dbSNP
rs1230405411 4435 dbSNP
rs909865687 4440 dbSNP
rs760291662 4447 dbSNP
rs189175334 4457 dbSNP
rs1198061052 4458 dbSNP
rs549515270 4460 dbSNP
rs1449951713 4464 dbSNP
rs6087810 4474 dbSNP
rs538462296 4475 dbSNP
rs1227280911 4476 dbSNP
rs181165046 4480 dbSNP
rs1439116611 4483 dbSNP
rs1207854420 4490 dbSNP
rs186403947 4491 dbSNP
rs1242819113 4494 dbSNP
rs770478905 4496 dbSNP
rs538975634 4504 dbSNP
rs1000387950 4518 dbSNP
rs759520485 4520 dbSNP
rs893465557 4522 dbSNP
rs1185167277 4525 dbSNP
rs1304394447 4533 dbSNP
rs1405208229 4537 dbSNP
rs1009226827 4546 dbSNP
rs1295954783 4562 dbSNP
rs908710121 4563 dbSNP
rs1408366974 4565 dbSNP
rs1171929901 4567 dbSNP
rs1476976740 4571 dbSNP
rs1246016400 4572 dbSNP
rs1431570025 4580 dbSNP
rs1020621710 4592 dbSNP
rs1200291205 4598 dbSNP
rs765025835 4608 dbSNP
rs997957383 4618 dbSNP
rs878869955 4619 dbSNP
rs190379707 4628 dbSNP
rs1278286782 4629 dbSNP
rs372565361 4629 dbSNP
rs928227889 4631 dbSNP
rs937983287 4636 dbSNP
rs1175911020 4643 dbSNP
rs752559415 4651 dbSNP
rs1455095442 4658 dbSNP
rs1275921945 4659 dbSNP
rs1318936379 4662 dbSNP
rs909832755 4663 dbSNP
rs1365000250 4667 dbSNP
rs181526930 4672 dbSNP
rs1419614192 4673 dbSNP
rs973103637 4677 dbSNP
rs917263482 4678 dbSNP
rs946824469 4688 dbSNP
rs950157163 4689 dbSNP
rs1044511181 4692 dbSNP
rs1216990937 4695 dbSNP
rs535009013 4698 dbSNP
rs927455166 4720 dbSNP
rs186269778 4723 dbSNP
rs555075744 4726 dbSNP
rs1245958177 4730 dbSNP
rs1237293984 4732 dbSNP
rs1054633904 4734 dbSNP
rs892008818 4735 dbSNP
rs1010453443 4742 dbSNP
rs1244077415 4743 dbSNP
rs1215996404 4762 dbSNP
rs1477056358 4762 dbSNP
rs1362275206 4767 dbSNP
rs1283216087 4768 dbSNP
rs573730567 4769 dbSNP
rs1384720398 4772 dbSNP
rs1337314489 4776 dbSNP
rs900854684 4787 dbSNP
rs1464981958 4797 dbSNP
rs998324402 4798 dbSNP
rs1172567974 4799 dbSNP
rs1410569657 4800 dbSNP
rs539521774 4802 dbSNP
rs1413423258 4807 dbSNP
rs1161678565 4809 dbSNP
rs1426026427 4816 dbSNP
rs1471236706 4823 dbSNP
rs1157679093 4827 dbSNP
rs1028102773 4830 dbSNP
rs377088574 4851 dbSNP
rs562630061 4859 dbSNP
rs1027339620 4861 dbSNP
rs1235072740 4864 dbSNP
rs777676241 4879 dbSNP
rs951844449 4882 dbSNP
rs1458109143 4893 dbSNP
rs1307553099 4902 dbSNP
rs961247797 4911 dbSNP
rs751875905 4920 dbSNP
rs1243234366 4924 dbSNP
rs1433910035 4926 dbSNP
rs866693256 4929 dbSNP
rs1015119663 4939 dbSNP
rs917221911 4944 dbSNP
rs971452876 4945 dbSNP
rs533212345 4946 dbSNP
rs1299787571 4947 dbSNP
rs1367775686 4948 dbSNP
rs980589296 4952 dbSNP
rs961521411 4953 dbSNP
rs927422147 4956 dbSNP
rs1386283820 4960 dbSNP
rs765898496 4961 dbSNP
rs1158463591 4965 dbSNP
rs936090921 4975 dbSNP
rs1054519631 4983 dbSNP
rs1410878087 4984 dbSNP
rs913417267 4987 dbSNP
rs1480675567 4989 dbSNP
rs6061085 4992 dbSNP
rs191004797 4993 dbSNP
rs1292008330 4996 dbSNP
rs1239214803 4997 dbSNP
rs1314909584 5012 dbSNP
rs1309067551 5016 dbSNP
rs959632053 5017 dbSNP
rs991189477 5020 dbSNP
rs527721560 5031 dbSNP
rs1450062895 5032 dbSNP
rs549478254 5034 dbSNP
rs1406814633 5035 dbSNP
rs183406184 5035 dbSNP
rs946741946 5040 dbSNP
rs1297806860 5045 dbSNP
rs1049937146 5048 dbSNP
rs1481464353 5050 dbSNP
