miRTarBase - #MIRT566834 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAP3K7   
Synonyms CSCF, FMD2, MEKK7, TAK1, TGF1a
Description mitogen-activated protein kinase kinase kinase 7
Transcript NM_145332   
Other Transcripts NM_145331 , NM_003188 , NM_145333   
Expression
Putative miRNA Targets on MAP3K7
3'UTR of MAP3K7
(miRNA target sites are highlighted)
>MAP3K7|NM_145332|3'UTR
   1 AAAGGACCAGCAAAATACATCTCGCCTGGTACAGGAACATAAAAAGCTTTTAGATGAAAACAAAAGCCTTTCTACTTACT
  81 ACCAGCAATGCAAAAAACAACTAGAGGTCATCAGAAGTCAGCAGCAGAAACGACAAGGCACTTCATGATTCTCTGGGACC
 161 GTTACATTTTGAAATATGCAAAGAAAGACTTTTTTTTTAAGGAAAGGAAAACCTTATAATGACGATTCATGAGTGTTAGC
 241 TTTTTGGCGTGTTCTGAATGCCAACTGCCTATATTTGCTGCATTTTTTTCATTGTTTATTTTCCTTTTCTCATGGTGGAC
 321 ATACAATTTTACTGTTTCATTGCATAACATGGTAGCATCTGTGACTTGAATGAGCAGCACTTTGCAACTTCAAAACAGAT
 401 GCAGTGAACTGTGGCTGTATATGCATGCTCATTGTGTGAAGGCTAGCCTAACAGAACAGGAGGTATCAAACTAGCTGCTA
 481 TGTGCAAACAGCGTCCATTTTTTCATATTAGAGGTGGAACCTCAAGAATGACTTTATTCTTGTATCTCATCTCAAAATAT
 561 TAATAATTTTTTTCCCAAAAGATGGTATATACCAAGTTAAAGACAGGGTATTATAAATTTAGAGTGATTGGTGGTATATT
 641 ACGGAAATACGGAACCTTTAGGGATAGTTCCGTGTAAGGGCTTTGATGCCAGCATCCTTGGATCAGTACTGAACTCAGTT
 721 CCATCCGTAAAATATGTAAAGGTAAGTGGCAGCTGCTCTATTTAATGAAAGCAGTTTTACCGGATTTTGTTAGACTAAAA
 801 TTTGATTGTGATACATTGAACAAAATGGAACTCATTTTTTTTTAAGGAGTAAAGATTTTTAATTCTGTGATTGTGTGTAT
 881 GTGTGTTGAAACTGTAAAGCTTTTATGACTCTAATATTAATCTCTTAAATGAAATTAAAAGGCAAAAGAACATGATTGAG
 961 CTTAAATGATCATTTCTTCCTGCAGTGATTCTTGGATTGTTTTCTCATGTATTTGAAAAAAAAAAAATGAAGAAAAATAA
1041 TGGAAAATGGAAGTAATTACTCCAGCTAAAAAAAGCTTGGACTTAGATTTCTTTTTATGATACCAAATGAGAAATAAACC
1121 AGGCAAATCAGAAGGAAGTTAAAGAAGCAAATATAAATTCAACAAGTGTCCTAATTATCCTGGATATTGGAATATTTGAT
1201 TTTCCTTACAATCCCGTTCTAGAATGCCTGCCGCCTTTCAACACTTTCAAGAGAATTTCAACACTTACAGAGTATTTATA
1281 TTGTTAACAGTAATTTTGCTACCAAAACCTTCAGAATAACTTTAATAATAAAATGACACTGAAATAATAGACTATACAAA
1361 CTCTATATTTTTTCAGTTGGTGTTAAAATAAGTCACATTTTGATACCAGTACAAGATGTCTTTTAAATAAGGATGTCATC
1441 AGTCTGATTTTTATAGCATTAATGTTTTATGAAGAAAAAGTTCAAAATGAAAGCATTAATTGCTGTGATTATTAGAATTC
1521 TATCATGACTGTATTGTAGTTTTTGCTCTATTTCAGATAAGCAAGATCTAAGAAGTTATCAAAACTATTCTTTAAAATGC
1601 TAAAGCAGGTAACTTTTTCTTCCATTATTTTTTCCTCCTACCACTGAGTTTTGTAATGAATTCCTTGTGTATACAAGCAA
1681 TACAGGTGAATACTAAACTGTTATTTTTAGCTTCTTCAAAAGCTATTTTAGAAAGCTTCCTGGAAATAAATGTCTTCTGT
1761 CATTTAATTTAAATAAAAGGAGTGTTAATTGTTCCCAAATTTGATTACCTAGCTGAAACAGATATTGGATTCAGCATAGT
1841 AATAGTAAAATAAAATTGGCAGAGAAAATAACTGTAGACTAGGATAAAGCATGACTCCTCCATAGCATTGTTGCTTGTAT
1921 GTACATCTGTCACTCCACTGAAAGGGACCTAGTCACTTTAAAGAGGCCTTTTATCTCAGCACGAGATATCCAAGCGTGAA
2001 TGCTAAGGCTTGATGTTTCCATTAGGATTTAGCATTCGAGATTTCAGATTTTATTTATAGTCATTGATGTGTTTTGCTGT
2081 ATTATAACACATTTAAGGGAAATTTTATTATGGTTTTTACATGTAGTCATTTCATAAAAATATCCAGATAGGTAAATGGA
2161 AGAAAATAGTAGATTTTAGTCATGGTACCAAATGCAAGAGGCTGTTGAACAGTTGCTTGTTTGTTTACAGTAAGTTCCTT
2241 GAGATTTTCAGTACTGTAGTTGCCCTGGACATTGAGTACAGTTCAGCCTTACTCTGTTTTTAAGTAGTTGTGTTGTCAAT
2321 TTCATGCTTTTAAGTCCTGATGATCCTTGGAGATGGGAGAAAAAGATACCAGGGATAATTAAAATCCACAGCCAGTTTCA
