miRTarBase - #MIRT566654 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NCKAP1   
Synonyms HEM2, NAP1, NAP125, p125Nap1
Description NCK associated protein 1
Transcript NM_013436   
Other Transcripts NM_205842   
Expression
Putative miRNA Targets on NCKAP1
3'UTR of NCKAP1
(miRNA target sites are highlighted)
>NCKAP1|NM_013436|3'UTR
   1 AATTACCTACTTAATCAAGATAAGCACGCATTTTTGTTGCCTTGGTTTTACCTGTAGACTGTGGAACTATTTTACCTTAA
  81 GACCTGAAAAAGTTTTGTGGATTATAAATTTCTTTCATACGGTTGTATTTTCTGATCATTGGTTTCTTAATATGGTTGTA
 161 CTACAGTATACTTGGTTGATTTAGGTTGCACATTCACTGAATTCACTGAGATTATTCCTATAATTTTAAAGTATCATTTA
 241 TTTGAAAAACATACATTATCAACATGTTTTTGATATTTGATAATGAAAAAAATCTTTGCTTGTTTATTTCTGAAAAAGAA
 321 CTGTATTTAGTGATTATTTTAGATAGTGATATTATAGTATTCATCTGTGTGTAAATTATTTCATATAGGGAAGAGTTCTG
 401 ATCTGTACCTATGGTTCTTATTGAAAACAACATTGGATGTGCATTTCTGTGATGTTATGAATACATTTCTACTTTATTTT
 481 GAAACATTTGCCAAACTAAATACTGTAACACTGTATAACATTTAAAAATGTTAAAGAACTGCTTAGTATTAGAAGCAGAT
 561 CATTTCCCAAAATTCTAAGAGCAGCAGCATATGTTGTTGCTTGTATAAAGCCTAGCGATAATTTTTAGACTAACTTCCAT
 641 GGTGCCCTGTTGGCATTAGCACTACCATTGTACCCTGCTGTATAATAAACAATCTTAGACATTTATCAACTGTTGATACA
 721 AATGTTAGTCCCTAACCACTTTTTATATATGTTTTAAATTTTTGAAATTCAAGTGTACCTGCCATAACATAAAATAAACA
 801 CTAGACTGTATCACACTTCGATTGATTTCTTTAAGATCCTTGGATATTCGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU-UGGUAAUAC-ACGACGAu 5'
            ||: | || |||| ||:|||| 
Target 5' agCAGCAGCA-TATGTTGTTGCTt 3'
580 - 602 143.00 -14.00
2
miRNA  3' guguuUGGUAAUA---CACGACGau 5'
               ||||||:|    |||||:  
Target 5' gcactACCATTGTACCCTGCTGTat 3'
659 - 683 125.00 -18.50
3
miRNA  3' guGUUUG---GUAAUACACGACGau 5'
            :||:|   |||| | ||:|||  
Target 5' gaTAAGCACGCATT-TTTGTTGCct 3'
19 - 42 123.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20644249 19 COSMIC
COSN30497617 28 COSMIC
COSN26986089 34 COSMIC
COSN28860341 66 COSMIC
COSN30536689 70 COSMIC
COSN30149412 81 COSMIC
COSN30154143 82 COSMIC
COSN30509158 93 COSMIC
COSN30131020 94 COSMIC
COSN30138116 107 COSMIC
COSN13956200 112 COSMIC
COSN13956199 116 COSMIC
COSN30159704 118 COSMIC
COSN25282250 128 COSMIC
COSN31502176 174 COSMIC
COSN30529693 222 COSMIC
COSN31599956 318 COSMIC
COSN1810462 381 COSMIC
COSN17038419 487 COSMIC
COSN1810461 691 COSMIC
COSN21672813 704 COSMIC
COSN27052526 1132 COSMIC
COSN1810460 1325 COSMIC
COSN5490988 1426 COSMIC
COSN19400867 1732 COSMIC
COSN30245004 2033 COSMIC
COSN16433753 2524 COSMIC
COSN23676177 3472 COSMIC
COSN22883349 3733 COSMIC
COSN4799667 3779 COSMIC
COSN18942674 4787 COSMIC
COSN16535519 4802 COSMIC
COSN20995879 4829 COSMIC
COSN19147139 5265 COSMIC
COSN29343314 5389 COSMIC
COSN20642824 5684 COSMIC
COSN1229933 5736 COSMIC
COSN1229932 5784 COSMIC
COSN21616437 5828 COSMIC
COSN29016764 6032 COSMIC
COSN1229931 6070 COSMIC
COSN24205832 6101 COSMIC
COSN25598856 6273 COSMIC
COSN25397795 6335 COSMIC
COSN4799666 6740 COSMIC
COSN30216547 7213 COSMIC
COSN28285918 7595 COSMIC
COSN17581970 7984 COSMIC
COSN1810458 8417 COSMIC
COSN16470883 8565 COSMIC
COSN1810457 8574 COSMIC
COSN16447727 8961 COSMIC
COSN28319462 9034 COSMIC
COSN15598477 9272 COSMIC
COSN1810456 9372 COSMIC
COSN31796328 9684 COSMIC
COSN16295155 9772 COSMIC
COSN22147510 10250 COSMIC
COSN26827563 11177 COSMIC
COSN7150202 11998 COSMIC
COSN16229426 12814 COSMIC
COSN16253719 12853 COSMIC
COSN9229220 12862 COSMIC
COSN29530688 13582 COSMIC
COSN5785744 13791 COSMIC
COSN29530524 13951 COSMIC
COSN29332611 13961 COSMIC
COSN6157530 14060 COSMIC
COSN21502430 14251 COSMIC
COSN24334702 14665 COSMIC
COSN23139161 14752 COSMIC
COSN24336221 14753 COSMIC
COSN19262233 14970 COSMIC
COSN28290971 15199 COSMIC
COSN29509479 15353 COSMIC
COSN22150948 15491 COSMIC
COSN16159882 16029 COSMIC
rs4427983 4832 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746081831 2 dbSNP
rs201160356 4 dbSNP
rs368545464 7 dbSNP
rs1246862100 12 dbSNP
rs1356066577 17 dbSNP
rs1277006945 18 dbSNP
rs1348914986 19 dbSNP
rs548316278 21 dbSNP
rs374748591 22 dbSNP
rs751136773 27 dbSNP
rs370261738 28 dbSNP
rs940429461 30 dbSNP
rs762611887 35 dbSNP
rs1165401172 36 dbSNP
rs750102394 39 dbSNP
rs1022597150 45 dbSNP
rs543171066 52 dbSNP
rs1160322258 54 dbSNP
rs886231533 69 dbSNP
rs1400453137 80 dbSNP
rs1339810692 89 dbSNP
rs1227474983 111 dbSNP
rs1272345315 116 dbSNP
rs1410044675 120 dbSNP
rs1350022012 121 dbSNP
rs992480124 125 dbSNP
rs1178787438 127 dbSNP
rs1211551809 139 dbSNP
rs531388555 150 dbSNP
rs1441933653 152 dbSNP
rs1185677869 155 dbSNP
rs1450447029 161 dbSNP
rs1428678530 162 dbSNP
rs1168405592 164 dbSNP
rs555784427 165 dbSNP
rs920146261 165 dbSNP
rs191525924 185 dbSNP
rs1031880283 187 dbSNP
rs574895914 188 dbSNP
rs937603997 189 dbSNP
rs1434055704 192 dbSNP
rs968966674 195 dbSNP
rs981644784 199 dbSNP
rs967828010 201 dbSNP
rs1445008072 206 dbSNP
rs146509460 208 dbSNP
rs186667499 211 dbSNP
rs1322264195 220 dbSNP
rs1188198304 222 dbSNP
rs957411911 226 dbSNP
rs1280778857 228 dbSNP
rs560428315 231 dbSNP
rs899722814 237 dbSNP
rs1028975960 242 dbSNP
rs996036669 261 dbSNP
rs1464075600 265 dbSNP
rs1159842561 267 dbSNP
rs1388757973 270 dbSNP
rs1215768179 272 dbSNP
rs1040969419 273 dbSNP
rs1318144784 273 dbSNP
rs1289900134 276 dbSNP
rs1300467182 276 dbSNP
rs1430484958 280 dbSNP
rs1386894687 283 dbSNP
rs1339021096 293 dbSNP
