miRTarBase - #MIRT567450 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GNG12   
Synonyms -
Description G protein subunit gamma 12
Transcript NM_018841   
Expression
Putative miRNA Targets on GNG12
3'UTR of GNG12
(miRNA target sites are highlighted)
>GNG12|NM_018841|3'UTR
   1 TGGAATAGAGAAACAGCTCCTCGCCTCTTCCCAACAACGCAAATTATGAGCAGCTCCTTGAAGAGATTTACCTTCAGCTT
  81 ATTTGGTAACCACTGCTAATAACTAAAATGTTCTCAGCTTGGAATAATGGACTCTGAAGTCTCTATTTTCCAAGTTGTCC
 161 TTTCTCTTAAAATACCCTTTACTGATTTAATACAGAATAACAATCTTATTTTCCACTTGGTAACTATGGCTTTATGTTGG
 241 GTTACTGTTTAAGGAAAGTTGATCTGGGCCTTTTTAAAAACATAATTATATACTTTAGAAATACAAGGGATTCCGATATG
 321 TCAGGACCTAAATGGCCTAAGCACCTGTCAAATTAAAATTCCAAAATTCATTGAAATCCTAAAGCCTTGATATTATATTC
 401 TTTATAAGGCGTGTGCCAGCCTGTATAGTATATAAGAGAGAGGGGTGTTTGTGTGTATATATATATGCCTTTGTGTATAC
 481 ACTTATCAAAGCTATTTTCTTATGAAAACGTCCCTCTCTCCATACCATCAGTTTCTCAGTTCCAGAAGTTATACCTTTAT
 561 TTTGAGCTGTGTATAGGTAGAATAAAAAATTCCTTTCATATCGTTATTGTACAAAAAGTAAAGAGTATCCTAAAGATTGT
 641 ATTCATTGTAATCAAGTAATGCAATCATCTCTCCTCTCTTGAAATCTTGCTGGACCTCTTAGGCTACAATAAACTGTACC
 721 AAACTAAACTGACAGTCCTTCGATAATATGAAACATTAATTTACAAGGACCCGTTAGGGCTTCAATGATGCTGAGTCTGG
 801 AAAAGGGGAGGAGACCCTTGGGAGGACTCCAGGCAGCTGTGCTCCCAGGGCTCATGTTCTCTACTGGATTAGGGATAGGC
 881 ACCTCTGAAATCTCCACCCTGATGATTGGAATGAAACGGAGTGAACATGAGCCCAGCTGAGAGAGGAGCAGGAATGTGTG
 961 AAAAACAGCTGCTCTCCTTGTCCCAGCTTTGTGATTGAGCCCTCTGTCTTGCTCTCTCTGCCTTCCCTGTGTCTTTCTTC
1041 TCTTACCAGAGCATCTGTTTGCAGAGGTAACATTACCTTCCCCAGCCACAGGTATGTGGAATACGGTGAGGAAAAAAAAA
1121 ATTAAAAAAAAAATGCAAGCTGTCAGGATGCTTAAGCTCTTTTCAGACATCTGCAGTTTCATCCCTACCTTGTTCACATA
1201 CCATCCAAGAGGCACATAGGCTACCCAAGAGAGCCTTGGATTCAGTGGTACACTCCTTGGGCCCAAGGGCTTTAGCAGCT
1281 GGATATGGGGTTCCTTGATTTTCCTCTGGGCCCAAATATAGCCCTCACACTCTTGGAATTTCCAGGTATGGGGGTAGCCC
1361 CAAAAGGAGGAATCTCCTATGGCCAATAAGGTATCTTGACTTTATCAAAGTAGAAGAGAGGGTCACTTCGGAGTCAAATC
1441 ATACACTAGGCCTTTGATGCTTTAATTCTTCTTCAGTTCATTAAAAGTAACTACTAAGGAAAGGTTAAAAACTTCCCCTC
1521 AAAAAGGAATCAACCCCAGGAAGTAATTATTTACAACGATTTTCCCAAATTTTGTACAATCTGTCCTGGAAAGCAAACCC
1601 CTTTTAAAATCTAATGTCTGGGCTTTGAGTATTAGCTCATTTAGGGTGGACAAATGCATTACTGTTTTCAAACTGCTCAC
1681 ATTTATTCAGTATTTCTCCAAGTTGCTATCTACTCAGCCTTATGAATGCCCCTCGCTTTTCTAAGGCCATGTGAAAATCA
1761 CGGCACTGCCCTTAGCCTTGTGTCATCTGCTTTTTCGTTCTGCGATATGCCCAGTTCCCAAATCAATTATAGGTACCTGT
1841 TTAGGAGAGAGGAAGATTTTACCTCTCAAAGGGTGAGATTTGAAATTTACACTAAAAAGACAACTTTACATTTAATGCTT
1921 CACTTAATGAGACATTCTTTTTTTTATAAGTCTATTTTTCTACTCAGTTTCAGAACACTAATCTGATTTTCACTCTGATT
2001 TTTAACGTTTCTTTAAATATTTATAATGTAGCTTCTTTCAAAATATTTTCATGAAAAATTACTTTTATTATACCATTATG
2081 TGCATGTTATTGGTAGCAGGCATAGTTTATTATTTAGTACTGAAACATGCTCTTTTACCTAACAGTAAACAAGTATGTTT
2161 TGATATATATCTGTTAATATGCTTATAGTGGTAAGAAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTCACCCTGGT
2241 CAGATACAATAAAGGCTATGAGTATAAATACATAACTTCCTAACCAGGTGTAGGGCATGTTCATGAATATCAAATCTTTT
2321 GATGCTGGACCCAAGAGAGGAAAAGTTGTAGCTAAATGTTGATTTACTTATAACTAGACGTCTATGTGAGAAAATATATG
2401 TATACATATATATGATATGCAGAAGTCACTTTTTTTATCAGGCTTTATTCTCCTTACAAAGCCACAGTTTAACTGTCTGC
2481 AACAGTTGGTTTATGTTAATGATAGACAAATACCCAGTGTTTGTTACTTTTTCCAACTACCACTGTAATGATAATCTTTC
2561 TCACGTATATACATGCAACTTCTTGGCTTCATTTCCATGAAGCTGTTTCAATATATTCAGTATACTTTGTCCTTAATGCT
2641 GCTTCTGTTAACAGTGATCTCTTTCTTTTTTTCATTCTTATATCTTCATTAGTTCATCATAAATCTGTCCAGTTGAGGCC
2721 TCAGGACCACGGCATGATTTCATGACTCCGAAGTATTTTACAGAAACATTTTTTAAATAAGGGAAATATTTTATATACCA
2801 GATGGTTCACAAGTGATGGCTCATAGCTAGTTTTTTTTTTTCTTCTAAAAAATGTCAGGTTTTTAAAATCATTTACCTTA
2881 TTAAAATGAAAAGTGCCATACTTAACTTTTAAAGGAAAGACCTGACTTGCTTTTTCTCTATTTAGACTGTTTTTGTACTT
2961 TACTAATCTTTAAACTATCAGGAAAAAAACCAAAACTTTATACCAATGATTTAGTAATTTTGAGGCATAGGGTAGCTTAC
3041 GTAGTGGAGGATGTGCCAAATATTCTCTTCAAATGCCACCTTCTCAATTTATAACTAAAATAGTGTTATCTGACTAATTC
3121 CTCTGAATTTTGATGTAAGATCTATATAGGCCCCCAAAATGATCGTAGTACATGCCAGTCATTTCTCAGTGAAATAAATA
3201 CAATACCAGAGTACATTATGGGTTTTATTGCTTTCTTTTATGGTAGACCTGTTAATGGGGAAAAAATACATCAAATCAAA
3281 TAGAATCTTATATCTGTATGTTAAAATAGAGCACTTACCTGAAGTCAGTGGCCTGGATCATAGCCCTGGATCATTTCCCA
3361 GTCTGTCCTGTGCTGTGTGACCTTGGACAAGGCGCTTCATCTCTCTGGGCCTCTATTTCTCCATTTGTAAAACAAGTGGC
3441 TGCAGTAGATGATGGCTGAGAGCCCTTCCTGTTCCCAGATGCCTTGGTCCAAAGACCCCACCCCTCTGCTGGTCCTGCCA
3521 ACGTGTTGGTGCTATAAGCTGCTTCAGATATAAAATTGGTTTATCTATAATGTTTGTTCATTTAATAGCTTCTAAAAGGC
3601 CTTTTTGTTATACAGTGCTTTTTTTCTAGTTTTATGGACTTGGTTACTGTAATAATGTCTTGTTTTTAGCCATGTAACTA
3681 CAAACAGATATTCTCTTGATGTCTTAGTAAATTTGCATTTGATATATCATTGATGAGATTTTGTTGTTATGTAATATTCT
3761 TTGGCTACGCATCTGTCCAGCATCTTATTAACCATAATACTGTGATCATTATTTGGAAATATGTCCTATGGAAAGAATAA
3841 AAGCATGTACTTCACAGCTAGCATGTTCACAGATTTGAAAGAAGTTTCATTAAAAGCACCATTGCTTTCTGTACTGCGTC
3921 AGTGCCTCATTGTATCATCCTACTTGTGTTTTGCTCAATAAATGAATAAAAGACCATTTCTCTTCAAAAAAAAAAAAAAA
4001 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ::| |||  ||||||| 
Target 5' actttGTCCTTA-ATGCTGCTt 3'
2624 - 2644 148.00 -10.10
2
miRNA  3' guGUUUGGUAAUACACG-ACGAu 5'
            :| |||||||||||| ||:| 
Target 5' atTATACCATTATGTGCATGTTa 3'
2067 - 2089 140.00 -20.80
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            ||||:| ||   || |||| 
Target 5' atCAAATCTTT---TGATGCTg 3'
2309 - 2327 129.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26977649 39 COSMIC
COSN31492858 66 COSMIC
COSN30472707 85 COSMIC
COSN30101900 164 COSMIC
COSN1107478 175 COSMIC
COSN25992964 310 COSMIC
COSN28089064 564 COSMIC
COSN26552372 733 COSMIC
COSN20672500 875 COSMIC
COSN28806212 879 COSMIC
COSN31570380 932 COSMIC
COSN19604830 999 COSMIC
COSN21094909 1004 COSMIC
COSN29656283 1123 COSMIC