2401 TCAGTTTCCTCATCCATCCTGCAAATAAAAATGTTAACAAGGAGCCAAACTTATTCGTTCTGGTTTTACAATTTATTTTG
2481 ACCGTTTTTTGGGTGAAAATTGCAAACAGCCAAGCAAGTGGCTGGAATGCCCCAGTCTAAGAAATTCAAAAACAATCACT
2561 GAGTAAGCCCTAATTACATTAATTACATTTTACTCTTGACTCCAGGAAAAGAAAGCAAGCTTTTATCTAATCTAGAGGGA
2641 AGTATTCGTGAGCAATAAAAATCACTTTTTTGAGTTGAATAATAATCAGTTAAGAATATTTACCGCATAGCAACACAACA
2721 TATAAAGATTTGTTACAAGTTGTTTACGGATGTTTGACTATTTTTGCTGAAGTATTTTAGAGTATTGAATGTCTTCTCTC
2801 TTCAAGTTTCTTTCATGTTCCTAATTTCAGCTCCTGTAGCCAGAGATCACAGGTCTTCCCTGTGAAACTTTGGTTTCTTT
2881 CTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATGGTAGTAAGTTCTACTTCTACTTCTGTCATTCAGA
2961 ACATTTTATGTCAAATGATGTAATGCAGAAATTCTTGTGCATATTTGTAACTGAAGGAAGCTTTTTAGATTTATTTTTGT
3041 TTTTAATAAAATTCAGATTCCTATTCTAAACTGGTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guGUU--UGGUAAUACACGACGau 5'
            |||  :||  ||| ||||||  
Target 5' gcCAACTGCCTATATTTGCTGCat 3'
260 - 283 142.00 -10.80
2
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             ||| |||||  |||||:  
Target 5' atgAAAGCATTAATTGCTGTga 3'
1487 - 1508 135.00 -9.70
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            || | |||    ||:|||| 
Target 5' tcCATAGCAT----TGTTGCTt 3'
1899 - 1916 134.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
760823 7 ClinVar
729099 82 ClinVar
COSM3630576 1 COSMIC
COSM3876180 3 COSMIC
COSM9237754 6 COSMIC
COSM7560489 23 COSMIC
COSM3178773 25 COSMIC
COSM8339817 28 COSMIC
COSM9074561 45 COSMIC
COSM6895837 53 COSMIC
COSM8860785 53 COSMIC
COSM7696845 72 COSMIC
COSM1214451 81 COSMIC
COSM7516863 93 COSMIC
COSM743824 104 COSMIC
COSM8177736 113 COSMIC
COSM3178765 118 COSMIC
COSM3178763 121 COSMIC
COSM3630574 127 COSMIC
COSM7508478 131 COSMIC
COSM9316204 131 COSMIC
COSM6587525 147 COSMIC
COSN17132167 160 COSMIC
COSN26983670 161 COSMIC
COSN30145504 183 COSMIC
COSN2533750 190 COSMIC
COSN30554488 190 COSMIC
COSN28859831 198 COSMIC
COSN26983669 199 COSMIC
COSN31502195 201 COSMIC
COSN30529037 209 COSMIC
COSN31601804 224 COSMIC
COSN23016830 239 COSMIC
COSN24301915 249 COSMIC
COSN7797000 261 COSMIC
COSN30190342 271 COSMIC
COSN30125012 280 COSMIC
COSN31536716 357 COSMIC
COSN6514777 425 COSMIC
COSN20103119 640 COSMIC
COSN16128801 692 COSMIC
COSN29662077 834 COSMIC
COSN20492255 995 COSMIC
COSN24706840 1015 COSMIC
COSN29077150 1016 COSMIC
COSN14949972 1148 COSMIC
COSN29078998 1353 COSMIC
COSN14975829 1451 COSMIC
COSN19228637 1797 COSMIC
COSN19107522 1824 COSMIC
COSN9812634 1845 COSMIC
COSN23852335 1975 COSMIC
COSN29863868 2447 COSMIC
COSN7912699 2549 COSMIC
COSN2182843 2718 COSMIC
COSN14990790 2748 COSMIC
COSN21886742 2963 COSMIC
COSN27166184 2986 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs151262083 7 dbSNP
rs757655772 10 dbSNP
rs1193870624 13 dbSNP
rs754275108 16 dbSNP
rs778400307 17 dbSNP
rs755574294 18 dbSNP
rs985484108 19 dbSNP
rs1358908852 20 dbSNP
rs767221108 24 dbSNP
rs1444081587 25 dbSNP
rs1457817469 29 dbSNP
rs184756473 31 dbSNP
rs1365432543 33 dbSNP
rs145838783 34 dbSNP
rs766248028 39 dbSNP
rs781293668 46 dbSNP