rs1290248969 294 dbSNP
rs1008270993 298 dbSNP
rs1470408916 300 dbSNP
rs1018732712 305 dbSNP
rs749911175 306 dbSNP
rs1210849962 310 dbSNP
rs1267241323 319 dbSNP
rs1431892198 320 dbSNP
rs1184636897 325 dbSNP
rs1411988125 327 dbSNP
rs1174081169 329 dbSNP
rs1430312318 330 dbSNP
rs773611144 352 dbSNP
rs1419626118 353 dbSNP
rs887097935 354 dbSNP
rs1458200928 355 dbSNP
rs1292683308 356 dbSNP
rs4666601 358 dbSNP
rs767741954 364 dbSNP
rs1308574003 373 dbSNP
rs761978248 373 dbSNP
rs144151653 379 dbSNP
rs1323779319 386 dbSNP
rs1045204967 396 dbSNP
rs948208397 403 dbSNP
rs1048820679 404 dbSNP
rs183732318 411 dbSNP
rs992370493 416 dbSNP
rs774813576 421 dbSNP
rs1460612559 430 dbSNP
rs1179452193 435 dbSNP
rs1260824317 437 dbSNP
rs544301290 439 dbSNP
rs1054828915 455 dbSNP
rs1163643088 457 dbSNP
rs924268439 461 dbSNP
rs1463384816 467 dbSNP
rs1296997414 472 dbSNP
rs1169137011 486 dbSNP
rs575378514 487 dbSNP
rs1409256860 488 dbSNP
rs1306203779 490 dbSNP
rs1381467066 493 dbSNP
rs1396751888 494 dbSNP
rs928873751 502 dbSNP
rs1320293035 503 dbSNP
rs1231132629 506 dbSNP
rs1275949289 507 dbSNP
rs968474150 513 dbSNP
rs1342013184 515 dbSNP
rs1203675122 520 dbSNP
rs1021890410 529 dbSNP
rs1214494650 534 dbSNP
rs749643453 536 dbSNP
rs1483297241 543 dbSNP
rs558616440 546 dbSNP
rs963870552 550 dbSNP
rs539057005 552 dbSNP
rs1417649701 568 dbSNP
rs1801817 573 dbSNP
rs1253720671 574 dbSNP
rs1019576234 577 dbSNP
rs748177015 581 dbSNP
rs1389344170 582 dbSNP
rs1427695551 586 dbSNP
rs775920574 587 dbSNP
rs1405627174 588 dbSNP
rs1466678031 590 dbSNP
rs1047033626 591 dbSNP
rs1377308450 597 dbSNP
rs913283708 599 dbSNP
rs990233017 613 dbSNP
rs1301256127 615 dbSNP
rs370981433 616 dbSNP
rs1312257212 617 dbSNP
rs745374821 621 dbSNP
rs1253857329 622 dbSNP
rs780789966 624 dbSNP
rs1188838437 627 dbSNP
rs1247107734 629 dbSNP
rs1447446969 631 dbSNP
rs1045108237 632 dbSNP
rs1192848711 634 dbSNP
rs756992418 659 dbSNP
rs1425838453 668 dbSNP
rs746619927 681 dbSNP
rs777446883 685 dbSNP
rs1175394992 686 dbSNP
rs1018828005 689 dbSNP
rs1458959188 697 dbSNP
rs1386959406 702 dbSNP
rs1005096456 704 dbSNP
rs758171965 717 dbSNP
rs1433431402 723 dbSNP
rs1443715189 731 dbSNP
rs1277083705 735 dbSNP
rs553645353 737 dbSNP
rs1178567360 738 dbSNP
rs1298506903 740 dbSNP
rs1208900254 747 dbSNP
rs1027928206 749 dbSNP
rs1463354265 750 dbSNP
rs1223558636 751 dbSNP
rs1247090298 752 dbSNP
rs879251901 777 dbSNP
rs935547827 778 dbSNP
rs7510 781 dbSNP
rs567863988 789 dbSNP
rs546983046 799 dbSNP
rs1294500328 805 dbSNP
rs1003217551 819 dbSNP
rs1399294941 842 dbSNP
rs1325881899 850 dbSNP
rs1382479653 854 dbSNP
rs551244662 854 dbSNP
rs765152320 855 dbSNP
rs914351122 859 dbSNP
rs994150235 872 dbSNP
rs975152830 874 dbSNP
rs963880422 875 dbSNP
rs1351783983 878 dbSNP
rs1228515765 892 dbSNP
rs1019418988 908 dbSNP
rs946315826 913 dbSNP
rs1326584486 919 dbSNP
rs1229712623 931 dbSNP
rs1290246941 932 dbSNP
rs754854926 937 dbSNP
rs1219267554 940 dbSNP
rs55886059 942 dbSNP
rs1484057769 950 dbSNP
rs747278522 951 dbSNP
rs1367376144 953 dbSNP
rs1251196427 961 dbSNP
rs539296295 963 dbSNP
rs1165225683 967 dbSNP
rs1423838228 971 dbSNP
rs1366495222 978 dbSNP
rs1160888832 980 dbSNP
rs1373000859 995 dbSNP
rs1410997525 997 dbSNP
rs1025967985 1000 dbSNP
rs995541764 1002 dbSNP
rs1306830486 1007 dbSNP
rs1333485959 1012 dbSNP
rs1449698561 1012 dbSNP
rs898485148 1016 dbSNP
rs1284487486 1021 dbSNP
rs1023711205 1022 dbSNP
rs1226435154 1025 dbSNP
rs1012254260 1026 dbSNP
rs1179433173 1027 dbSNP
rs1204382417 1039 dbSNP
rs1273925004 1040 dbSNP
rs896662714 1046 dbSNP
rs570300267 1054 dbSNP
rs1189861046 1058 dbSNP
rs1238333390 1065 dbSNP
rs767549557 1071 dbSNP
rs1056535612 1073 dbSNP
rs1472662797 1077 dbSNP
rs935596378 1079 dbSNP
rs902794000 1082 dbSNP
rs761851340 1090 dbSNP
rs753613028 1095 dbSNP
rs947107319 1103 dbSNP
rs1392453490 1104 dbSNP
rs1271752701 1107 dbSNP
rs1168527087 1112 dbSNP
rs1393680786 1113 dbSNP
rs1223872991 1118 dbSNP
rs774486784 1120 dbSNP
rs974683853 1124 dbSNP
rs149833916 1126 dbSNP
rs966033316 1126 dbSNP
rs1264021198 1133 dbSNP
rs1227501082 1147 dbSNP
rs569010126 1163 dbSNP
rs777578861 1167 dbSNP
rs1241556598 1168 dbSNP
rs1272459857 1175 dbSNP
rs911914009 1176 dbSNP
rs1202299737 1178 dbSNP
rs983372861 1185 dbSNP
rs146737776 1194 dbSNP
rs1027485233 1206 dbSNP
rs1213424527 1207 dbSNP
rs1287894636 1226 dbSNP
rs1188485805 1236 dbSNP
rs1371893871 1237 dbSNP
rs1408097522 1249 dbSNP
rs942402591 1262 dbSNP
rs192611267 1264 dbSNP
rs986658343 1265 dbSNP
rs1467839759 1266 dbSNP
rs559856792 1272 dbSNP
rs1389084358 1280 dbSNP
rs1293312556 1283 dbSNP
rs1233923328 1286 dbSNP
rs1332708653 1286 dbSNP
rs1275443332 1294 dbSNP
rs1322935864 1304 dbSNP
rs1221900880 1316 dbSNP
rs951268736 1317 dbSNP
rs1404226039 1324 dbSNP
rs1270328556 1328 dbSNP
rs1388370657 1331 dbSNP
rs752564990 1333 dbSNP
rs1025597666 1352 dbSNP
rs974392443 1357 dbSNP
rs1465607583 1359 dbSNP
rs1208545873 1369 dbSNP
rs763295527 1376 dbSNP
rs962752419 1379 dbSNP
rs1023554073 1380 dbSNP
rs1454086461 1381 dbSNP
rs115166250 1384 dbSNP
rs1156487513 1386 dbSNP
rs1376517441 1392 dbSNP
rs1479203839 1401 dbSNP
rs1003186605 1405 dbSNP
rs1286862177 1408 dbSNP
rs896547888 1412 dbSNP
rs149691631 1428 dbSNP