COSN7052422 1125 COSMIC
COSN6042127 1600 COSMIC
COSN216747 1606 COSMIC
COSN21161642 1735 COSMIC
COSN26235136 1879 COSMIC
COSN25736231 1910 COSMIC
COSN7277750 1972 COSMIC
COSN25210549 2121 COSMIC
COSN22276120 2519 COSMIC
COSN26343125 2602 COSMIC
COSN27576585 2830 COSMIC
COSN20094928 2831 COSMIC
COSN17078513 3188 COSMIC
COSN26482225 3518 COSMIC
COSN26640571 3538 COSMIC
COSN31530169 3558 COSMIC
COSN15381831 3570 COSMIC
COSN28769154 3643 COSMIC
COSN26649860 3670 COSMIC
COSN31548812 3759 COSMIC
COSN31567975 3768 COSMIC
COSN1107477 3771 COSMIC
COSN31536777 3925 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778036855 2 dbSNP
rs1443327549 4 dbSNP
rs111445182 9 dbSNP
rs890675821 10 dbSNP
rs368515270 17 dbSNP
rs753197245 22 dbSNP
rs374150257 23 dbSNP
rs1414665659 27 dbSNP
rs573708614 29 dbSNP
rs372297619 31 dbSNP
rs113817847 34 dbSNP
rs1401028609 35 dbSNP
rs753541054 38 dbSNP
rs373833781 39 dbSNP
rs370081170 46 dbSNP
rs1409883338 64 dbSNP
rs1227719441 65 dbSNP
rs1288832983 69 dbSNP
rs1330988364 74 dbSNP
rs571208080 81 dbSNP
rs1221408839 86 dbSNP
rs190580980 103 dbSNP
rs1345974277 106 dbSNP
rs536998272 108 dbSNP
rs568464156 109 dbSNP
rs1248526825 132 dbSNP
rs1046790622 135 dbSNP
rs1409816753 142 dbSNP
rs1254538134 159 dbSNP
rs773725682 165 dbSNP
rs770955679 166 dbSNP
rs1479690785 173 dbSNP
rs548359378 187 dbSNP
rs1189312148 192 dbSNP
rs948498528 203 dbSNP
rs917089160 204 dbSNP
rs1393693837 205 dbSNP
rs1408644569 210 dbSNP
rs1308582184 214 dbSNP
rs1487951628 217 dbSNP
rs765968908 221 dbSNP
rs760251491 226 dbSNP
rs950016282 229 dbSNP
rs917126176 239 dbSNP
rs188229809 245 dbSNP
rs1249800031 250 dbSNP
rs1341577243 255 dbSNP
rs1266940753 259 dbSNP
rs1205932880 269 dbSNP
rs1238885010 280 dbSNP
rs937154018 282 dbSNP
rs139526167 284 dbSNP
rs973157675 288 dbSNP
rs962056812 291 dbSNP
rs1217871379 293 dbSNP
rs749857498 301 dbSNP
rs907551212 304 dbSNP
rs371957677 312 dbSNP
rs202241300 314 dbSNP
rs374533216 316 dbSNP
rs987512176 318 dbSNP
rs183347842 319 dbSNP
rs764699366 322 dbSNP
rs563199258 323 dbSNP
rs1029183883 327 dbSNP
rs531973346 330 dbSNP
rs1454237347 351 dbSNP
rs958194266 361 dbSNP
rs763426083 363 dbSNP
rs1346962047 364 dbSNP
rs978143586 366 dbSNP
rs999619062 368 dbSNP
rs1229321718 372 dbSNP
rs1173668247 378 dbSNP
rs1357295871 379 dbSNP
rs902572323 384 dbSNP
rs1221477854 391 dbSNP
rs1432333965 393 dbSNP
rs968536780 395 dbSNP
rs1022370121 398 dbSNP
rs190980766 400 dbSNP
rs1448489971 404 dbSNP
rs1013992000 410 dbSNP
rs147777562 411 dbSNP
rs1442199593 412 dbSNP
rs1164027066 427 dbSNP
rs889913695 432 dbSNP
rs1459288705 433 dbSNP
rs1286898856 436 dbSNP
rs560953122 440 dbSNP
rs1447295144 442 dbSNP
rs1388249408 443 dbSNP
rs1055711564 445 dbSNP
rs1277352175 449 dbSNP
rs937207821 455 dbSNP
rs920428155 457 dbSNP
rs1227762539 461 dbSNP
rs768435249 467 dbSNP
rs1323995696 468 dbSNP
rs775890447 483 dbSNP
rs1267910509 488 dbSNP
rs770138878 492 dbSNP
rs149674152 494 dbSNP
rs1249449856 497 dbSNP
rs1482019619 503 dbSNP
rs1180744900 507 dbSNP
rs139454756 509 dbSNP
rs117317528 510 dbSNP
rs1425475055 511 dbSNP
rs759828956 513 dbSNP
rs940462790 515 dbSNP
rs888118584 519 dbSNP
rs1457534657 523 dbSNP
rs1044127859 530 dbSNP
rs1404153698 531 dbSNP
rs1263071843 538 dbSNP
rs1227569039 548 dbSNP
rs1447443785 549 dbSNP
rs907602792 550 dbSNP
rs987176566 551 dbSNP
rs1303494258 552 dbSNP
rs954525847 555 dbSNP
rs948467562 561 dbSNP
rs1390174308 566 dbSNP
rs1347565178 567 dbSNP
rs776926327 570 dbSNP
rs922222775 573 dbSNP
rs1269676313 576 dbSNP
rs974976280 577 dbSNP
rs1310075353 584 dbSNP
rs576341023 590 dbSNP
rs771010384 600 dbSNP
rs958246556 602 dbSNP
rs186109832 603 dbSNP
rs1483906027 622 dbSNP
rs1179961527 624 dbSNP
rs1382888155 624 dbSNP
rs1000073412 626 dbSNP
rs934557631 635 dbSNP
rs1300968668 637 dbSNP
rs1161065674 645 dbSNP
rs577518154 655 dbSNP
rs1414108034 658 dbSNP
rs966849523 659 dbSNP
rs1375772214 663 dbSNP
rs180806474 664 dbSNP
rs985487832 669 dbSNP
rs537766119 676 dbSNP
rs1412142948 679 dbSNP
rs1281762422 680 dbSNP
rs1427415550 681 dbSNP
rs1367275632 689 dbSNP
rs1218278967 691 dbSNP
rs1029765631 704 dbSNP
rs1389205764 724 dbSNP
rs998403824 741 dbSNP
rs79383732 742 dbSNP
rs1483338384 748 dbSNP
rs376946992 756 dbSNP
rs577943194 757 dbSNP
rs34458460 769 dbSNP
rs773143970 772 dbSNP
rs1477551240 773 dbSNP
rs1001468381 778 dbSNP
rs1427503444 779 dbSNP
rs777685503 785 dbSNP
rs1168036159 786 dbSNP
rs1485640547 792 dbSNP
rs76353201 799 dbSNP
rs79583445 800 dbSNP
rs76547382 802 dbSNP
rs1037567316 803 dbSNP
rs940499500 806 dbSNP
rs548592891 807 dbSNP
rs886231324 814 dbSNP
rs772188397 820 dbSNP
rs1349693134 825 dbSNP
rs1437568566 832 dbSNP
rs1275119671 833 dbSNP
rs1369246710 834 dbSNP
rs1225630433 835 dbSNP
rs1213551914 837 dbSNP
rs534807303 841 dbSNP
rs933053727 844 dbSNP
rs921607920 849 dbSNP
rs1296209737 853 dbSNP
rs1251018344 854 dbSNP
rs141550359 856 dbSNP
rs552265740 861 dbSNP
rs1309261247 863 dbSNP
rs1310677131 864 dbSNP
rs1287583117 868 dbSNP
rs1012659656 873 dbSNP
rs15471 875 dbSNP
rs925525853 878 dbSNP
rs9549 879 dbSNP
rs1447876884 882 dbSNP
rs1188106962 883 dbSNP
rs1407815449 892 dbSNP
rs934547545 895 dbSNP
rs1451362829 898 dbSNP
rs1161997789 907 dbSNP
rs559727831 910 dbSNP
rs1406355735 916 dbSNP
rs1025106865 917 dbSNP
rs549772351 918 dbSNP
rs546628776 925 dbSNP
rs1319390820 927 dbSNP
rs1365325180 932 dbSNP
rs1229948543 935 dbSNP
rs959420071 940 dbSNP
rs567656708 943 dbSNP
rs1282397589 945 dbSNP