rs762857691 50 dbSNP
rs1433991408 52 dbSNP
rs1304532901 55 dbSNP
rs1236776312 60 dbSNP
rs193156060 63 dbSNP
rs955602310 67 dbSNP
rs34631230 82 dbSNP
rs149129500 83 dbSNP
rs760608455 89 dbSNP
rs1309758104 93 dbSNP
rs1432698401 97 dbSNP
rs775565610 99 dbSNP
rs1173965744 100 dbSNP
rs772239861 103 dbSNP
rs746056485 107 dbSNP
rs1176163018 115 dbSNP
rs1470177652 119 dbSNP
rs779153846 121 dbSNP
rs1209351901 130 dbSNP
rs771627063 131 dbSNP
rs779104023 132 dbSNP
rs1213408965 135 dbSNP
rs1217645013 135 dbSNP
rs1380385865 142 dbSNP
rs1314291848 145 dbSNP
rs749727937 150 dbSNP
rs1306525346 151 dbSNP
rs1447343177 152 dbSNP
rs3734657 160 dbSNP
rs372769737 161 dbSNP
rs1291441739 163 dbSNP
rs1412869260 164 dbSNP
rs1425054370 165 dbSNP
rs752100972 165 dbSNP
rs1313293929 171 dbSNP
rs780882057 175 dbSNP
rs1343119935 177 dbSNP
rs370852052 186 dbSNP
rs376157927 187 dbSNP
rs766195114 188 dbSNP
rs1395978456 189 dbSNP
rs994624266 189 dbSNP
rs762655225 191 dbSNP
rs1475181190 192 dbSNP
rs1258783974 195 dbSNP
rs200763682 199 dbSNP
rs747159934 199 dbSNP
rs757307788 199 dbSNP
rs1188627099 206 dbSNP
rs1288689608 215 dbSNP
rs1328232168 221 dbSNP
rs1208304032 222 dbSNP
rs935483871 223 dbSNP
rs755173911 224 dbSNP
rs1235462051 226 dbSNP
rs1222359284 229 dbSNP
rs1209165302 237 dbSNP
rs1040180285 239 dbSNP
rs549527426 240 dbSNP
rs1184986542 247 dbSNP
rs1413069720 248 dbSNP
rs529391523 249 dbSNP
rs1050793837 257 dbSNP
rs780052176 261 dbSNP
rs911479700 264 dbSNP
rs1322294575 269 dbSNP
rs1234385702 271 dbSNP
rs560303185 279 dbSNP
rs1444216903 281 dbSNP
rs185739991 288 dbSNP
rs1260598314 290 dbSNP
rs955372987 291 dbSNP
rs1226322627 294 dbSNP
rs987833722 295 dbSNP
rs1294946175 303 dbSNP
rs1447848307 309 dbSNP
rs533082702 311 dbSNP
rs927740163 312 dbSNP
rs1289165100 313 dbSNP
rs982269431 315 dbSNP
rs1207865772 317 dbSNP
rs1253191149 322 dbSNP
rs9451441 325 dbSNP
rs2131906 326 dbSNP
rs952017267 341 dbSNP
rs1162290501 342 dbSNP
rs984757143 342 dbSNP
rs952998268 343 dbSNP
rs1026026650 344 dbSNP
rs386703687 344 dbSNP
rs1411617161 349 dbSNP
rs994219683 354 dbSNP
rs1407993013 369 dbSNP
rs375351215 378 dbSNP
rs901257799 380 dbSNP
rs575140963 381 dbSNP
rs1238988825 387 dbSNP
rs1448943095 388 dbSNP
rs139814039 393 dbSNP
rs1283852479 397 dbSNP
rs1354275578 400 dbSNP
rs1008664526 405 dbSNP
rs1230666633 416 dbSNP
rs1269061712 417 dbSNP
rs1200714687 432 dbSNP
rs1342063780 432 dbSNP
rs772415008 438 dbSNP
rs1456628052 441 dbSNP
rs1257442175 442 dbSNP
rs1214404782 453 dbSNP
rs1324025819 457 dbSNP
rs1258626417 462 dbSNP
rs944632460 468 dbSNP
rs1186341679 480 dbSNP
rs1288421748 481 dbSNP
rs896177735 485 dbSNP
rs112828311 487 dbSNP
rs35335029 492 dbSNP
rs946592692 493 dbSNP
rs1427675594 502 dbSNP
rs552714961 507 dbSNP
rs1402591646 514 dbSNP
rs902277287 516 dbSNP
rs1044241845 519 dbSNP
rs746233141 521 dbSNP
rs1375696894 543 dbSNP
rs1298353915 546 dbSNP
rs1364558310 560 dbSNP
rs1325985452 564 dbSNP
rs1258313535 567 dbSNP
rs893728074 573 dbSNP
rs1050040199 574 dbSNP
rs1277033219 574 dbSNP