rs1200836276 1430 dbSNP
rs999723515 1431 dbSNP
rs902678645 1432 dbSNP
rs1403228022 1433 dbSNP
rs114516353 1437 dbSNP
rs1330030536 1439 dbSNP
rs946919558 1442 dbSNP
rs892824235 1448 dbSNP
rs188730533 1456 dbSNP
rs1039356680 1472 dbSNP
rs1267347454 1473 dbSNP
rs1054592549 1476 dbSNP
rs1183773886 1483 dbSNP
rs1251948244 1484 dbSNP
rs1472023421 1486 dbSNP
rs936181549 1487 dbSNP
rs575079384 1496 dbSNP
rs912336447 1500 dbSNP
rs558653452 1503 dbSNP
rs1325808953 1509 dbSNP
rs1283978943 1516 dbSNP
rs775856257 1518 dbSNP
rs1351184210 1519 dbSNP
rs139529822 1534 dbSNP
rs746327814 1535 dbSNP
rs974022536 1541 dbSNP
rs573199497 1546 dbSNP
rs553046156 1549 dbSNP
rs1383964687 1554 dbSNP
rs962925549 1559 dbSNP
rs1318177153 1572 dbSNP
rs536648625 1575 dbSNP
rs1480059172 1581 dbSNP
rs1175118215 1582 dbSNP
rs1257890348 1585 dbSNP
rs959211384 1590 dbSNP
rs1186522857 1592 dbSNP
rs990810416 1601 dbSNP
rs150505005 1606 dbSNP
rs1431477187 1608 dbSNP
rs1169151707 1611 dbSNP
rs981844335 1619 dbSNP
rs970500544 1627 dbSNP
rs1035107451 1630 dbSNP
rs1404679147 1633 dbSNP
rs866519184 1642 dbSNP
rs966906585 1650 dbSNP
rs557669242 1651 dbSNP
rs75511547 1652 dbSNP
rs1195940873 1653 dbSNP
rs900782442 1657 dbSNP
rs1247766904 1666 dbSNP
rs1306385092 1667 dbSNP
rs114968505 1672 dbSNP
rs1257271213 1673 dbSNP
rs1483347944 1682 dbSNP
rs1202640772 1683 dbSNP
rs547850901 1683 dbSNP
rs1451160031 1684 dbSNP
rs900664149 1685 dbSNP
rs1418762191 1686 dbSNP
rs1427972584 1687 dbSNP
rs1168352439 1691 dbSNP
rs1360973830 1692 dbSNP
rs1466693126 1693 dbSNP
rs746502003 1698 dbSNP
rs890785479 1700 dbSNP
rs1437779530 1701 dbSNP
rs1321786957 1715 dbSNP
rs1462843539 1724 dbSNP
rs1050876731 1737 dbSNP
rs1312274695 1739 dbSNP
rs1452651140 1741 dbSNP
rs552268238 1745 dbSNP
rs1466063338 1753 dbSNP
rs1209173826 1755 dbSNP
rs1241327789 1756 dbSNP
rs1199948398 1758 dbSNP
rs573766124 1764 dbSNP
rs141609558 1776 dbSNP
rs1038583639 1778 dbSNP
rs1427338969 1780 dbSNP
rs941185215 1782 dbSNP
rs916522360 1783 dbSNP
rs1175938557 1787 dbSNP
rs777346433 1801 dbSNP
rs1047689776 1811 dbSNP
rs1427524816 1816 dbSNP
rs566469264 1818 dbSNP
rs1160316697 1822 dbSNP
rs183705778 1825 dbSNP
rs960729831 1829 dbSNP
rs1367685780 1831 dbSNP
rs1280946463 1833 dbSNP
rs1295152434 1837 dbSNP
rs1228660315 1838 dbSNP
rs139475685 1840 dbSNP
rs1283225583 1849 dbSNP
rs1314969917 1864 dbSNP
rs368171001 1871 dbSNP
rs191385390 1872 dbSNP
rs937940880 1873 dbSNP
rs926435704 1877 dbSNP
rs758061973 1885 dbSNP
rs1398008448 1896 dbSNP
rs1170192437 1898 dbSNP
rs967167550 1899 dbSNP
rs1159377005 1900 dbSNP
rs1407694656 1907 dbSNP
rs1399384889 1918 dbSNP
rs1167486996 1925 dbSNP
rs1366786899 1930 dbSNP
rs1022365350 1932 dbSNP
rs1462929220 1933 dbSNP
rs1424607958 1934 dbSNP
rs1300700554 1936 dbSNP
rs1351802973 1937 dbSNP
rs35818510 1941 dbSNP
rs981981799 1941 dbSNP
rs1011512864 1943 dbSNP
rs72886527 1944 dbSNP
rs1017902272 1946 dbSNP
rs147315721 1947 dbSNP
rs1290361212 1954 dbSNP
rs1358597293 1956 dbSNP
rs1446756461 1968 dbSNP
rs1220173684 1972 dbSNP
rs4666870 1975 dbSNP
rs1051180988 1979 dbSNP
rs993945831 1980 dbSNP
rs1232559428 1982 dbSNP
rs896926836 1984 dbSNP
rs1468902253 1985 dbSNP
rs1183911096 2003 dbSNP
rs1386280604 2005 dbSNP
rs1038106504 2008 dbSNP
rs1275174898 2015 dbSNP
rs1162286954 2021 dbSNP
rs1371865502 2023 dbSNP
rs754943760 2025 dbSNP
rs1196401281 2035 dbSNP
rs1410084920 2051 dbSNP
rs1327741201 2057 dbSNP
rs6739840 2061 dbSNP
rs1272303399 2066 dbSNP
rs1315402601 2071 dbSNP
rs964969101 2074 dbSNP
rs377348502 2077 dbSNP
rs1299814883 2084 dbSNP
rs773556535 2087 dbSNP
rs542687805 2094 dbSNP
rs1283307987 2095 dbSNP
rs1445317685 2096 dbSNP
rs1009027386 2097 dbSNP
rs1272402662 2097 dbSNP
rs1337067629 2099 dbSNP
rs890515701 2105 dbSNP
rs1444481218 2109 dbSNP
rs563534406 2109 dbSNP
rs1392622880 2111 dbSNP
rs1476041166 2115 dbSNP
rs1166769341 2121 dbSNP
rs1328978409 2130 dbSNP
rs1048294490 2131 dbSNP
rs1415768773 2134 dbSNP
rs1337056344 2135 dbSNP
rs939248367 2140 dbSNP
rs1450228129 2141 dbSNP
rs927998586 2143 dbSNP
rs978525375 2152 dbSNP
rs779945173 2153 dbSNP
rs1167201835 2155 dbSNP
rs1427018443 2157 dbSNP
rs1221151901 2161 dbSNP
rs1264034854 2169 dbSNP
rs915349144 2182 dbSNP
rs757385534 2183 dbSNP
rs1448017640 2185 dbSNP
rs1193121561 2199 dbSNP
rs572642391 2214 dbSNP
rs1478760956 2219 dbSNP
rs926530404 2223 dbSNP
rs751656575 2227 dbSNP
rs1467923343 2238 dbSNP
rs1161051977 2241 dbSNP
rs1471943657 2242 dbSNP
rs1234777627 2243 dbSNP
rs1182623924 2244 dbSNP
rs1482735646 2248 dbSNP
rs113638779 2257 dbSNP
rs1017748869 2261 dbSNP
rs987743204 2266 dbSNP
rs949258184 2276 dbSNP
rs1249599586 2279 dbSNP
rs764228591 2281 dbSNP
rs954915047 2284 dbSNP
rs1406897866 2288 dbSNP
rs1026556342 2289 dbSNP
rs913630649 2291 dbSNP
rs574058940 2292 dbSNP
rs994263152 2302 dbSNP
rs896817564 2304 dbSNP
rs1017129437 2305 dbSNP
rs924945033 2317 dbSNP
rs1288853459 2327 dbSNP
rs975049862 2335 dbSNP
rs964896160 2336 dbSNP
rs543744691 2337 dbSNP
rs895000809 2360 dbSNP
rs557705946 2364 dbSNP
rs1026512284 2366 dbSNP
rs1306758813 2374 dbSNP
rs1392732942 2377 dbSNP
rs1425258077 2380 dbSNP
rs1303769585 2384 dbSNP
rs1344984882 2387 dbSNP
rs1407269800 2391 dbSNP
rs1054854596 2397 dbSNP
rs1323343364 2403 dbSNP
rs1309514310 2405 dbSNP