rs915215063 946 dbSNP
rs1033691398 949 dbSNP
rs546362387 961 dbSNP
rs1291784265 962 dbSNP
rs899102809 966 dbSNP
rs1016590945 972 dbSNP
rs780519511 973 dbSNP
rs1004754819 980 dbSNP
rs115148897 989 dbSNP
rs954125371 991 dbSNP
rs1051569174 995 dbSNP
rs1185466621 1002 dbSNP
rs1237476959 1005 dbSNP
rs560699249 1006 dbSNP
rs115299854 1015 dbSNP
rs140134246 1016 dbSNP
rs977246741 1020 dbSNP
rs564927685 1025 dbSNP
rs1388879311 1026 dbSNP
rs1263752372 1038 dbSNP
rs961526054 1040 dbSNP
rs545147124 1045 dbSNP
rs1339315568 1046 dbSNP
rs755688447 1047 dbSNP
rs1016193419 1057 dbSNP
rs749997146 1058 dbSNP
rs1005771561 1062 dbSNP
rs12072422 1065 dbSNP
rs1227527015 1074 dbSNP
rs557568339 1077 dbSNP
rs15472 1078 dbSNP
rs1329314066 1082 dbSNP
rs1255573936 1084 dbSNP
rs1443008786 1087 dbSNP
rs1190260312 1089 dbSNP
rs918097507 1090 dbSNP
rs750712828 1092 dbSNP
rs1388217124 1098 dbSNP
rs959470367 1100 dbSNP
rs1183348861 1104 dbSNP
rs767522900 1105 dbSNP
rs555790005 1108 dbSNP
rs543738243 1110 dbSNP
rs1419418442 1111 dbSNP
rs75634619 1112 dbSNP
rs554432363 1116 dbSNP
rs1015562747 1121 dbSNP
rs1035411769 1122 dbSNP
rs1314706444 1122 dbSNP
rs999013314 1123 dbSNP
rs11209142 1124 dbSNP
rs1288731757 1124 dbSNP
rs1043295384 1125 dbSNP
rs1345867057 1134 dbSNP
rs889070315 1134 dbSNP
rs947286949 1134 dbSNP
rs1049709494 1135 dbSNP
rs886337688 1136 dbSNP
rs932619601 1142 dbSNP
rs1206428028 1148 dbSNP
rs1254426742 1148 dbSNP
rs1431767445 1157 dbSNP
rs1196338722 1167 dbSNP
rs1030593260 1168 dbSNP
rs1376689767 1175 dbSNP
rs922595495 1182 dbSNP
rs1174967172 1187 dbSNP
rs997292114 1189 dbSNP
rs554659330 1192 dbSNP
rs976837551 1205 dbSNP
rs12027405 1206 dbSNP
rs1206681493 1212 dbSNP
rs940112258 1216 dbSNP
rs908694926 1217 dbSNP
rs867562272 1218 dbSNP
rs1349944962 1224 dbSNP
rs114173897 1226 dbSNP
rs757344271 1239 dbSNP
rs984314162 1241 dbSNP
rs867052827 1243 dbSNP
rs1253551135 1247 dbSNP
rs1487735519 1252 dbSNP
rs763652090 1253 dbSNP
rs1266312914 1255 dbSNP
rs1038758871 1256 dbSNP
rs959694734 1257 dbSNP
rs1387786996 1261 dbSNP
rs1035782417 1263 dbSNP
rs1000535933 1266 dbSNP
rs1374694982 1283 dbSNP
rs565737041 1283 dbSNP
rs1456260466 1286 dbSNP
rs558596042 1287 dbSNP
rs1391111772 1289 dbSNP
rs903519120 1290 dbSNP
rs902961572 1297 dbSNP
rs1042031206 1298 dbSNP
rs1318019349 1306 dbSNP
rs1229208961 1309 dbSNP
rs186167004 1316 dbSNP
rs1320436739 1319 dbSNP
rs918160687 1321 dbSNP
rs1021455752 1335 dbSNP
rs1337317152 1343 dbSNP
rs1011398357 1348 dbSNP
rs1056668581 1349 dbSNP
rs1464087771 1355 dbSNP
rs888956355 1362 dbSNP
rs1263840550 1367 dbSNP
rs760298002 1374 dbSNP
rs926727610 1376 dbSNP
rs556551413 1378 dbSNP
rs569498046 1379 dbSNP
rs974164250 1386 dbSNP
rs1388137517 1393 dbSNP
rs181645457 1397 dbSNP
rs3737745 1399 dbSNP
rs1376989298 1402 dbSNP
rs908557545 1405 dbSNP
rs982776524 1408 dbSNP
rs1357782892 1411 dbSNP
rs529941295 1425 dbSNP
rs1041470244 1429 dbSNP
rs190331107 1430 dbSNP
rs775044755 1431 dbSNP
rs767301295 1438 dbSNP
rs1481967620 1440 dbSNP
rs1017350901 1444 dbSNP
rs1258116215 1445 dbSNP
rs1476090588 1449 dbSNP
rs1000588345 1451 dbSNP
rs1179738262 1451 dbSNP
rs984283151 1466 dbSNP
rs903572799 1470 dbSNP
rs761117265 1475 dbSNP
rs1206848080 1478 dbSNP
rs1342564877 1502 dbSNP
rs1279356960 1512 dbSNP
rs1042473115 1513 dbSNP
rs1372807242 1518 dbSNP
rs1009215527 1520 dbSNP
rs1294725366 1521 dbSNP
rs1351414100 1523 dbSNP
rs896769198 1534 dbSNP
rs931437687 1538 dbSNP
rs17130199 1539 dbSNP
rs556773027 1542 dbSNP
rs1319509364 1550 dbSNP
rs991717811 1553 dbSNP
rs960583011 1554 dbSNP
rs1250808993 1557 dbSNP
rs527250365 1558 dbSNP
rs938211914 1574 dbSNP
rs564889623 1578 dbSNP
rs926783211 1579 dbSNP
rs1035351469 1583 dbSNP
rs1176863657 1585 dbSNP
rs1435570389 1593 dbSNP
rs1377293745 1600 dbSNP
rs1428385670 1602 dbSNP
rs977529649 1606 dbSNP
rs1371580421 1616 dbSNP
rs1038525225 1617 dbSNP
rs1444782592 1628 dbSNP
rs1299563099 1631 dbSNP
rs941457508 1645 dbSNP
rs908612180 1646 dbSNP
rs566501840 1659 dbSNP
rs955399527 1671 dbSNP
rs531463962 1687 dbSNP
rs1273767394 1690 dbSNP
rs1206320219 1700 dbSNP
rs1438233961 1700 dbSNP
rs975973644 1709 dbSNP
rs770992887 1716 dbSNP
rs1488286180 1717 dbSNP
rs1194429759 1720 dbSNP
rs1396999569 1729 dbSNP
rs964574214 1734 dbSNP
rs184989709 1735 dbSNP
rs544037519 1748 dbSNP
rs1440687168 1750 dbSNP
rs574945643 1751 dbSNP
rs968223626 1752 dbSNP
rs749300417 1762 dbSNP
rs763972429 1763 dbSNP
rs762988704 1770 dbSNP
rs1211380899 1779 dbSNP
rs1349607663 1796 dbSNP
rs72922732 1797 dbSNP
rs1326121677 1800 dbSNP
rs1004657115 1803 dbSNP
rs569678318 1804 dbSNP
rs1034646978 1817 dbSNP
rs1213656509 1819 dbSNP
rs1216197630 1826 dbSNP
rs1339392537 1833 dbSNP
rs1287473481 1839 dbSNP
rs887126170 1847 dbSNP
rs1271447858 1852 dbSNP
rs1002476351 1861 dbSNP
rs541345988 1863 dbSNP
rs1255095744 1865 dbSNP
rs1463629856 1869 dbSNP
rs1354189866 1871 dbSNP
rs181406452 1877 dbSNP
rs941520734 1879 dbSNP
rs189533261 1894 dbSNP
rs35883238 1899 dbSNP
rs1161910738 1925 dbSNP
rs1056003676 1932 dbSNP
rs765180103 1933 dbSNP
rs928914252 1936 dbSNP
rs538723431 1945 dbSNP
rs977708871 1946 dbSNP
rs1326434443 1947 dbSNP
rs1047136853 1954 dbSNP
rs1432843523 1954 dbSNP
rs138345972 1976 dbSNP
rs144723240 1980 dbSNP
rs922622011 1990 dbSNP
rs1233639499 1992 dbSNP
rs1409613238 2006 dbSNP
rs1420299659 2007 dbSNP
rs1208288181 2014 dbSNP
rs1169794697 2020 dbSNP
rs1285054126 2020 dbSNP
rs989827856 2023 dbSNP
rs975355461 2024 dbSNP
rs1417137959 2025 dbSNP