rs933963480 576 dbSNP
rs922638725 578 dbSNP
rs1447165897 582 dbSNP
rs144187044 584 dbSNP
rs1348025451 586 dbSNP
rs1378108945 588 dbSNP
rs751256856 596 dbSNP
rs571856439 602 dbSNP
rs529596634 608 dbSNP
rs1164046934 614 dbSNP
rs558476264 616 dbSNP
rs1170586151 627 dbSNP
rs2172710 631 dbSNP
rs752728083 634 dbSNP
rs867193527 638 dbSNP
rs947804717 642 dbSNP
rs771093943 643 dbSNP
rs868273803 647 dbSNP
rs548133972 650 dbSNP
rs953073096 652 dbSNP
rs1012157752 653 dbSNP
rs960354424 656 dbSNP
rs1343803559 662 dbSNP
rs1191832599 663 dbSNP
rs754242430 670 dbSNP
rs754882671 671 dbSNP
rs972695022 672 dbSNP
rs1211073383 674 dbSNP
rs999147665 695 dbSNP
rs1450908569 700 dbSNP
rs139518611 709 dbSNP
rs1413854903 710 dbSNP
rs1288513914 712 dbSNP
rs1238509982 718 dbSNP
rs1352506406 723 dbSNP
rs529426696 726 dbSNP
rs766915121 727 dbSNP
rs1006899093 735 dbSNP
rs1295348472 736 dbSNP
rs889986077 744 dbSNP
rs1050431012 749 dbSNP
rs566908420 758 dbSNP
rs1352662954 759 dbSNP
rs1229367350 767 dbSNP
rs1288161556 771 dbSNP
rs922858147 774 dbSNP
rs1029205870 781 dbSNP
rs940022825 782 dbSNP
rs1207939422 783 dbSNP
rs1253861804 786 dbSNP
rs1483365607 790 dbSNP
rs909929482 804 dbSNP
rs1249422906 805 dbSNP
rs984244939 810 dbSNP
rs754775854 811 dbSNP
rs1010781283 821 dbSNP
rs893709450 826 dbSNP
rs1457487849 829 dbSNP
rs1156608524 834 dbSNP
rs1372912187 835 dbSNP
rs1052392847 836 dbSNP
rs990618971 842 dbSNP
rs960569830 844 dbSNP
rs1034916588 845 dbSNP
rs999172917 850 dbSNP
rs9396 857 dbSNP
rs1313019912 862 dbSNP
rs1320800743 867 dbSNP
rs966433176 877 dbSNP
rs563802622 902 dbSNP
rs1010697846 903 dbSNP
rs889945659 905 dbSNP
rs1028461958 906 dbSNP
rs1484130213 920 dbSNP
rs533401651 931 dbSNP
rs1183765653 942 dbSNP
rs1257095632 944 dbSNP
rs1046110585 946 dbSNP
rs1181820415 948 dbSNP
rs947744421 948 dbSNP
rs1392161574 954 dbSNP
rs1430888189 956 dbSNP
rs901402285 966 dbSNP
rs1353073575 972 dbSNP
rs1467884765 980 dbSNP
rs1037300623 981 dbSNP
rs916371162 982 dbSNP
rs939984963 995 dbSNP
rs1190701786 1000 dbSNP
rs1365300104 1006 dbSNP
rs16883060 1007 dbSNP
rs1313930808 1009 dbSNP
rs1048948493 1011 dbSNP
rs1266043758 1015 dbSNP
rs931528069 1026 dbSNP
rs1249937530 1028 dbSNP
rs1450195544 1028 dbSNP
rs770608924 1028 dbSNP
rs545163599 1043 dbSNP
rs772605732 1057 dbSNP
rs762120771 1065 dbSNP
rs1488190685 1067 dbSNP
rs918813907 1069 dbSNP
rs1256982838 1074 dbSNP
rs1234901635 1079 dbSNP
rs1310088038 1080 dbSNP
rs1299912100 1083 dbSNP
rs34266448 1086 dbSNP
rs367624930 1087 dbSNP
rs972933450 1094 dbSNP
rs1296320322 1099 dbSNP
rs1369631766 1100 dbSNP
rs990587786 1103 dbSNP
rs1300262032 1108 dbSNP
rs1321151509 1110 dbSNP
rs544131454 1113 dbSNP
rs1465549727 1117 dbSNP
rs1215156140 1120 dbSNP
rs912528376 1124 dbSNP
rs985430705 1130 dbSNP
rs157704 1148 dbSNP
rs768795154 1152 dbSNP
rs1161884644 1153 dbSNP
rs1021997373 1154 dbSNP
rs989561354 1162 dbSNP
rs1011146001 1168 dbSNP
rs1376202075 1171 dbSNP
rs561563376 1173 dbSNP
rs1175428984 1174 dbSNP
rs1030857727 1177 dbSNP
rs541596843 1184 dbSNP