rs1403887512 2409 dbSNP
rs1410454713 2412 dbSNP
rs939173370 2414 dbSNP
rs1259355413 2415 dbSNP
rs899287574 2419 dbSNP
rs906465585 2420 dbSNP
rs1002214420 2421 dbSNP
rs1042302990 2421 dbSNP
rs905083843 2421 dbSNP
rs1179347785 2422 dbSNP
rs537703186 2430 dbSNP
rs144143319 2431 dbSNP
rs1162919744 2437 dbSNP
rs1365035712 2446 dbSNP
rs1422869645 2449 dbSNP
rs1300088988 2453 dbSNP
rs945401638 2467 dbSNP
rs1046366441 2471 dbSNP
rs1445273072 2476 dbSNP
rs1472342504 2477 dbSNP
rs1305221272 2482 dbSNP
rs138475108 2485 dbSNP
rs1247332728 2491 dbSNP
rs989565265 2504 dbSNP
rs1315046195 2516 dbSNP
rs913713890 2518 dbSNP
rs1228910419 2529 dbSNP
rs943412937 2539 dbSNP
rs1052314203 2545 dbSNP
rs1201568465 2553 dbSNP
rs762437901 2557 dbSNP
rs1490499841 2561 dbSNP
rs1244735098 2566 dbSNP
rs1246019620 2567 dbSNP
rs936377162 2575 dbSNP
rs910739263 2588 dbSNP
rs1461657263 2604 dbSNP
rs1219120367 2606 dbSNP
rs1448462157 2607 dbSNP
rs116599222 2609 dbSNP
rs188338707 2610 dbSNP
rs1326516072 2630 dbSNP
rs1027023418 2637 dbSNP
rs1172568137 2639 dbSNP
rs546661457 2649 dbSNP
rs1373720308 2650 dbSNP
rs1223546164 2663 dbSNP
rs1461617769 2665 dbSNP
rs1368921842 2668 dbSNP
rs942387467 2675 dbSNP
rs144802583 2679 dbSNP
rs374470709 2684 dbSNP
rs1347311595 2686 dbSNP
rs765657741 2693 dbSNP
rs1005271684 2694 dbSNP
rs1321516464 2697 dbSNP
rs963423795 2698 dbSNP
rs550471005 2703 dbSNP
rs1016372388 2705 dbSNP
rs1002183437 2706 dbSNP
rs905179014 2708 dbSNP
rs1241077422 2727 dbSNP
rs1184683726 2729 dbSNP
rs1178716796 2733 dbSNP
rs530670759 2739 dbSNP
rs759947575 2740 dbSNP
rs1262503360 2753 dbSNP
rs1433783347 2756 dbSNP
rs565181756 2757 dbSNP
rs1431657701 2760 dbSNP
rs551326804 2761 dbSNP
rs1404378033 2762 dbSNP
rs545703533 2763 dbSNP
rs1248383733 2764 dbSNP
rs1380072118 2766 dbSNP
rs1284676808 2775 dbSNP
rs892383307 2783 dbSNP
rs371419423 2796 dbSNP
rs1052662055 2799 dbSNP
rs1463291467 2805 dbSNP
rs906357150 2806 dbSNP
rs1042703233 2811 dbSNP
rs1260115442 2812 dbSNP
rs1311089940 2815 dbSNP
rs889576953 2816 dbSNP
rs945271800 2819 dbSNP
rs1480852146 2820 dbSNP
rs182412799 2823 dbSNP
rs1199041560 2828 dbSNP
rs1053760794 2832 dbSNP
rs1364588146 2846 dbSNP
rs943339413 2848 dbSNP
rs1402844626 2852 dbSNP
rs910665442 2853 dbSNP
rs1051847791 2855 dbSNP
rs933519813 2863 dbSNP
rs1363296911 2872 dbSNP
rs561283560 2877 dbSNP
rs1304366306 2878 dbSNP
rs972728585 2881 dbSNP
rs963633987 2891 dbSNP
rs1403940227 2898 dbSNP
rs909455614 2913 dbSNP
rs1281058219 2920 dbSNP
rs1358650903 2921 dbSNP
rs1050900758 2924 dbSNP
rs933711026 2929 dbSNP
rs35800996 2932 dbSNP
rs1173922401 2933 dbSNP
rs903588188 2938 dbSNP
rs1314986162 2950 dbSNP
rs1224643990 2953 dbSNP
rs1294023428 2954 dbSNP
rs559617058 2956 dbSNP
rs1221980572 2960 dbSNP
rs959028239 2963 dbSNP
rs541498798 2964 dbSNP
rs1178104359 2966 dbSNP
rs1407724404 2972 dbSNP
rs1438323350 2976 dbSNP
rs543077447 2984 dbSNP
rs1390664552 2986 dbSNP
rs1039409655 2987 dbSNP
rs1365655973 2998 dbSNP
rs190041288 3003 dbSNP
rs1033422609 3005 dbSNP
rs1355871678 3010 dbSNP
rs1442487328 3013 dbSNP
rs1297336105 3018 dbSNP
rs912222046 3028 dbSNP
rs1248072073 3031 dbSNP
rs1315689605 3032 dbSNP
rs1447375476 3036 dbSNP
rs986522082 3037 dbSNP
rs1287848334 3041 dbSNP
rs933529515 3049 dbSNP
rs1244654929 3053 dbSNP
rs1009297554 3067 dbSNP
rs1232654201 3079 dbSNP
rs1482665397 3093 dbSNP
rs1456771393 3097 dbSNP
rs1003259696 3099 dbSNP
rs970968031 3100 dbSNP
rs1020760611 3105 dbSNP
rs963559465 3106 dbSNP
rs1309816773 3121 dbSNP
rs1160880220 3123 dbSNP
rs563636134 3127 dbSNP
rs1421040948 3131 dbSNP
rs1410169542 3135 dbSNP
rs1016467186 3137 dbSNP
rs1397806616 3147 dbSNP
rs980842085 3152 dbSNP
rs1275893320 3158 dbSNP
rs1454418513 3163 dbSNP
rs1337168532 3165 dbSNP
rs1009912734 3170 dbSNP
rs1228150205 3173 dbSNP
rs1450367485 3174 dbSNP
rs34150129 3181 dbSNP
rs893754116 3181 dbSNP
rs1282446951 3182 dbSNP
rs1341635304 3184 dbSNP
rs1215380507 3188 dbSNP
rs969498088 3190 dbSNP
rs879470305 3195 dbSNP
rs879375147 3196 dbSNP
rs777322547 3199 dbSNP
rs1317519568 3205 dbSNP
rs544133350 3207 dbSNP
rs58959242 3209 dbSNP
rs1244165350 3214 dbSNP
rs1461212779 3215 dbSNP
rs1378651333 3223 dbSNP
rs1301198446 3224 dbSNP
rs1475477991 3232 dbSNP
rs771546912 3234 dbSNP
rs1166932994 3236 dbSNP
rs1013593783 3242 dbSNP
rs1470767419 3245 dbSNP
rs538999260 3246 dbSNP
rs889113254 3251 dbSNP
rs149373265 3253 dbSNP
rs933382521 3256 dbSNP
rs1371098120 3261 dbSNP
rs1328246638 3266 dbSNP
rs1431638626 3268 dbSNP
rs919433069 3270 dbSNP
rs1277673653 3271 dbSNP
rs534942657 3276 dbSNP
rs942174555 3278 dbSNP
rs1323356620 3280 dbSNP
rs909507932 3287 dbSNP
rs6706591 3288 dbSNP
rs552815256 3289 dbSNP
rs959037358 3291 dbSNP
rs1051168100 3297 dbSNP
rs1411132775 3302 dbSNP
rs1428335013 3303 dbSNP
rs185181233 3303 dbSNP
rs1483064369 3307 dbSNP
rs1464395236 3314 dbSNP
rs1160204131 3315 dbSNP
rs566925473 3317 dbSNP
rs982285649 3325 dbSNP
rs879038810 3330 dbSNP
rs919480747 3331 dbSNP
rs970477151 3333 dbSNP
rs535805702 3338 dbSNP
rs1205072638 3339 dbSNP
rs1009428829 3345 dbSNP
rs1406989977 3346 dbSNP
rs1284209530 3347 dbSNP
rs942291295 3351 dbSNP
rs1482304285 3352 dbSNP
rs1231457824 3353 dbSNP
rs957857849 3356 dbSNP
rs559100585 3360 dbSNP
rs1216533779 3368 dbSNP