rs1475762610 2038 dbSNP
rs1190508015 2050 dbSNP
rs943318368 2055 dbSNP
rs41296163 2065 dbSNP
rs1486505718 2068 dbSNP
rs1230963940 2073 dbSNP
rs1157590978 2095 dbSNP
rs536405075 2102 dbSNP
rs1401914851 2105 dbSNP
rs1332156261 2111 dbSNP
rs1374765539 2113 dbSNP
rs979711658 2127 dbSNP
rs183970601 2142 dbSNP
rs868084080 2150 dbSNP
rs1203313319 2157 dbSNP
rs781294496 2164 dbSNP
rs1294912672 2173 dbSNP
rs1348328051 2181 dbSNP
rs1438106127 2185 dbSNP
rs1228053323 2191 dbSNP
rs1274499348 2199 dbSNP
rs1280312775 2203 dbSNP
rs1021170928 2209 dbSNP
rs1198774190 2223 dbSNP
rs1278621309 2233 dbSNP
rs1486277729 2234 dbSNP
rs1213575554 2239 dbSNP
rs1250104290 2244 dbSNP
rs1472440609 2245 dbSNP
rs1180703904 2249 dbSNP
rs776427127 2258 dbSNP
rs1470914596 2260 dbSNP
rs1170279899 2271 dbSNP
rs1393892947 2279 dbSNP
rs755313410 2287 dbSNP
rs567372243 2289 dbSNP
rs12016645 2290 dbSNP
rs770504267 2293 dbSNP
rs150966345 2295 dbSNP
rs1329843248 2302 dbSNP
rs1390585855 2302 dbSNP
rs1337751819 2326 dbSNP
rs569149135 2327 dbSNP
rs1034697761 2335 dbSNP
rs747340884 2338 dbSNP
rs1293162533 2339 dbSNP
rs1302784900 2340 dbSNP
rs1001857717 2343 dbSNP
rs780535595 2344 dbSNP
rs1273078057 2345 dbSNP
rs1357686264 2356 dbSNP
rs1250864381 2358 dbSNP
rs550761473 2360 dbSNP
rs1441742981 2370 dbSNP
rs1196221431 2371 dbSNP
rs878939686 2376 dbSNP
rs1006169464 2379 dbSNP
rs995578522 2380 dbSNP
rs760280542 2390 dbSNP
rs1461355749 2392 dbSNP
rs887291781 2409 dbSNP
rs11544220 2413 dbSNP
rs1055963396 2414 dbSNP
rs1398290380 2414 dbSNP
rs1325414697 2419 dbSNP
rs938814868 2422 dbSNP
rs1459893264 2428 dbSNP
rs1047649157 2430 dbSNP
rs1443153287 2436 dbSNP
rs1042339261 2437 dbSNP
rs1296131313 2437 dbSNP
rs1307410051 2437 dbSNP
rs928821871 2437 dbSNP
rs1354635009 2444 dbSNP
rs1393868728 2457 dbSNP
rs1207727546 2464 dbSNP
rs1251967209 2477 dbSNP
rs191349874 2482 dbSNP
rs56926776 2486 dbSNP
rs1039700300 2489 dbSNP
rs1405509575 2490 dbSNP
rs1246180226 2502 dbSNP
rs551444941 2507 dbSNP
rs942700590 2508 dbSNP
rs188038053 2510 dbSNP
rs1176478024 2511 dbSNP
rs979380624 2512 dbSNP
rs1374606117 2516 dbSNP
rs41311166 2519 dbSNP
rs913755059 2522 dbSNP
rs988352460 2527 dbSNP
rs140862907 2531 dbSNP
rs1273275057 2535 dbSNP
rs927679619 2537 dbSNP
rs1361274842 2551 dbSNP
rs1383295654 2554 dbSNP
rs980475164 2562 dbSNP
rs1298311179 2563 dbSNP
rs1339133763 2564 dbSNP
rs1272233117 2565 dbSNP
rs138130784 2567 dbSNP
rs1215116337 2572 dbSNP
rs1016978925 2574 dbSNP
rs146976760 2591 dbSNP
rs1337667143 2597 dbSNP
rs1485237025 2599 dbSNP
rs951686174 2619 dbSNP
rs1263726467 2631 dbSNP
rs1421903883 2632 dbSNP
rs41312728 2650 dbSNP
rs749868277 2651 dbSNP
rs1374534541 2657 dbSNP
rs572431525 2670 dbSNP
rs1281446631 2673 dbSNP
rs1438986376 2674 dbSNP
rs752342867 2676 dbSNP
rs1326734901 2677 dbSNP
rs1039754250 2678 dbSNP
rs1462947582 2680 dbSNP
rs1006894433 2681 dbSNP
rs111795245 2699 dbSNP
rs904534855 2709 dbSNP
rs1294306968 2710 dbSNP
rs1357685094 2715 dbSNP
rs1234783386 2717 dbSNP
rs542674714 2719 dbSNP
rs3171009 2725 dbSNP
rs1315853799 2729 dbSNP
rs1043428496 2730 dbSNP
rs1158081223 2731 dbSNP
rs946668723 2734 dbSNP
rs1409929737 2736 dbSNP
rs1257999136 2746 dbSNP
rs545040627 2749 dbSNP
rs865842255 2750 dbSNP
rs1453437621 2756 dbSNP
rs1419819620 2760 dbSNP
rs939166489 2762 dbSNP
rs1034807712 2768 dbSNP
rs576368507 2796 dbSNP
rs1375943164 2799 dbSNP
rs1002977457 2809 dbSNP
rs1313979744 2811 dbSNP
rs907335830 2830 dbSNP
rs1408353161 2833 dbSNP
rs1296159254 2836 dbSNP
rs1372140866 2838 dbSNP
rs1223936654 2842 dbSNP
rs1233501186 2842 dbSNP
rs1345061497 2842 dbSNP
rs201633419 2842 dbSNP
rs75397461 2843 dbSNP
rs1194996595 2845 dbSNP
rs1202179562 2846 dbSNP
rs1232585495 2850 dbSNP
rs1489740946 2853 dbSNP
rs536363463 2854 dbSNP
rs1179101254 2865 dbSNP
rs969088772 2898 dbSNP
rs1453821327 2906 dbSNP
rs1174859885 2913 dbSNP
rs200100391 2915 dbSNP
rs909562304 2934 dbSNP
rs1428286259 2940 dbSNP
rs1170206054 2948 dbSNP
rs573764294 2958 dbSNP
rs984177664 2959 dbSNP
rs946282373 2962 dbSNP
rs1442520532 2966 dbSNP
rs565409578 2974 dbSNP
rs1232348877 2981 dbSNP
rs549600731 2983 dbSNP
rs1368206150 2990 dbSNP
rs76137184 2990 dbSNP
rs1026311883 2996 dbSNP
rs184980651 2998 dbSNP
rs998343012 2999 dbSNP
rs755967666 3001 dbSNP
rs1212680184 3002 dbSNP
rs965524901 3003 dbSNP
rs1272029776 3011 dbSNP
rs931617360 3014 dbSNP
rs1288176505 3030 dbSNP
rs1206920304 3031 dbSNP
rs1018357305 3040 dbSNP
rs571610788 3041 dbSNP
rs1006946544 3045 dbSNP
rs1194323537 3046 dbSNP
rs551712102 3050 dbSNP
rs1254904320 3059 dbSNP
rs1474715425 3062 dbSNP
rs976216403 3084 dbSNP
rs904578364 3087 dbSNP
rs1420691607 3088 dbSNP
rs944485003 3091 dbSNP
rs907688146 3101 dbSNP
rs759305645 3104 dbSNP
rs547206189 3106 dbSNP
rs1171590638 3116 dbSNP
rs1043091759 3128 dbSNP
rs780279783 3133 dbSNP
rs1428590812 3138 dbSNP
rs951941684 3139 dbSNP
rs1362458686 3145 dbSNP
rs1216102263 3148 dbSNP
rs1027537365 3151 dbSNP
rs990737509 3154 dbSNP
rs892422548 3157 dbSNP
rs1275156635 3164 dbSNP
rs1426177736 3165 dbSNP
rs1215763396 3170 dbSNP
rs1243165446 3171 dbSNP
rs774007904 3185 dbSNP
rs958671526 3198 dbSNP
rs506731 3199 dbSNP
rs939218615 3205 dbSNP
rs1186383482 3216 dbSNP
rs762956759 3221 dbSNP
rs927787348 3222 dbSNP
rs1165147592 3229 dbSNP
rs1486510975 3230 dbSNP
rs1003353901 3233 dbSNP
rs1398433253 3234 dbSNP
rs1317606440 3244 dbSNP
rs773316429 3251 dbSNP
rs1345700213 3259 dbSNP
rs907306763 3264 dbSNP
rs193042556 3267 dbSNP
rs577994912 3267 dbSNP