rs1028095489 1186 dbSNP
rs999415056 1215 dbSNP
rs534199847 1216 dbSNP
rs1477792449 1219 dbSNP
rs1194474190 1227 dbSNP
rs1257230491 1232 dbSNP
rs157705 1233 dbSNP
rs1015849882 1235 dbSNP
rs1482068967 1247 dbSNP
rs34087194 1249 dbSNP
rs1490014350 1250 dbSNP
rs1198703621 1253 dbSNP
rs1184777757 1255 dbSNP
rs1253056517 1268 dbSNP
rs888703330 1268 dbSNP
rs1048351241 1270 dbSNP
rs1275794852 1272 dbSNP
rs1163512688 1278 dbSNP
rs948746310 1278 dbSNP
rs749890618 1283 dbSNP
rs1431617215 1286 dbSNP
rs545571569 1287 dbSNP
rs1308346659 1314 dbSNP
rs576799567 1323 dbSNP
rs894874454 1324 dbSNP
rs1349656199 1333 dbSNP
rs556979345 1348 dbSNP
rs1278027590 1357 dbSNP
rs1314532682 1361 dbSNP
rs531929717 1361 dbSNP
rs1228929304 1365 dbSNP
rs1357904033 1365 dbSNP
rs1207930859 1374 dbSNP
rs1275710773 1378 dbSNP
rs538553073 1380 dbSNP
rs1180171887 1385 dbSNP
rs1238815623 1388 dbSNP
rs575979208 1392 dbSNP
rs555998054 1402 dbSNP
rs1182434690 1404 dbSNP
rs1382868731 1407 dbSNP
rs1431478788 1409 dbSNP
rs1302525131 1412 dbSNP
rs1169178452 1413 dbSNP
rs1395444577 1429 dbSNP
rs931071543 1432 dbSNP
rs1407979810 1433 dbSNP
rs868026442 1438 dbSNP
rs1449104078 1439 dbSNP
rs1314396352 1441 dbSNP
rs1466364323 1442 dbSNP
rs1380676837 1444 dbSNP
rs1231202592 1446 dbSNP
rs1299018508 1450 dbSNP
rs157706 1451 dbSNP
rs1037166941 1458 dbSNP
rs146017797 1465 dbSNP
rs1477741800 1469 dbSNP
rs1442584162 1471 dbSNP
rs547121546 1477 dbSNP
rs539531555 1495 dbSNP
rs750208093 1505 dbSNP
rs1240683898 1507 dbSNP
rs1190034255 1510 dbSNP
rs566595043 1515 dbSNP
rs985420911 1522 dbSNP
rs1188697584 1526 dbSNP
rs1372395736 1530 dbSNP
rs1474423415 1533 dbSNP
rs1425624842 1537 dbSNP
rs192428719 1542 dbSNP
rs915146141 1546 dbSNP
rs1403935711 1558 dbSNP
rs1437331856 1562 dbSNP
rs1321383111 1566 dbSNP
rs914625808 1569 dbSNP
rs1225901696 1579 dbSNP
rs953857776 1590 dbSNP
rs990228110 1591 dbSNP
rs956333237 1609 dbSNP
rs1222471287 1612 dbSNP
rs976536929 1616 dbSNP
rs965526941 1619 dbSNP
rs1208805027 1622 dbSNP
rs1356942180 1622 dbSNP
rs1030807161 1623 dbSNP
rs1260502111 1633 dbSNP
rs764903059 1634 dbSNP
rs1445152428 1638 dbSNP
rs977958150 1639 dbSNP
rs1015736633 1653 dbSNP
rs1377943986 1655 dbSNP
rs1479998906 1659 dbSNP
rs1174055540 1665 dbSNP
rs970624808 1683 dbSNP
rs1242294945 1684 dbSNP
rs1339606713 1685 dbSNP
rs1159165333 1686 dbSNP
rs1384357779 1688 dbSNP
rs952966927 1694 dbSNP
rs187807611 1697 dbSNP
rs1346751087 1700 dbSNP
rs979855013 1707 dbSNP
rs1281847105 1711 dbSNP
rs1330755077 1721 dbSNP
rs1259562073 1725 dbSNP
rs894503318 1735 dbSNP
rs1211510760 1739 dbSNP
rs894783858 1746 dbSNP
rs1490186094 1748 dbSNP
rs9451440 1757 dbSNP
rs1197004487 1758 dbSNP
rs1253728242 1759 dbSNP
rs1473659755 1760 dbSNP
rs1182840377 1762 dbSNP
rs201684886 1787 dbSNP
rs200411389 1788 dbSNP
rs397888753 1789 dbSNP
rs5878142 1789 dbSNP
rs1392055145 1791 dbSNP
rs1002948693 1795 dbSNP
rs1165552821 1810 dbSNP
rs1027077620 1820 dbSNP
rs1366726348 1824 dbSNP
rs995231820 1825 dbSNP
rs1352718986 1835 dbSNP
rs1391564810 1837 dbSNP