rs545315432 3370 dbSNP
rs369702336 3372 dbSNP
rs1321350059 3390 dbSNP
rs1007448606 3391 dbSNP
rs1222734680 3392 dbSNP
rs969424612 3394 dbSNP
rs1310771626 3397 dbSNP
rs1431118866 3410 dbSNP
rs918020061 3415 dbSNP
rs180822086 3420 dbSNP
rs889124684 3427 dbSNP
rs536640151 3431 dbSNP
rs1030309181 3432 dbSNP
rs1364166397 3435 dbSNP
rs997912097 3437 dbSNP
rs977853035 3453 dbSNP
rs1378516832 3458 dbSNP
rs1426678131 3466 dbSNP
rs1036852521 3473 dbSNP
rs942246436 3474 dbSNP
rs1407896528 3481 dbSNP
rs956713083 3484 dbSNP
rs1336787543 3486 dbSNP
rs747799519 3489 dbSNP
rs571484811 3491 dbSNP
rs1360952210 3493 dbSNP
rs551629987 3499 dbSNP
rs528295114 3500 dbSNP
rs1264385442 3504 dbSNP
rs1000728762 3509 dbSNP
rs1250964539 3514 dbSNP
rs1437058049 3532 dbSNP
rs1176675582 3539 dbSNP
rs887909711 3542 dbSNP
rs967977462 3558 dbSNP
rs747039230 3571 dbSNP
rs1290516925 3577 dbSNP
rs1366367166 3582 dbSNP
rs1160829074 3583 dbSNP
rs1006686620 3590 dbSNP
rs890841781 3591 dbSNP
rs1397624949 3595 dbSNP
rs1446578820 3601 dbSNP
rs565831221 3611 dbSNP
rs113774246 3617 dbSNP
rs1453993128 3618 dbSNP
rs1182157480 3621 dbSNP
rs1319462942 3626 dbSNP
rs1229117297 3636 dbSNP
rs981831450 3638 dbSNP
rs533487659 3641 dbSNP
rs1270009190 3648 dbSNP
rs1210817567 3652 dbSNP
rs1488349695 3653 dbSNP
rs529362747 3665 dbSNP
rs6735144 3667 dbSNP
rs1329980361 3668 dbSNP
rs909500746 3673 dbSNP
rs1181263393 3680 dbSNP
rs1255558086 3694 dbSNP
rs1422181974 3699 dbSNP
rs988290413 3701 dbSNP
rs138772247 3704 dbSNP
rs150225026 3705 dbSNP
rs948227050 3708 dbSNP
rs1032139225 3710 dbSNP
rs1332766239 3715 dbSNP
rs756015265 3716 dbSNP
rs1376314997 3721 dbSNP
rs1386064766 3722 dbSNP
rs953302745 3727 dbSNP
rs1030644109 3735 dbSNP
rs1295710778 3740 dbSNP
rs997566396 3742 dbSNP
rs1381023414 3743 dbSNP
rs897812231 3752 dbSNP
rs957014677 3753 dbSNP
rs1264754898 3763 dbSNP
rs923926416 3765 dbSNP
rs1015014719 3774 dbSNP
rs1457425529 3778 dbSNP
rs751602047 3781 dbSNP
rs1156319304 3784 dbSNP
rs979442008 3789 dbSNP
rs1379936412 3790 dbSNP
rs777681893 3791 dbSNP
rs1018175609 3800 dbSNP
rs567703314 3803 dbSNP
rs1264004956 3810 dbSNP
rs1433009338 3812 dbSNP
rs1477585126 3814 dbSNP
rs1265677290 3828 dbSNP
rs1006660098 3840 dbSNP
rs114421199 3857 dbSNP
rs191052988 3859 dbSNP
rs187017101 3861 dbSNP
rs1175822206 3863 dbSNP
rs1267671454 3871 dbSNP
rs1357890445 3872 dbSNP
rs753003184 3873 dbSNP
rs1206919126 3877 dbSNP
rs993896481 3887 dbSNP
rs1359406084 3892 dbSNP
rs1397740949 3894 dbSNP
rs896897506 3901 dbSNP
rs1016604728 3902 dbSNP
rs1347201616 3903 dbSNP
rs1298969831 3904 dbSNP
rs1318584054 3905 dbSNP
rs1055859146 3911 dbSNP
rs1216428587 3915 dbSNP
rs937498890 3917 dbSNP
rs1005252978 3919 dbSNP
rs1488043600 3923 dbSNP
rs888012438 3924 dbSNP
rs1232407477 3925 dbSNP
rs907476658 3927 dbSNP
rs755841759 3928 dbSNP
rs1205553148 3929 dbSNP
rs949117225 3933 dbSNP
rs555882516 3941 dbSNP
rs1057038342 3943 dbSNP
rs935427297 3947 dbSNP
rs1417379555 3948 dbSNP
rs1304455507 3954 dbSNP
rs1365773614 3958 dbSNP
rs1435316851 3961 dbSNP
rs924061638 3962 dbSNP
rs913525507 3971 dbSNP
rs979388195 3976 dbSNP
rs1470706632 3980 dbSNP
rs987910976 3985 dbSNP
rs1402254438 3988 dbSNP
rs936382799 3992 dbSNP
rs1351447471 4001 dbSNP
rs765530211 4008 dbSNP
rs74564500 4010 dbSNP
rs953187692 4014 dbSNP
rs1030281447 4015 dbSNP
rs1221182070 4022 dbSNP
rs911239040 4025 dbSNP
rs976370228 4037 dbSNP
rs1179792453 4038 dbSNP
rs1238053818 4041 dbSNP
rs962070422 4044 dbSNP
rs116784508 4048 dbSNP
rs1450418971 4049 dbSNP
rs1404381575 4052 dbSNP
rs973015407 4057 dbSNP
rs1363981966 4058 dbSNP
rs1356030987 4062 dbSNP
rs1447184487 4067 dbSNP
rs1330462775 4069 dbSNP
rs961143778 4078 dbSNP
rs1016719090 4091 dbSNP
rs1186907143 4093 dbSNP
rs1357218219 4095 dbSNP
rs1005326451 4097 dbSNP
rs1444242181 4102 dbSNP
rs556621065 4115 dbSNP
rs1199897082 4116 dbSNP
rs1342787618 4117 dbSNP
rs1199623953 4119 dbSNP
rs867831571 4123 dbSNP
rs1257831609 4124 dbSNP
rs1022646214 4128 dbSNP
rs1186029798 4132 dbSNP
rs1237546515 4142 dbSNP
rs1012462302 4143 dbSNP
rs1179730289 4143 dbSNP
rs1421151759 4148 dbSNP
rs1276614205 4155 dbSNP
rs1465821134 4156 dbSNP
rs140911030 4158 dbSNP
rs952157790 4160 dbSNP
rs571192971 4161 dbSNP
rs557780854 4171 dbSNP
rs1034381292 4173 dbSNP
rs1397917665 4176 dbSNP
rs1470911648 4177 dbSNP
rs1334791405 4189 dbSNP
rs1001698375 4190 dbSNP
rs181935361 4191 dbSNP
rs1282533760 4211 dbSNP
rs1364272412 4216 dbSNP
rs565742795 4218 dbSNP
rs1056627710 4228 dbSNP
rs1316515600 4229 dbSNP
rs935526380 4230 dbSNP
rs1010866109 4231 dbSNP
rs1442379668 4239 dbSNP
rs1449737794 4241 dbSNP
rs892149319 4265 dbSNP
rs1052072891 4276 dbSNP
rs1477936231 4283 dbSNP
rs1192566324 4286 dbSNP
rs1421163167 4287 dbSNP
rs1481321890 4289 dbSNP
rs879683392 4294 dbSNP
rs1412694979 4295 dbSNP
rs936302492 4298 dbSNP
rs925062248 4301 dbSNP
rs1400833490 4304 dbSNP
rs1458521806 4312 dbSNP
rs549248307 4313 dbSNP
rs1277848873 4315 dbSNP
rs1050165048 4328 dbSNP
rs1235822547 4331 dbSNP
rs933918161 4333 dbSNP
rs931810680 4334 dbSNP
rs923055468 4336 dbSNP
rs922542094 4344 dbSNP
rs976040691 4353 dbSNP
rs1285740778 4357 dbSNP
rs1488352597 4357 dbSNP
rs1215407384 4359 dbSNP
rs529091616 4380 dbSNP
rs1490748210 4381 dbSNP
rs1199225165 4382 dbSNP