rs1234153636 3273 dbSNP
rs947813042 3288 dbSNP
rs1223286024 3290 dbSNP
rs529011159 3290 dbSNP
rs983840999 3291 dbSNP
rs929621404 3295 dbSNP
rs1209280219 3300 dbSNP
rs1281251120 3300 dbSNP
rs1257301166 3308 dbSNP
rs900140442 3316 dbSNP
rs918224766 3319 dbSNP
rs1188277850 3320 dbSNP
rs1369809135 3321 dbSNP
rs505712 3334 dbSNP
rs748193302 3335 dbSNP
rs965575760 3353 dbSNP
rs1157495266 3355 dbSNP
rs1235738631 3363 dbSNP
rs1421474016 3364 dbSNP
rs561509111 3365 dbSNP
rs1040068704 3369 dbSNP
rs1374673350 3373 dbSNP
rs188664309 3374 dbSNP
rs529773305 3380 dbSNP
rs1336470115 3393 dbSNP
rs544085636 3394 dbSNP
rs1441675118 3395 dbSNP
rs1280219029 3400 dbSNP
rs1352886619 3402 dbSNP
rs1382698969 3410 dbSNP
rs968854797 3415 dbSNP
rs527968713 3416 dbSNP
rs565197143 3425 dbSNP
rs1010274572 3433 dbSNP
rs891800869 3436 dbSNP
rs1435720377 3437 dbSNP
rs1180596811 3450 dbSNP
rs768757593 3452 dbSNP
rs1375869058 3462 dbSNP
rs370760576 3468 dbSNP
rs1171726834 3469 dbSNP
rs747314170 3471 dbSNP
rs1394395668 3485 dbSNP
rs545299596 3487 dbSNP
rs959305661 3500 dbSNP
rs1174122587 3501 dbSNP
rs374199688 3502 dbSNP
rs1371984454 3504 dbSNP
rs1170611223 3513 dbSNP
rs780374721 3521 dbSNP
rs576351267 3522 dbSNP
rs947863880 3523 dbSNP
rs562777911 3524 dbSNP
rs1438766290 3528 dbSNP
rs1485528666 3529 dbSNP
rs746332938 3533 dbSNP
rs779417105 3560 dbSNP
rs971878553 3567 dbSNP
rs1339086458 3572 dbSNP
rs1202336178 3577 dbSNP
rs1479815049 3585 dbSNP
rs1191189295 3588 dbSNP
rs1250828072 3589 dbSNP
rs888234451 3592 dbSNP
rs376988148 3599 dbSNP
rs1251774279 3607 dbSNP
rs1454662168 3626 dbSNP
rs1048625887 3630 dbSNP
rs929701409 3638 dbSNP
rs7419 3643 dbSNP
rs976357943 3644 dbSNP
rs574098760 3647 dbSNP
rs1459997088 3649 dbSNP
rs1325303771 3655 dbSNP
rs944322629 3662 dbSNP
rs1389057459 3667 dbSNP
rs1033153767 3679 dbSNP
rs1326246844 3687 dbSNP
rs142110058 3688 dbSNP
rs900779498 3690 dbSNP
rs1319568146 3698 dbSNP
rs1040444131 3699 dbSNP
rs1008598745 3704 dbSNP
rs911457298 3721 dbSNP
rs886106161 3725 dbSNP
rs1211621318 3729 dbSNP
rs1259537308 3738 dbSNP
rs1047487990 3740 dbSNP
rs1193617069 3750 dbSNP
rs752150007 3751 dbSNP
rs920411420 3768 dbSNP
rs554001615 3769 dbSNP
rs1054988834 3771 dbSNP
rs11544221 3778 dbSNP
rs1021763795 3779 dbSNP
rs183250851 3788 dbSNP
rs1384852839 3793 dbSNP
rs1383209235 3794 dbSNP
rs1300440789 3802 dbSNP
rs989306432 3804 dbSNP
rs757287736 3806 dbSNP
rs982443923 3807 dbSNP
rs1292274664 3817 dbSNP
rs1391694712 3828 dbSNP
rs1321838700 3835 dbSNP
rs1246347766 3836 dbSNP
rs956127212 3838 dbSNP
rs971384223 3843 dbSNP
rs149045338 3864 dbSNP
rs1475175781 3871 dbSNP
rs1274863470 3875 dbSNP
rs1002854626 3876 dbSNP
rs1265089636 3877 dbSNP
rs1484554410 3882 dbSNP
rs1187550242 3887 dbSNP
rs988827250 3896 dbSNP
rs1231324249 3905 dbSNP
rs906487053 3909 dbSNP
rs1363230436 3911 dbSNP
rs537763121 3915 dbSNP
rs568817870 3917 dbSNP
rs1023547160 3918 dbSNP
rs767117517 3922 dbSNP
rs1012130121 3925 dbSNP
rs1009580482 3928 dbSNP
rs1397359922 3931 dbSNP
rs1250022138 3935 dbSNP
rs1196633756 3938 dbSNP
rs1304239421 3938 dbSNP
rs1459094935 3940 dbSNP
rs191573284 3943 dbSNP
rs112069016 3946 dbSNP
rs555600976 3955 dbSNP
rs1237775807 3957 dbSNP
rs929727712 3958 dbSNP
rs1335461273 3959 dbSNP
rs1249942379 3973 dbSNP
rs757798350 3974 dbSNP
rs1040711976 3975 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuUGGUAAUACACGACGAu 5'
               ::| |||  ||||||| 
Target 5' acuuuGUCCUUA-AUGCUGCUu 3'
4 - 24
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000370982.3 | 3UTR | UAUACUUUGUCCUUAAUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000370982.3 | 3UTR | UAUACUUUGUCCUUAAUGCUGCUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.734 7.6e-5 -0.730 8.6e-5 21 Click to see details
GSE21032 Prostate cancer 0.343 7.5e-4 0.209 2.9e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells 0.611 9.8e-4 0.606 1.1e-3 23 Click to see details
GSE19783 ER- ER- breast cancer 0.192 4.5e-2 0.109 1.7e-1 79 Click to see details
GSE19536 Breast cancer 0.154 6.3e-2 0.083 2.1e-1 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.317 6.6e-2 0.291 8.4e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.12 1.3e-1 -0.155 7.2e-2 90 Click to see details
GSE17306 Multiple myeloma 0.142 1.7e-1 0.144 1.6e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.172 1.7e-1 0.136 2.3e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.201 2.0e-1 0.077 3.7e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.103 2.1e-1 0.153 1.1e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.222 2.4e-1 0.147 3.2e-1 12 Click to see details
GSE28544 Breast cancer 0.145 2.5e-1 0.545 2.9e-3 24 Click to see details
GSE27834 Pluripotent stem cells 0.178 2.5e-1 0.256 1.7e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.116 3.1e-1 -0.156 2.6e-1 20 Click to see details
GSE17498 Multiple myeloma 0.07 3.3e-1 -0.085 3.0e-1 40 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.041 4.2e-1 -0.045 4.2e-1 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.036 4.3e-1 0.045 4.2e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.033 4.6e-1 -0.027 4.7e-1 13 Click to see details
GSE28260 Renal cortex and medulla -0.033 4.6e-1 -0.027 4.7e-1 13 Click to see details
GSE28260 Renal cortex and medulla -0.033 4.6e-1 -0.027 4.7e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.403 0 -0.266 0.03 50 Click to see details
BLCA -0.516 0.01 -0.340 0.08 18 Click to see details