rs1305876313 1838 dbSNP
rs1333668339 1840 dbSNP
rs1246311595 1843 dbSNP
rs141807443 1857 dbSNP
rs1358574354 1859 dbSNP
rs375936953 1865 dbSNP
rs1042186234 1866 dbSNP
rs1037160579 1867 dbSNP
rs945221871 1873 dbSNP
rs915134232 1874 dbSNP
rs780937012 1880 dbSNP
rs1176456522 1883 dbSNP
rs1250046338 1889 dbSNP
rs1054142709 1894 dbSNP
rs757113935 1895 dbSNP
rs891367003 1896 dbSNP
rs1189688784 1897 dbSNP
rs932318636 1902 dbSNP
rs1444489902 1907 dbSNP
rs751201885 1908 dbSNP
rs1162257594 1911 dbSNP
rs1049989912 1919 dbSNP
rs1441091652 1927 dbSNP
rs1462792410 1929 dbSNP
rs932917580 1935 dbSNP
rs976422780 1951 dbSNP
rs35554154 1963 dbSNP
rs368166739 1967 dbSNP
rs9362746 1968 dbSNP
rs990566084 1969 dbSNP
rs1177439099 1971 dbSNP
rs982940012 1972 dbSNP
rs934724595 1974 dbSNP
rs1268877769 1981 dbSNP
rs547991373 1982 dbSNP
rs16883049 1983 dbSNP
rs1249459933 1989 dbSNP
rs1355571371 1995 dbSNP
rs9345020 1996 dbSNP
rs766747006 1999 dbSNP
rs767932015 2003 dbSNP
rs1460942184 2005 dbSNP
rs545918385 2009 dbSNP
rs1181873367 2010 dbSNP
rs1392534090 2015 dbSNP
rs1429696037 2016 dbSNP
rs1170120637 2024 dbSNP
rs990723893 2037 dbSNP
rs958693084 2039 dbSNP
rs1337008229 2054 dbSNP
rs1404969420 2056 dbSNP
rs1449798547 2057 dbSNP
rs1035623196 2062 dbSNP
rs1002834102 2063 dbSNP
rs576829412 2064 dbSNP
rs1293087634 2066 dbSNP
rs959558829 2068 dbSNP
rs1225525415 2069 dbSNP
rs1026610633 2077 dbSNP
rs1263964890 2080 dbSNP
rs182416687 2084 dbSNP
rs1331715181 2087 dbSNP
rs543393837 2088 dbSNP
rs77028954 2094 dbSNP
rs869178480 2094 dbSNP
rs397710860 2095 dbSNP
rs199552422 2097 dbSNP
rs34973388 2097 dbSNP
rs556133183 2099 dbSNP
rs1325637701 2103 dbSNP
rs374071542 2103 dbSNP
rs1015326647 2115 dbSNP
rs1009391094 2120 dbSNP
rs1008332671 2121 dbSNP
rs535767976 2122 dbSNP
rs1428164022 2135 dbSNP
rs891270495 2143 dbSNP
rs1050362862 2145 dbSNP
rs573415861 2146 dbSNP
rs1160661209 2164 dbSNP
rs1345271961 2167 dbSNP
rs1421953376 2168 dbSNP
rs1378060659 2173 dbSNP
rs1287065816 2181 dbSNP
rs932886969 2182 dbSNP
rs1282472180 2185 dbSNP
rs148453945 2192 dbSNP
rs932520966 2200 dbSNP
rs1286384168 2202 dbSNP
rs1378802432 2215 dbSNP
rs1317617670 2216 dbSNP
rs539939942 2219 dbSNP
rs1054452673 2227 dbSNP
rs921183938 2229 dbSNP
rs1450958599 2232 dbSNP
rs1491003933 2232 dbSNP
rs1263890778 2238 dbSNP
rs570831363 2248 dbSNP
rs750957589 2254 dbSNP
rs1479212711 2275 dbSNP
rs943695965 2277 dbSNP
rs1285082538 2279 dbSNP
rs191386246 2284 dbSNP
rs934675881 2286 dbSNP
rs1223385433 2291 dbSNP
rs1351542502 2304 dbSNP
rs982960478 2308 dbSNP
rs931495363 2309 dbSNP
rs529904735 2310 dbSNP
rs537008375 2311 dbSNP
rs924670039 2312 dbSNP
rs1374388454 2319 dbSNP
rs767979754 2321 dbSNP
rs1276625714 2334 dbSNP
rs34651140 2339 dbSNP
rs1305035227 2344 dbSNP
rs1362148672 2360 dbSNP
rs1223882893 2365 dbSNP
rs762280213 2380 dbSNP
rs548126023 2388 dbSNP
rs950126900 2399 dbSNP
rs1231246878 2408 dbSNP
rs1207119693 2411 dbSNP
rs1345425326 2412 dbSNP
rs1469368929 2415 dbSNP
rs561237221 2418 dbSNP
rs1174958315 2427 dbSNP