rs1376873807 4386 dbSNP
rs1430874253 4397 dbSNP
rs961480661 4406 dbSNP
rs1160297550 4411 dbSNP
rs1016792084 4419 dbSNP
rs907769493 4424 dbSNP
rs984782289 4425 dbSNP
rs983839608 4433 dbSNP
rs969798465 4435 dbSNP
rs1324600981 4450 dbSNP
rs1167003456 4458 dbSNP
rs1434897806 4463 dbSNP
rs570198964 4465 dbSNP
rs1312156784 4469 dbSNP
rs952045792 4477 dbSNP
rs1473912953 4478 dbSNP
rs1283271979 4480 dbSNP
rs1034433659 4481 dbSNP
rs1001541402 4485 dbSNP
rs1369233790 4486 dbSNP
rs1266408530 4488 dbSNP
rs375033293 4492 dbSNP
rs1238663714 4502 dbSNP
rs1439045875 4503 dbSNP
rs1158061578 4504 dbSNP
rs971591995 4505 dbSNP
rs761197975 4517 dbSNP
rs1024870567 4525 dbSNP
rs1459636656 4527 dbSNP
rs1164090931 4531 dbSNP
rs376974981 4533 dbSNP
rs772631998 4535 dbSNP
rs1186946482 4537 dbSNP
rs200307037 4550 dbSNP
rs5836860 4554 dbSNP
rs1014371277 4573 dbSNP
rs1306443156 4575 dbSNP
rs1446718196 4575 dbSNP
rs1341819255 4578 dbSNP
rs78389197 4583 dbSNP
rs1054708961 4584 dbSNP
rs1353847628 4593 dbSNP
rs1200262055 4603 dbSNP
rs1258479155 4605 dbSNP
rs1000566647 4608 dbSNP
rs1176772877 4609 dbSNP
rs1236398755 4613 dbSNP
rs751010361 4618 dbSNP
rs1188356686 4623 dbSNP
rs1229778601 4629 dbSNP
rs1368071757 4631 dbSNP
rs1456584456 4632 dbSNP
rs762644993 4636 dbSNP
rs1050175055 4643 dbSNP
rs902659420 4648 dbSNP
rs1043879055 4649 dbSNP
rs771656526 4650 dbSNP
rs10192715 4661 dbSNP
rs889905434 4672 dbSNP
rs1338269650 4674 dbSNP
rs1049741314 4685 dbSNP
rs1040638646 4692 dbSNP
rs940515257 4693 dbSNP
rs1410955647 4699 dbSNP
rs189877637 4700 dbSNP
rs984666375 4701 dbSNP
rs952057163 4703 dbSNP
rs939928607 4705 dbSNP
rs1255573800 4706 dbSNP
rs541370611 4710 dbSNP
rs1196209843 4713 dbSNP
rs184957220 4717 dbSNP
rs983994759 4722 dbSNP
rs969788511 4723 dbSNP
rs1379841758 4729 dbSNP
rs768294109 4732 dbSNP
rs992488204 4735 dbSNP
rs971858953 4737 dbSNP
rs78544526 4738 dbSNP
rs749087273 4740 dbSNP
rs542051544 4743 dbSNP
rs7422554 4752 dbSNP
rs576207444 4762 dbSNP
rs1031347682 4769 dbSNP
rs1216525808 4777 dbSNP
rs989409448 4791 dbSNP
rs956224757 4795 dbSNP
rs1000151678 4797 dbSNP
rs1312642233 4798 dbSNP
rs1033270190 4801 dbSNP
rs1219046291 4806 dbSNP
rs966934293 4806 dbSNP
rs1264115708 4812 dbSNP
rs1488106428 4813 dbSNP
rs398090915 4813 dbSNP
rs5836859 4813 dbSNP
rs76551540 4813 dbSNP
rs1472241858 4814 dbSNP
rs1434250670 4815 dbSNP
rs200061446 4815 dbSNP
rs1000410985 4817 dbSNP
rs1011061841 4821 dbSNP
rs889851662 4824 dbSNP
rs1451955056 4828 dbSNP
rs4427983 4832 dbSNP
rs769639134 4833 dbSNP
rs1295055063 4838 dbSNP
rs4334455 4850 dbSNP
rs1299165977 4852 dbSNP
rs577572616 4855 dbSNP
rs1355801581 4858 dbSNP
rs373511153 4866 dbSNP
rs1037038453 4888 dbSNP
rs750027137 4888 dbSNP
rs1028632321 4890 dbSNP
rs1048244671 4894 dbSNP
rs1191001214 4896 dbSNP
rs948558544 4896 dbSNP
rs1227206983 4898 dbSNP
rs557686772 4903 dbSNP
rs901612156 4911 dbSNP
rs1398593279 4918 dbSNP
rs534323057 4921 dbSNP
rs1350230461 4924 dbSNP
rs566008888 4926 dbSNP
rs555687231 4934 dbSNP
rs1291606974 4936 dbSNP
rs1378940334 4937 dbSNP
rs1447444625 4940 dbSNP
rs181390686 4943 dbSNP
rs924231182 4955 dbSNP
rs1439127135 4956 dbSNP
rs1292228352 4968 dbSNP
rs886240916 4982 dbSNP
rs966922815 4985 dbSNP
rs1323193995 4986 dbSNP
rs35899097 4996 dbSNP
rs1459471552 5007 dbSNP
rs1022529845 5008 dbSNP
rs1468200956 5013 dbSNP
rs1414025401 5015 dbSNP
rs989711954 5016 dbSNP
rs1048971989 5017 dbSNP
rs1028500455 5018 dbSNP
rs535676398 5020 dbSNP
rs901297759 5027 dbSNP
rs927311122 5029 dbSNP
rs1440057466 5030 dbSNP
rs980540250 5035 dbSNP
rs758553227 5039 dbSNP
rs1456718758 5043 dbSNP
rs917354096 5049 dbSNP
rs1267781018 5051 dbSNP
rs1320498381 5064 dbSNP
rs988877208 5071 dbSNP
rs188599236 5076 dbSNP
rs1436610509 5077 dbSNP
rs1211539980 5083 dbSNP
rs1192846992 5090 dbSNP
rs1048317135 5095 dbSNP
rs1478257910 5100 dbSNP
rs1033154284 5105 dbSNP
rs1185442435 5106 dbSNP
rs1425475849 5114 dbSNP
rs1477995952 5133 dbSNP
rs1169732344 5135 dbSNP
rs1417216780 5149 dbSNP
rs138222282 5156 dbSNP
rs1466001512 5160 dbSNP
rs1268301463 5170 dbSNP
rs1414364511 5170 dbSNP
rs1311345663 5176 dbSNP
rs1207575327 5179 dbSNP
rs1056968356 5180 dbSNP
rs145549915 5182 dbSNP
rs1221411640 5185 dbSNP
rs748220691 5190 dbSNP
rs924417360 5193 dbSNP
rs1277973745 5200 dbSNP
rs1337957548 5206 dbSNP
rs979018934 5213 dbSNP
rs954304140 5214 dbSNP
rs529221316 5217 dbSNP
rs947033225 5225 dbSNP
rs1274663450 5227 dbSNP
rs140452757 5232 dbSNP
rs1441384555 5234 dbSNP
rs547809538 5235 dbSNP
rs527669202 5236 dbSNP
rs989659624 5241 dbSNP
rs1488413963 5244 dbSNP
rs1192594836 5248 dbSNP
rs562071821 5249 dbSNP
rs901503767 5250 dbSNP
rs1019119629 5251 dbSNP
rs1004599612 5252 dbSNP
rs886294748 5271 dbSNP
rs1048852571 5282 dbSNP
rs1343478676 5295 dbSNP
rs1434135773 5302 dbSNP
rs930466290 5303 dbSNP
rs1362621521 5309 dbSNP
rs765676936 5310 dbSNP
rs1400859220 5318 dbSNP
rs1178205486 5326 dbSNP
rs76254772 5327 dbSNP
rs1439187451 5330 dbSNP
rs965832345 5331 dbSNP
rs1347825297 5338 dbSNP
rs531801707 5343 dbSNP
rs1287553658 5353 dbSNP
rs1171534641 5354 dbSNP
rs1451039020 5361 dbSNP
rs1353955333 5362 dbSNP
rs1215528906 5367 dbSNP
rs1004317694 5396 dbSNP
rs1248326322 5398 dbSNP
rs1187504620 5399 dbSNP
rs562699498 5403 dbSNP
rs1238722631 5409 dbSNP