LIHC 0.313 0.01 0.312 0.01 49 Click to see details
LUAD 0.602 0.02 0.469 0.06 12 Click to see details
PAAD -0.867 0.07 -0.400 0.3 4 Click to see details
CHOL -0.522 0.07 -0.550 0.06 9 Click to see details
KIRC 0.175 0.08 0.182 0.07 68 Click to see details
UCEC 0.305 0.1 0.226 0.18 19 Click to see details
COAD -0.496 0.11 -0.595 0.06 8 Click to see details
PCPG 0.864 0.17 0.500 0.33 3 Click to see details
THCA -0.119 0.18 -0.143 0.14 59 Click to see details
STAD 0.148 0.21 0.121 0.25 32 Click to see details
CESC 0.593 0.3 0.500 0.33 3 Click to see details
LUSC -0.079 0.32 -0.122 0.23 38 Click to see details
KICH 0.08 0.35 0.068 0.37 25 Click to see details
HNSC 0.045 0.39 0.069 0.33 42 Click to see details
ESCA -0.066 0.42 0.009 0.49 11 Click to see details
BRCA -0.01 0.46 -0.080 0.23 84 Click to see details
KIRP -0.005 0.49 -0.106 0.28 32 Click to see details
KIRP -0.005 0.49 -0.106 0.28 32 Click to see details
KIRP -0.005 0.49 -0.106 0.28 32 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 1 2
MIRT474318 LAMC1 laminin subunit gamma 1 1 1
MIRT474828 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT475068 IVNS1ABP influenza virus NS1A binding protein 1 3
MIRT475123 IPPK inositol-pentakisphosphate 2-kinase 1 1
MIRT475539 HOXA3 homeobox A3 1 4
MIRT475720 HEYL hes related family bHLH transcription factor with YRPW motif-like 1 1
MIRT475843 HDGF heparin binding growth factor 1 2
MIRT476259 GNB1 G protein subunit beta 1 1 4
MIRT476276 GNAL G protein subunit alpha L 1 3
MIRT476698 FURIN furin, paired basic amino acid cleaving enzyme 1 1
MIRT477565 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 4
MIRT477849 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT478911 CPSF7 cleavage and polyadenylation specific factor 7 1 3
MIRT479457 CDK6 cyclin dependent kinase 6 1 1
MIRT479988 CARD10 caspase recruitment domain family member 10 1 1
MIRT481181 AVL9 AVL9 cell migration associated 1 3
MIRT482370 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT482556 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 5
MIRT482581 ABHD2 abhydrolase domain containing 2 1 1
MIRT484778 ABCC6 ATP binding cassette subfamily C member 6 1 2
MIRT485215 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 1 4
MIRT487394 C10orf54 V-set immunoregulatory receptor 1 1
MIRT492715 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 1 1
MIRT494354 CASKIN1 CASK interacting protein 1 1 1
MIRT495146 ZNRF1 zinc and ring finger 1 1 1
MIRT496019 CD180 CD180 molecule 1 1
MIRT497776 KIAA0895 KIAA0895 1 1
MIRT498984 ORC4 origin recognition complex subunit 4 1 4
MIRT499456 ODF2L outer dense fiber of sperm tails 2 like 1 4
MIRT499619 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 1 4
MIRT500097 L2HGDH L-2-hydroxyglutarate dehydrogenase 1 4
MIRT500321 ZNF622 zinc finger protein 622 1 5
MIRT500425 ZMAT3 zinc finger matrin-type 3 1 2
MIRT500580 USP53 ubiquitin specific peptidase 53 1 1
MIRT500860 SYPL1 synaptophysin like 1 1 4
MIRT500936 SRPR SRP receptor alpha subunit 1 4
MIRT500953 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 4
MIRT501089 SMAD7 SMAD family member 7 1 4
MIRT501506 PRICKLE2 prickle planar cell polarity protein 2 1 1
MIRT502038 LRIG2 leucine rich repeats and immunoglobulin like domains 2 1 1
MIRT502151 KIF5B kinesin family member 5B 1 5
MIRT502496 FAM122B family with sequence similarity 122B 1 4
MIRT502570 E2F7 E2F transcription factor 7 1 6
MIRT502643 DDX3X DEAD-box helicase 3, X-linked 1 4
MIRT502922 CDCA4 cell division cycle associated 4 1 5
MIRT502950 CDC37L1 cell division cycle 37 like 1 1 5
MIRT503140 ATG9A autophagy related 9A 1 4
MIRT504338 ASGR2 asialoglycoprotein receptor 2 1 3
MIRT504540 ZNF620 zinc finger protein 620 1 3
MIRT504855 HAUS3 HAUS augmin like complex subunit 3 1 3
MIRT505116 YTHDC1 YTH domain containing 1 1 3
MIRT505349 TMEM245 transmembrane protein 245 1 3
MIRT505398 TMEM100 transmembrane protein 100 1 1
MIRT505505 SRSF1 serine and arginine rich splicing factor 1 1 3
MIRT505549 SNX16 sorting nexin 16 1 3
MIRT505686 SESTD1 SEC14 and spectrin domain containing 1 1 3
MIRT505911 RIMS3 regulating synaptic membrane exocytosis 3 1 3
MIRT505930 RCAN3 RCAN family member 3 1 2
MIRT506112 PPIG peptidylprolyl isomerase G 1 3
MIRT506138 PLRG1 pleiotropic regulator 1 1 2
MIRT506166 PLAG1 PLAG1 zinc finger 1 5
MIRT506194 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 3
MIRT506487 MYO5A myosin VA 1 4
MIRT506854 KIF23 kinesin family member 23 1 4
MIRT507002 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 1 3
MIRT507820 CDK1 cyclin dependent kinase 1 1 3
MIRT507853 CCNE2 cyclin E2 1 3
MIRT507877 CBX6 chromobox 6 1 1
MIRT508041 AXIN2 axin 2 1 3
MIRT508644 CASK calcium/calmodulin dependent serine protein kinase 1 2
MIRT509368 DMPK DM1 protein kinase 1 5
MIRT509693 ATAD5 ATPase family, AAA domain containing 5 1 2
MIRT510047 AKR1B10 aldo-keto reductase family 1 member B10 1 2
MIRT511847 GPATCH8 G-patch domain containing 8 1 3
MIRT512288 ARHGDIA Rho GDP dissociation inhibitor alpha 1 4
MIRT512646 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 3
MIRT513854 JARID2 jumonji and AT-rich interaction domain containing 2 1 4
MIRT514020 CAMSAP1 calmodulin regulated spectrin associated protein 1 1 3
MIRT514042 ATG14 autophagy related 14 1 1
MIRT518095 TRIM35 tripartite motif containing 35 1 1
MIRT518533 FLCN folliculin 1 3
MIRT518998 NNT nicotinamide nucleotide transhydrogenase 1 2