rs958911430 2448 dbSNP
rs1299380591 2452 dbSNP
rs1402428394 2454 dbSNP
rs1035924557 2456 dbSNP
rs1363691626 2457 dbSNP
rs981378902 2460 dbSNP
rs1329376138 2461 dbSNP
rs1355327138 2474 dbSNP
rs967381791 2483 dbSNP
rs917722399 2484 dbSNP
rs1012116151 2485 dbSNP
rs1318087743 2490 dbSNP
rs774645021 2491 dbSNP
rs1314933415 2492 dbSNP
rs991063298 2503 dbSNP
rs959315286 2504 dbSNP
rs866682373 2506 dbSNP
rs919872903 2513 dbSNP
rs187188963 2525 dbSNP
rs144562017 2528 dbSNP
rs996700712 2531 dbSNP
rs1477437535 2538 dbSNP
rs1424213181 2539 dbSNP
rs552056912 2552 dbSNP
rs1168228170 2555 dbSNP
rs1476814335 2559 dbSNP
rs973752580 2560 dbSNP
rs1210567928 2572 dbSNP
rs866234395 2578 dbSNP
rs868714858 2579 dbSNP
rs3073574 2590 dbSNP
rs36213953 2590 dbSNP
rs1281068983 2591 dbSNP
rs961053087 2602 dbSNP
rs943664963 2603 dbSNP
rs1015231811 2604 dbSNP
rs1381209368 2611 dbSNP
rs149302293 2621 dbSNP
rs1278938464 2624 dbSNP
rs115453865 2625 dbSNP
rs1028453239 2627 dbSNP
rs919690443 2631 dbSNP
rs991597047 2643 dbSNP
rs1323899876 2646 dbSNP
rs543532119 2647 dbSNP
rs893373456 2648 dbSNP
rs1055137157 2662 dbSNP
rs1449288870 2667 dbSNP
rs1341869328 2669 dbSNP
rs1331837233 2672 dbSNP
rs1468997736 2674 dbSNP
rs999124090 2676 dbSNP
rs928878940 2679 dbSNP
rs1474289935 2684 dbSNP
rs903152821 2686 dbSNP
rs1178367401 2687 dbSNP
rs1431707929 2689 dbSNP
rs1470458227 2699 dbSNP
rs981683608 2704 dbSNP
rs1172210849 2705 dbSNP
rs967350710 2709 dbSNP
rs530508916 2710 dbSNP
rs1418802097 2715 dbSNP
rs1429057840 2716 dbSNP
rs1285654507 2719 dbSNP
rs529758461 2721 dbSNP
rs1473686257 2722 dbSNP
rs564907766 2734 dbSNP
rs1222533086 2741 dbSNP
rs990167744 2747 dbSNP
rs10894 2748 dbSNP
rs1029089459 2750 dbSNP
rs916019605 2751 dbSNP
rs1054958157 2760 dbSNP
rs1461046041 2768 dbSNP
rs1201299746 2794 dbSNP
rs937871514 2796 dbSNP
rs899690154 2799 dbSNP
rs572917425 2803 dbSNP
rs762888709 2805 dbSNP
rs1380455537 2806 dbSNP
rs542547331 2807 dbSNP
rs573426605 2813 dbSNP
rs1455385722 2815 dbSNP
rs887040287 2821 dbSNP
rs1047130926 2822 dbSNP
rs1418427656 2828 dbSNP
rs1305273799 2849 dbSNP
rs931013322 2858 dbSNP
rs1403903169 2877 dbSNP
rs1298708074 2882 dbSNP
rs560446615 2883 dbSNP
rs1316579956 2889 dbSNP
rs898210611 2894 dbSNP
rs372761246 2896 dbSNP
rs1239126871 2898 dbSNP
rs553554187 2904 dbSNP
rs1055500906 2905 dbSNP
rs1381747772 2910 dbSNP
rs1282817548 2916 dbSNP
rs115962977 2918 dbSNP
rs182814265 2920 dbSNP
rs2180736 2926 dbSNP
rs1220028707 2929 dbSNP
rs1444016916 2929 dbSNP
rs1353840471 2930 dbSNP
rs1265533284 2936 dbSNP
rs537145209 2939 dbSNP
rs986434770 2941 dbSNP
rs771400571 2951 dbSNP
rs955124214 2953 dbSNP
rs796260673 2954 dbSNP
rs1045954347 2972 dbSNP
rs1363310438 2973 dbSNP
rs1438343437 2987 dbSNP
rs946249948 2993 dbSNP
rs913501383 2996 dbSNP
rs1424386311 3017 dbSNP
rs1407033321 3018 dbSNP
rs1398165094 3020 dbSNP
rs1391624904 3027 dbSNP
rs1327522043 3028 dbSNP
rs1374053845 3039 dbSNP
rs191940557 3039 dbSNP
rs1028518761 3041 dbSNP
rs1248016995 3049 dbSNP
rs138708424 3054 dbSNP