rs917218026 5413 dbSNP
rs543152712 5414 dbSNP
rs894430210 5421 dbSNP
rs1278465214 5426 dbSNP
rs1158255295 5436 dbSNP
rs934701903 5438 dbSNP
rs1407391179 5448 dbSNP
rs530049856 5449 dbSNP
rs777304111 5453 dbSNP
rs978946876 5457 dbSNP
rs1439413897 5458 dbSNP
rs1298660989 5464 dbSNP
rs1377043706 5465 dbSNP
rs754265317 5466 dbSNP
rs1237850915 5470 dbSNP
rs1227920080 5472 dbSNP
rs1258533986 5475 dbSNP
rs954189731 5476 dbSNP
rs921547177 5479 dbSNP
rs1288895708 5486 dbSNP
rs1467076743 5495 dbSNP
rs976998090 5501 dbSNP
rs1041422348 5505 dbSNP
rs966104463 5508 dbSNP
rs183967442 5509 dbSNP
rs756406644 5523 dbSNP
rs985800597 5529 dbSNP
rs1164183102 5530 dbSNP
rs1460309692 5539 dbSNP
rs1334008071 5540 dbSNP
rs1401690158 5541 dbSNP
rs1390274117 5547 dbSNP
rs1310984297 5555 dbSNP
rs1341833169 5556 dbSNP
rs1245141878 5558 dbSNP
rs932889710 5563 dbSNP
rs1332468823 5564 dbSNP
rs1005053615 5566 dbSNP
rs191256884 5573 dbSNP
rs977307028 5574 dbSNP
rs1480269466 5575 dbSNP
rs1195240234 5580 dbSNP
rs1248576883 5581 dbSNP
rs1444338808 5582 dbSNP
rs1167673161 5583 dbSNP
rs1027342530 5584 dbSNP
rs1426398813 5590 dbSNP
rs908723513 5592 dbSNP
rs775779737 5606 dbSNP
rs1461932276 5609 dbSNP
rs1295934531 5619 dbSNP
rs1403810361 5629 dbSNP
rs190641001 5633 dbSNP
rs572051199 5640 dbSNP
rs905669286 5656 dbSNP
rs982830035 5657 dbSNP
rs1482635406 5661 dbSNP
rs952774573 5665 dbSNP
rs1306830808 5671 dbSNP
rs1209317057 5672 dbSNP
rs541111522 5685 dbSNP
rs1044707058 5689 dbSNP
rs1225232309 5690 dbSNP
rs1484270362 5704 dbSNP
rs1347279323 5705 dbSNP
rs1026984577 5710 dbSNP
rs1014148657 5715 dbSNP
rs1211711464 5729 dbSNP
rs1257025398 5730 dbSNP
rs555722205 5732 dbSNP
rs535714690 5733 dbSNP
rs1428438768 5737 dbSNP
rs1305992166 5738 dbSNP
rs1169008187 5739 dbSNP
rs1378840461 5740 dbSNP
rs1402289199 5742 dbSNP
rs1315042137 5747 dbSNP
rs1229024927 5751 dbSNP
rs1344004824 5755 dbSNP
rs1378486917 5758 dbSNP
rs115204900 5761 dbSNP
rs1298574213 5766 dbSNP
rs1003218486 5769 dbSNP
rs1380434221 5770 dbSNP
rs926065088 5777 dbSNP
rs902993041 5781 dbSNP
rs1331640821 5786 dbSNP
rs527773526 5789 dbSNP
rs1279723919 5790 dbSNP
rs1307183800 5795 dbSNP
rs1011279710 5796 dbSNP
rs1219154608 5801 dbSNP
rs932815380 5804 dbSNP
rs7588408 5806 dbSNP
rs570958631 5814 dbSNP
rs1165033437 5818 dbSNP
rs545487134 5822 dbSNP
rs1414992765 5831 dbSNP
rs1270051141 5837 dbSNP
rs1183653194 5838 dbSNP
rs965631433 5840 dbSNP
rs1421104343 5849 dbSNP
rs1158924013 5851 dbSNP
rs1253085732 5855 dbSNP
rs931690281 5857 dbSNP
rs922948931 5861 dbSNP
rs908774950 5864 dbSNP
rs1302762819 5868 dbSNP
rs1440154633 5868 dbSNP
rs1368924524 5870 dbSNP
rs576201453 5871 dbSNP
rs1307921594 5874 dbSNP
rs1316590939 5876 dbSNP
rs950386287 5887 dbSNP
rs185434004 5892 dbSNP
rs12614071 5904 dbSNP
rs193167413 5905 dbSNP
rs1022768093 5906 dbSNP
rs994287167 5909 dbSNP
rs372034847 5917 dbSNP
rs1014488527 5938 dbSNP
rs920035367 5939 dbSNP
rs531836257 5945 dbSNP
rs1351047506 5948 dbSNP
rs895754708 5962 dbSNP
rs1053440893 5964 dbSNP
rs1323867452 5965 dbSNP
rs368211612 5979 dbSNP
rs998888518 5981 dbSNP
rs904491963 5982 dbSNP
rs1449041792 5984 dbSNP
rs1298826913 5985 dbSNP
rs1372855265 5990 dbSNP
rs1222345472 5991 dbSNP
rs1293803575 5993 dbSNP
rs1457116116 5997 dbSNP
rs1315233562 5999 dbSNP
rs1335977426 6000 dbSNP
rs1391783599 6004 dbSNP
rs1160753689 6012 dbSNP
rs1271778377 6013 dbSNP
rs958707578 6018 dbSNP
rs1204536798 6021 dbSNP
rs1457260576 6025 dbSNP
rs1413423751 6026 dbSNP
rs1181719216 6028 dbSNP
rs1418280773 6031 dbSNP
rs1417750466 6032 dbSNP
rs1043167192 6033 dbSNP
rs932700990 6038 dbSNP
rs1425609616 6042 dbSNP
rs1171214205 6047 dbSNP
rs1410481218 6047 dbSNP
rs921447696 6049 dbSNP
rs1041245446 6051 dbSNP
rs552779866 6056 dbSNP
rs1356371060 6058 dbSNP
rs1414476327 6059 dbSNP
rs944185306 6059 dbSNP
rs1320607001 6069 dbSNP
rs6433998 6070 dbSNP
rs753678647 6071 dbSNP
rs776648267 6071 dbSNP
rs1468206296 6072 dbSNP
rs1251307975 6076 dbSNP
rs1020069240 6082 dbSNP
rs1265145477 6084 dbSNP
rs745628550 6089 dbSNP
rs982989335 6098 dbSNP
rs928975711 6101 dbSNP
rs1408237045 6103 dbSNP
rs1260114278 6109 dbSNP
rs1236765297 6111 dbSNP
rs532584933 6116 dbSNP
rs1376229789 6117 dbSNP
rs776684678 6118 dbSNP
rs920237005 6121 dbSNP
rs1328600919 6125 dbSNP
rs892870098 6130 dbSNP
rs1050159170 6132 dbSNP
rs1360531496 6138 dbSNP
rs996342408 6142 dbSNP
rs1280441280 6145 dbSNP
rs375830673 6153 dbSNP
rs1346691363 6157 dbSNP
rs1208323918 6163 dbSNP
rs973139261 6164 dbSNP
rs1322125810 6170 dbSNP
rs1040447393 6172 dbSNP
rs944299280 6185 dbSNP
rs1387241877 6187 dbSNP
rs908828339 6197 dbSNP
rs969862522 6199 dbSNP
rs1023117783 6200 dbSNP
rs1195566810 6202 dbSNP
rs992714478 6207 dbSNP
rs1452294551 6210 dbSNP
rs1379807732 6212 dbSNP
rs1387445869 6216 dbSNP
rs1401611902 6217 dbSNP
rs770765076 6220 dbSNP
rs1343893404 6223 dbSNP
rs931491736 6227 dbSNP
rs960134695 6230 dbSNP
rs371282203 6234 dbSNP
rs920107336 6237 dbSNP
rs1031599254 6242 dbSNP
rs991559076 6244 dbSNP
rs937427941 6252 dbSNP
rs116690448 6255 dbSNP
rs1190719107 6256 dbSNP
rs904542965 6257 dbSNP
rs1453249809 6259 dbSNP
rs1214288574 6264 dbSNP
rs1021607575 6265 dbSNP
rs879243570 6266 dbSNP
rs1465439807 6275 dbSNP
rs1253681628 6279 dbSNP
rs144931456 6282 dbSNP