MIRT521055 SLC2A3 solute carrier family 2 member 3 1 2
MIRT521207 SBNO1 strawberry notch homolog 1 1 3
MIRT521818 POM121C POM121 transmembrane nucleoporin C 1 1
MIRT522098 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 3
MIRT522778 LAMP2 lysosomal associated membrane protein 2 1 3
MIRT537815 EFNB2 ephrin B2 1 2
MIRT539902 RPL14 ribosomal protein L14 1 2
MIRT540847 GNAT1 G protein subunit alpha transducin 1 1 2
MIRT541217 HOXA10 homeobox A10 1 1
MIRT541432 CBX4 chromobox 4 1 2
MIRT542810 PHC3 polyhomeotic homolog 3 1 2
MIRT542837 PDCD1 programmed cell death 1 1 3
MIRT543062 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT543310 ZNF585B zinc finger protein 585B 1 1
MIRT543411 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT543529 PRSS21 protease, serine 21 1 1
MIRT543801 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 2
MIRT543839 GSG1 germ cell associated 1 1 1
MIRT544575 POLDIP3 DNA polymerase delta interacting protein 3 1 1
MIRT544593 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 1 2
MIRT544916 CLSPN claspin 1 1
MIRT544969 UGT2B4 UDP glucuronosyltransferase family 2 member B4 1 1
MIRT545190 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 2
MIRT545351 CCDC83 coiled-coil domain containing 83 1 1
MIRT545686 DECR1 2,4-dienoyl-CoA reductase 1 1 1
MIRT545961 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT545973 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT546118 USP48 ubiquitin specific peptidase 48 1 2
MIRT546611 SALL1 spalt like transcription factor 1 1 2
MIRT546619 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT546640 RTN4 reticulon 4 1 1
MIRT547069 PNISR PNN interacting serine and arginine rich protein 1 2
MIRT547131 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT547233 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 1 2
MIRT547305 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 1 2
MIRT547406 MKX mohawk homeobox 1 1
MIRT547463 MBD4 methyl-CpG binding domain 4, DNA glycosylase 1 1
MIRT547546 LRRFIP2 LRR binding FLII interacting protein 2 1 2
MIRT547661 KPNA3 karyopherin subunit alpha 3 1 1
MIRT547702 KPNA1 karyopherin subunit alpha 1 1 2
MIRT547968 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 2
MIRT548001 HCFC2 host cell factor C2 1 2
MIRT548018 GRB2 growth factor receptor bound protein 2 1 2
MIRT548219 FKBP1A FK506 binding protein 1A 1 1
MIRT548275 FBXL20 F-box and leucine rich repeat protein 20 1 1
MIRT548727 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT548809 CLIP4 CAP-Gly domain containing linker protein family member 4 1 2
MIRT548946 CDK17 cyclin dependent kinase 17 1 2
MIRT549076 CACUL1 CDK2 associated cullin domain 1 1 1
MIRT549123 C11orf24 chromosome 11 open reading frame 24 1 2
MIRT549278 ASH1L ASH1 like histone lysine methyltransferase 1 2
MIRT549389 AMOT angiomotin 1 1
MIRT550405 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 2
MIRT550470 OSCAR osteoclast associated, immunoglobulin-like receptor 1 2
MIRT550619 MTHFR methylenetetrahydrofolate reductase 1 1
MIRT550827 FAM229B family with sequence similarity 229 member B 1 1
MIRT551383 EPM2AIP1 EPM2A interacting protein 1 1 1
MIRT551621 ZNF267 zinc finger protein 267 1 1
MIRT551740 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 1 1
MIRT552039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 1 1
MIRT552348 ZNF704 zinc finger protein 704 1 1
MIRT552744 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 1 1
MIRT553442 TPM3 tropomyosin 3 1 1
MIRT553565 TMEM161B transmembrane protein 161B 1 1
MIRT553620 TM7SF3 transmembrane 7 superfamily member 3 1 1
MIRT553777 TAF13 TATA-box binding protein associated factor 13 1 2
MIRT553812 SZRD1 SUZ RNA binding domain containing 1 1 2
MIRT554702 RNF149 ring finger protein 149 1 1
MIRT554965 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT555035 RAB23 RAB23, member RAS oncogene family 1 1
MIRT555143 PTPRD protein tyrosine phosphatase, receptor type D 1 1
MIRT555229 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 2
MIRT555278 PRDM4 PR/SET domain 4 1 1
MIRT555431 PPAP2B phospholipid phosphatase 3 1 1
MIRT556385 LURAP1L leucine rich adaptor protein 1 like 1 1
MIRT556861 KANK1 KN motif and ankyrin repeat domains 1 1 2
MIRT557284 HIST2H2BE histone cluster 2 H2B family member e 1 1
MIRT557484 GPR27 G protein-coupled receptor 27 1 2
MIRT558041 EXT1 exostosin glycosyltransferase 1 1 1
MIRT558511 CYP26B1 cytochrome P450 family 26 subfamily B member 1 1 2
MIRT558664 CNKSR3 CNKSR family member 3 1 1
MIRT559006 CA8 carbonic anhydrase 8 1 1
MIRT559155 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT559536 ARHGAP12 Rho GTPase activating protein 12 1 3
MIRT560855 OSBPL3 oxysterol binding protein like 3 1 1
MIRT561153 KRT33B keratin 33B 1 1
MIRT561404 TUBB2A tubulin beta 2A class IIa 1 1
MIRT561878 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT562031 LANCL1 LanC like 1 1 1
MIRT562204 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 1 1
MIRT562881 KIAA1456 KIAA1456 1 1
MIRT563090 SLC25A12 solute carrier family 25 member 12 1 2
MIRT563507 DLGAP3 DLG associated protein 3 1 1
MIRT563705 THRAP3 thyroid hormone receptor associated protein 3 1 1
MIRT563849 SMDT1 single-pass membrane protein with aspartate rich tail 1 1 1
MIRT563900 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT564336 CCNT1 cyclin T1 1 1
MIRT564482 ZNF391 zinc finger protein 391 1 1