rs997005046 3058 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            |||||:|      |||||| 
Target 5' auCAAACUA------GCUGCUa 3'
2 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000369325.3 | 3UTR | UAUCAAACUAGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.723 1.6e-4 0.817 5.5e-6 20 Click to see details
GSE21032 Prostate cancer 0.355 5.0e-4 0.229 1.9e-2 83 Click to see details
GSE17498 Multiple myeloma 0.411 4.2e-3 0.264 5.0e-2 40 Click to see details
GSE32688 Pancreatic cancer 0.411 9.7e-3 0.331 3.2e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.21 2.3e-2 -0.148 8.2e-2 90 Click to see details
GSE28260 Renal cortex and medulla -0.486 4.6e-2 -0.385 9.7e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.356 4.8e-2 -0.221 1.6e-1 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.319 6.0e-2 0.509 4.7e-3 25 Click to see details
GSE38226 Liver fibrosis 0.345 6.3e-2 0.398 3.7e-2 21 Click to see details
GSE19350 CNS germ cell tumors 0.344 1.4e-1 0.245 2.2e-1 12 Click to see details
GSE19783 ER- ER- breast cancer -0.109 1.7e-1 -0.095 2.0e-1 79 Click to see details
GSE17306 Multiple myeloma 0.139 1.7e-1 -0.008 4.8e-1 49 Click to see details
GSE27834 Pluripotent stem cells -0.218 2.1e-1 -0.185 2.5e-1 16 Click to see details
GSE28544 Breast cancer 0.173 2.1e-1 0.426 1.9e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.082 2.6e-1 0.153 1.1e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.119 2.9e-1 -0.136 2.6e-1 24 Click to see details
GSE21849 B cell lymphoma 0.101 3.0e-1 0.200 1.5e-1 29 Click to see details
GSE19536 Breast cancer -0.03 3.8e-1 -0.028 3.9e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.046 4.1e-1 0.135 2.6e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.002 5.0e-1 0.027 4.6e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.002 5.0e-1 0.027 4.6e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.209 0.07 -0.186 0.1 50 Click to see details
THCA -0.178 0.09 -0.272 0.02 59 Click to see details
PAAD 0.773 0.11 0.400 0.3 4 Click to see details
STAD -0.212 0.12 -0.186 0.15 32 Click to see details
CHOL -0.418 0.13 -0.233 0.27 9 Click to see details
BRCA -0.106 0.17 -0.115 0.15 84 Click to see details
LUAD 0.297 0.17 0.196 0.27 12 Click to see details
KIRP -0.171 0.17 -0.240 0.09 32 Click to see details
LIHC 0.115 0.22 0.064 0.33 49 Click to see details
KIRC 0.076 0.27 0.067 0.29 68 Click to see details
PCPG 0.659 0.27 0.500 0.33 3 Click to see details
KICH -0.12 0.28 -0.139 0.25 25 Click to see details
COAD 0.238 0.29 0.048 0.46 8 Click to see details
BLCA -0.106 0.34 0.007 0.49 18 Click to see details
UCEC 0.088 0.36 -0.061 0.4 19 Click to see details
ESCA 0.116 0.37 0.118 0.36 11 Click to see details
CESC 0.388 0.37 0.500 0.33 3 Click to see details
LUSC 0.053 0.38 0.176 0.15 38 Click to see details
HNSC -0.001 0.5 0.045 0.39 42 Click to see details
HNSC -0.001 0.5 0.045 0.39 42 Click to see details
HNSC -0.001 0.5 0.045 0.39 42 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*