rs540860179 5054 dbSNP
rs1180578736 5055 dbSNP
rs77452466 5061 dbSNP
rs550310770 5065 dbSNP
rs1016746955 5072 dbSNP
rs866485660 5075 dbSNP
rs897015919 5085 dbSNP
rs1040196603 5086 dbSNP
rs571754567 5097 dbSNP
rs1481117777 5111 dbSNP
rs994480222 5113 dbSNP
rs539287961 5120 dbSNP
rs770350654 5122 dbSNP
rs547697904 5134 dbSNP
rs1215360655 5159 dbSNP
rs1403238404 5163 dbSNP
rs559546902 5166 dbSNP
rs1484780899 5172 dbSNP
rs1322478998 5185 dbSNP
rs780381644 5192 dbSNP
rs1365596507 5198 dbSNP
rs1406264396 5203 dbSNP
rs1286333588 5206 dbSNP
rs1349761890 5210 dbSNP
rs999024219 5210 dbSNP
rs1239738594 5211 dbSNP
rs1346225935 5220 dbSNP
rs1049170050 5221 dbSNP
rs1380686638 5222 dbSNP
rs749695138 5236 dbSNP
rs1289774411 5250 dbSNP
rs887441583 5256 dbSNP
rs1004982021 5266 dbSNP
rs1179188151 5275 dbSNP
rs73102674 5280 dbSNP
rs1034321088 5281 dbSNP
rs957424330 5282 dbSNP
rs1192515264 5295 dbSNP
rs533569710 5297 dbSNP
rs555040142 5302 dbSNP
rs573720977 5303 dbSNP
rs1241976768 5305 dbSNP
rs1426329940 5310 dbSNP
rs537553177 5317 dbSNP
rs1290877912 5323 dbSNP
rs1490847047 5333 dbSNP
rs556296390 5340 dbSNP
rs1203152195 5343 dbSNP
rs990212901 5345 dbSNP
rs774678003 5347 dbSNP
rs1261255388 5350 dbSNP
rs913382623 5351 dbSNP
rs760379988 5353 dbSNP
rs1205412181 5355 dbSNP
rs1324388384 5357 dbSNP
rs946263455 5364 dbSNP
rs1225557689 5365 dbSNP
rs577778741 5373 dbSNP
rs776218081 5379 dbSNP
rs1395864990 5385 dbSNP
rs1381027914 5393 dbSNP
rs545308657 5396 dbSNP
rs187691722 5397 dbSNP
rs1453946783 5406 dbSNP
rs572470228 5408 dbSNP
rs374895801 5409 dbSNP
rs1460007618 5410 dbSNP
rs1374497197 5420 dbSNP
rs1367016752 5421 dbSNP
rs1170705441 5423 dbSNP
rs968057952 5430 dbSNP
rs1049388464 5436 dbSNP
rs978525310 5438 dbSNP
rs1162225174 5443 dbSNP
rs1185370997 5455 dbSNP
rs1385507000 5460 dbSNP
rs1426203645 5461 dbSNP
rs1305615439 5462 dbSNP
rs923999236 5466 dbSNP
rs1369467155 5468 dbSNP
rs1391894907 5469 dbSNP
rs1357775800 5488 dbSNP
rs190866861 5490 dbSNP
rs561138555 5496 dbSNP
rs944809866 5506 dbSNP
rs1376877371 5507 dbSNP
rs1327425240 5513 dbSNP
rs941072282 5526 dbSNP
rs112363421 5528 dbSNP
rs550025976 5529 dbSNP
rs11700088 5531 dbSNP
rs757564969 5533 dbSNP
rs931849492 5544 dbSNP
rs1423553081 5563 dbSNP
rs138131962 5564 dbSNP
rs1165281075 5571 dbSNP
rs1315949144 5572 dbSNP
rs1444990865 5572 dbSNP
rs994057049 5576 dbSNP
rs369250481 5580 dbSNP
rs887722224 5583 dbSNP
rs1024561842 5588 dbSNP
rs1251280044 5597 dbSNP
rs1209506676 5604 dbSNP
rs1489933300 5607 dbSNP
rs1294195422 5613 dbSNP
rs907085768 5621 dbSNP
rs1001872166 5623 dbSNP
rs532600026 5631 dbSNP
rs752613889 5632 dbSNP
rs990180038 5637 dbSNP
rs1241731816 5648 dbSNP
rs1020360011 5649 dbSNP
rs1307036635 5650 dbSNP
rs1342966178 5650 dbSNP
rs1363381936 5655 dbSNP
rs1304564011 5656 dbSNP
rs1425135814 5657 dbSNP
rs906914600 5658 dbSNP
rs1156768739 5660 dbSNP
rs1471099828 5661 dbSNP
rs1002633093 5665 dbSNP
rs1198855658 5667 dbSNP
rs1198013798 5671 dbSNP
rs1034135223 5672 dbSNP
rs1446800803 5674 dbSNP
rs762958798 5675 dbSNP
rs1207442067 5679 dbSNP
rs1352084114 5680 dbSNP
rs976235554 5688 dbSNP
rs183146137 5689 dbSNP
rs1446067566 5691 dbSNP