rs1191865466 6283 dbSNP
rs1365690279 6287 dbSNP
rs899940633 6296 dbSNP
rs1203426149 6309 dbSNP
rs1158343599 6313 dbSNP
rs1406332952 6314 dbSNP
rs1463451806 6319 dbSNP
rs967255842 6329 dbSNP
rs1020183318 6330 dbSNP
rs1256458261 6340 dbSNP
rs1437994629 6348 dbSNP
rs1330323436 6354 dbSNP
rs1041525700 6363 dbSNP
rs1237964180 6364 dbSNP
rs1336737302 6366 dbSNP
rs1233700068 6367 dbSNP
rs1272432581 6368 dbSNP
rs572703298 6370 dbSNP
rs1233371692 6384 dbSNP
rs574042954 6385 dbSNP
rs944255246 6386 dbSNP
rs1345468055 6395 dbSNP
rs887242012 6405 dbSNP
rs1029250179 6412 dbSNP
rs868211657 6418 dbSNP
rs1047319001 6428 dbSNP
rs1476366222 6431 dbSNP
rs995899498 6452 dbSNP
rs901628658 6456 dbSNP
rs1460389137 6459 dbSNP
rs931534093 6459 dbSNP
rs920163210 6460 dbSNP
rs1315613114 6461 dbSNP
rs1004578709 6467 dbSNP
rs561628379 6471 dbSNP
rs1397205689 6480 dbSNP
rs1326390591 6482 dbSNP
rs1357009972 6487 dbSNP
rs973066930 6491 dbSNP
rs748239197 6499 dbSNP
rs1292466081 6513 dbSNP
rs779075294 6522 dbSNP
rs948387891 6526 dbSNP
rs1229613727 6539 dbSNP
rs1253123654 6541 dbSNP
rs1340093687 6546 dbSNP
rs188511922 6552 dbSNP
rs1249804205 6563 dbSNP
rs1434531279 6564 dbSNP
rs1189078063 6567 dbSNP
rs992952355 6577 dbSNP
rs959903846 6586 dbSNP
rs1170820868 6591 dbSNP
rs1196018904 6607 dbSNP
rs892194325 6608 dbSNP
rs898626200 6608 dbSNP
rs1056407354 6609 dbSNP
rs1165656160 6609 dbSNP
rs1031486226 6613 dbSNP
rs928742584 6618 dbSNP
rs1353377860 6627 dbSNP
rs1372655309 6628 dbSNP
rs981448570 6630 dbSNP
rs182804206 6636 dbSNP
rs1226704086 6638 dbSNP
rs1272641736 6641 dbSNP
rs1350288679 6643 dbSNP
rs977350382 6644 dbSNP
rs968652558 6648 dbSNP
rs1479360494 6653 dbSNP
rs1021535794 6658 dbSNP
rs1482447742 6660 dbSNP
rs1256865008 6666 dbSNP
rs1210038650 6671 dbSNP
rs191865662 6678 dbSNP
rs554134949 6681 dbSNP
rs1186096170 6687 dbSNP
rs1396400718 6692 dbSNP
rs749564541 6705 dbSNP
rs1205519494 6710 dbSNP
rs1338357295 6711 dbSNP
rs957286379 6720 dbSNP
rs1268030051 6726 dbSNP
rs1246432759 6735 dbSNP
rs576934039 6743 dbSNP
rs1384137837 6750 dbSNP
rs780121049 6751 dbSNP
rs1373361097 6753 dbSNP
rs149904988 6757 dbSNP
rs1302866698 6772 dbSNP
rs1310696414 6780 dbSNP
rs1241558439 6785 dbSNP
rs1019131146 6786 dbSNP
rs1004650850 6789 dbSNP
rs1207461791 6791 dbSNP
rs1254315566 6792 dbSNP
rs1374105477 6794 dbSNP
rs1310271691 6802 dbSNP
rs1410831344 6805 dbSNP
rs1396102213 6815 dbSNP
rs887288947 6829 dbSNP
rs772533159 6830 dbSNP
rs1473853276 6837 dbSNP
rs886076299 6840 dbSNP
rs1451527340 6842 dbSNP
rs1327768849 6847 dbSNP
rs1027330221 6848 dbSNP
rs1047246972 6865 dbSNP
rs931460524 6867 dbSNP
rs1253827586 6871 dbSNP
rs1365726626 6883 dbSNP
rs367752226 6888 dbSNP
rs533995309 6891 dbSNP
rs1308149897 6905 dbSNP
rs1436986194 6907 dbSNP
rs1045282065 6908 dbSNP
rs1226953295 6909 dbSNP
rs948420435 6921 dbSNP
rs1275557850 6928 dbSNP
rs898779460 6941 dbSNP
rs915522356 6942 dbSNP
rs937530915 6946 dbSNP
rs1481409804 6951 dbSNP
rs1177485432 6952 dbSNP
rs867918707 6954 dbSNP
rs1249399971 6957 dbSNP
rs1056901989 6966 dbSNP
rs907387109 6973 dbSNP
rs938402681 6985 dbSNP
rs748488367 6991 dbSNP
rs924344759 6993 dbSNP
rs1348276123 6994 dbSNP
rs1444615952 6997 dbSNP
rs946144480 6999 dbSNP
rs564874443 7002 dbSNP
rs1408340525 7003 dbSNP
rs1295555712 7008 dbSNP
rs1356629230 7011 dbSNP
rs554588605 7019 dbSNP
rs1233285064 7021 dbSNP
rs1287118822 7022 dbSNP
rs1054424555 7025 dbSNP
rs1230882912 7029 dbSNP
rs977276835 7032 dbSNP
rs935925448 7034 dbSNP
rs756563623 7039 dbSNP
rs1204613518 7041 dbSNP
rs968540143 7044 dbSNP
rs537841781 7046 dbSNP
rs1354137778 7051 dbSNP
rs139447743 7053 dbSNP
rs1258011763 7065 dbSNP
rs766156641 7068 dbSNP
rs1443432792 7069 dbSNP
rs975704531 7070 dbSNP
rs1180101484 7088 dbSNP
rs1421581274 7090 dbSNP
rs966245048 7095 dbSNP
rs964082124 7098 dbSNP
rs768074325 7102 dbSNP
rs1315177904 7103 dbSNP
rs1327167647 7104 dbSNP
rs755778649 7110 dbSNP
rs186978070 7121 dbSNP
rs545508615 7122 dbSNP
rs911741514 7128 dbSNP
rs951487318 7129 dbSNP
rs1214595378 7130 dbSNP
rs572013860 7136 dbSNP
rs763552763 7157 dbSNP
rs1027317348 7162 dbSNP
rs182235220 7164 dbSNP
rs962976200 7169 dbSNP
rs62188259 7171 dbSNP
rs566917780 7177 dbSNP
rs1475730728 7178 dbSNP
rs1187155568 7193 dbSNP
rs1389705787 7202 dbSNP
rs1447875724 7213 dbSNP
rs1034992357 7214 dbSNP
rs1376297613 7216 dbSNP
rs898633354 7217 dbSNP
rs1045321575 7222 dbSNP
rs1012890356 7226 dbSNP
rs1414224795 7229 dbSNP
rs1332633694 7234 dbSNP
rs1347441165 7235 dbSNP
rs1432158746 7239 dbSNP
rs1319297997 7253 dbSNP
rs1362470179 7254 dbSNP
rs1235865889 7258 dbSNP
rs1303598329 7260 dbSNP
rs1469490599 7265 dbSNP
rs547481038 7270 dbSNP
rs907332400 7272 dbSNP
rs1045878668 7278 dbSNP
rs1447510652 7282 dbSNP
rs1215057869 7284 dbSNP
rs1010273396 7290 dbSNP
rs1463548886 7295 dbSNP
rs894155538 7299 dbSNP
rs527334677 7301 dbSNP
rs561764229 7302 dbSNP
rs147365379 7309 dbSNP
rs1054371944 7320 dbSNP
rs1477850864 7325 dbSNP
rs531310814 7332 dbSNP
rs1320399062 7336 dbSNP
rs371224408 7336 dbSNP
rs563230372 7336 dbSNP
rs921972320 7336 dbSNP
rs924398422 7339 dbSNP
rs944646910 7341 dbSNP
rs1270645852 7342 dbSNP
rs1041482150 7344 dbSNP
rs1224810869 7360 dbSNP
rs1350511228 7361 dbSNP
rs911686867 7363 dbSNP
rs1433941346