rs1012854495 5692 dbSNP
rs923439560 5694 dbSNP
rs1022531847 5696 dbSNP
rs1405112475 5698 dbSNP
rs968717097 5701 dbSNP
rs1316015341 5707 dbSNP
rs1462065950 5732 dbSNP
rs932222245 5733 dbSNP
rs117937228 5743 dbSNP
rs910879728 5744 dbSNP
rs1030961081 5750 dbSNP
rs1400020626 5764 dbSNP
rs1395427637 5765 dbSNP
rs941041225 5766 dbSNP
rs1475184978 5773 dbSNP
rs751567010 5774 dbSNP
rs966064049 5778 dbSNP
rs78428620 5780 dbSNP
rs1384806701 5792 dbSNP
rs1263130711 5793 dbSNP
rs1320815265 5799 dbSNP
rs1223562182 5804 dbSNP
rs759377608 5804 dbSNP
rs1338406461 5805 dbSNP
rs896866513 5808 dbSNP
rs1297158475 5814 dbSNP
rs1432718121 5816 dbSNP
rs1308101704 5817 dbSNP
rs1326737005 5819 dbSNP
rs929724336 5822 dbSNP
rs1229739865 5825 dbSNP
rs1045541748 5829 dbSNP
rs907049636 5830 dbSNP
rs1409428972 5835 dbSNP
rs1001390564 5836 dbSNP
rs1417708416 5841 dbSNP
rs1055666568 5844 dbSNP
rs1475946237 5846 dbSNP
rs893130172 5849 dbSNP
rs1011571909 5856 dbSNP
rs1204920916 5862 dbSNP
rs1265383061 5870 dbSNP
rs1463083796 5886 dbSNP
rs1210285794 5890 dbSNP
rs1436722615 5897 dbSNP
rs985044529 5898 dbSNP
rs1020706329 5912 dbSNP
rs143614157 5927 dbSNP
rs940609059 5928 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuugguaAUACACGACGAu 5'
                    | | ||||||| 
Target 5' ------cuucUUUCUGCUGCUa 3'
1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000562532.2 | 3UTR | CUUCUUUCUGCUGCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells -0.232 1.4e-1 -0.283 9.0e-2 24 Click to see details
GSE38226 Liver fibrosis -0.241 1.5e-1 0.121 3.0e-1 21 Click to see details
GSE21032 Prostate cancer -0.094 2.0e-1 -0.079 2.4e-1 83 Click to see details
GSE28544 Breast cancer 0.157 2.3e-1 0.170 2.1e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.223 2.3e-1 0.049 4.4e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.036 3.7e-1 0.032 3.8e-1 90 Click to see details
GSE27834 Pluripotent stem cells 0.04 4.4e-1 -0.106 3.5e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD -0.543 0.03 -0.455 0.07 12 Click to see details
PRAD 0.248 0.04 0.322 0.01 50 Click to see details
BRCA 0.189 0.04 0.062 0.29 84 Click to see details
ESCA -0.533 0.05 -0.382 0.12 11 Click to see details
KIRP -0.223 0.11 -0.349 0.03 32 Click to see details
THCA -0.151 0.13 -0.086 0.26 59 Click to see details
CESC 0.89 0.15 0.875 0.16 3 Click to see details
PAAD -0.632 0.18 -0.400 0.3 4 Click to see details
PCPG -0.661 0.27 -0.500 0.33 3 Click to see details
CHOL 0.178 0.32 0.500 0.09 9 Click to see details
LUSC -0.071 0.34 -0.048 0.39 38 Click to see details
UCEC -0.091 0.36 0.023 0.46 19 Click to see details
KIRC -0.042 0.37 0.016 0.45 68 Click to see details
LIHC 0.048 0.37 0.398 0 49 Click to see details
BLCA -0.068 0.39 0.098 0.35 18 Click to see details
HNSC -0.034 0.42 0.148 0.17 42 Click to see details
STAD 0.026 0.44 -0.175 0.17 32 Click to see details
COAD -0.055 0.45 -0.089 0.42 8 Click to see details
KICH 0.007 0.49 0.005 0.49 25 Click to see details
KICH 0.007 0.49 0.005 0.49 25 Click to see details
KICH 0.007 0.49 0.005 0.49 25 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922