MIRT564556 CCDC80 coiled-coil domain containing 80 1 1
MIRT564838 ZBTB16 zinc finger and BTB domain containing 16 1 1
MIRT564954 XKR7 XK related 7 1 1
MIRT564987 WNK3 WNK lysine deficient protein kinase 3 1 1
MIRT565041 VAV2 vav guanine nucleotide exchange factor 2 1 1
MIRT565400 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT566122 RASEF RAS and EF-hand domain containing 1 1
MIRT566654 NCKAP1 NCK associated protein 1 1 1
MIRT566834 MAP3K7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT567017 KLHL15 kelch like family member 15 1 1
MIRT567450 GNG12 G protein subunit gamma 12 1 1
MIRT567482 FZD9 frizzled class receptor 9 1 1
MIRT568025 CMTM4 CKLF like MARVEL transmembrane domain containing 4 1 1
MIRT568143 CCDC88C coiled-coil domain containing 88C 1 1
MIRT568477 ARMC12 armadillo repeat containing 12 1 1
MIRT568575 AHNAK2 AHNAK nucleoprotein 2 1 1
MIRT568621 ACVR2A activin A receptor type 2A 1 1
MIRT570464 TLK1 tousled like kinase 1 1 2
MIRT571123 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT571287 TTLL5 tubulin tyrosine ligase like 5 1 1
MIRT571431 RIF1 replication timing regulatory factor 1 1 1
MIRT571662 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT571824 PHF19 PHD finger protein 19 1 1
MIRT571926 LSM11 LSM11, U7 small nuclear RNA associated 1 2
MIRT574062 PROSC pyridoxal phosphate binding protein 1 1
MIRT574207 CLEC2D C-type lectin domain family 2 member D 1 1
MIRT574542 PDIA6 protein disulfide isomerase family A member 6 1 2
MIRT574595 N4BP1 NEDD4 binding protein 1 1 2
MIRT575886 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1 1
MIRT575928 Dmpk dystrophia myotonica-protein kinase 1 1
MIRT576100 Pdcd1 programmed cell death 1 1 1
MIRT576593 Npepps aminopeptidase puromycin sensitive 1 1
MIRT614697 TRAK1 trafficking kinesin protein 1 1 1
MIRT616471 ADRA2B adrenoceptor alpha 2B 1 1
MIRT618900 ANKMY1 ankyrin repeat and MYND domain containing 1 1 1
MIRT621501 GPRC5A G protein-coupled receptor class C group 5 member A 1 2
MIRT640542 C3orf36 chromosome 3 open reading frame 36 1 1
MIRT645514 BSPRY B-box and SPRY domain containing 1 1
MIRT646599 ANKRD36 ankyrin repeat domain 36 1 1
MIRT648788 KLHL40 kelch like family member 40 1 1
MIRT655815 NOTCH2 notch 2 1 2
MIRT658796 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 1 1
MIRT659260 CUL3 cullin 3 1 1
MIRT680986 DCAF17 DDB1 and CUL4 associated factor 17 1 1
MIRT682280 RS1 retinoschisin 1 1 1
MIRT682518 GLP2R glucagon like peptide 2 receptor 1 1
MIRT691713 FLOT2 flotillin 2 1 2
MIRT693934 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 1 1
MIRT701510 NEGR1 neuronal growth regulator 1 1 1
MIRT702096 MCFD2 multiple coagulation factor deficiency 2 1 1
MIRT702879 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT713423 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT714442 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT716436 RAB15 RAB15, member RAS oncogene family 1 1
MIRT717465 ADORA3 adenosine A3 receptor 1 1
MIRT720153 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 1 1
MIRT725130 SYNRG synergin gamma 1 1
MIRT726007 ZNF91 zinc finger protein 91 1 1
MIRT726084 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726128 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726132 CHMP3 charged multivesicular body protein 3 1 1
MIRT726143 VCL vinculin 1 1
MIRT726158 USP3 ubiquitin specific peptidase 3 1 1
MIRT726166 USP31 ubiquitin specific peptidase 31 1 1
MIRT726221 TUBB tubulin beta class I 1 1
MIRT726238 TRAM1 translocation associated membrane protein 1 1 1
MIRT726280 TMEM69 transmembrane protein 69 1 1
MIRT726287 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726307 TMEM135 transmembrane protein 135 1 1
MIRT726317 TLE4 transducin like enhancer of split 4 1 1
MIRT726322 TKTL1 transketolase like 1 1 1
MIRT726325 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726339 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726348 TCF3 transcription factor 3 1 1
MIRT726356 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726360 TBCCD1 TBCC domain containing 1 1 1
MIRT726367 TBC1D20 TBC1 domain family member 20 1 1
MIRT726372 TBC1D14 TBC1 domain family member 14 1 1
MIRT726384 TASP1 taspase 1 1 1
MIRT726410 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726422 STX17 syntaxin 17 1 1
MIRT726455 SRPK1 SRSF protein kinase 1 1 1
MIRT726462 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726482 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726507 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726511 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726545 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726548 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726677 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726680 RPS5 ribosomal protein S5 1 1
MIRT726685 RPL36 ribosomal protein L36 1 1
MIRT726712 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726715 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726720 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726756 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726764 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726773 RELT RELT, TNF receptor 1 1
MIRT726789 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT726812 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726826 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726853 PSMB5 proteasome subunit beta 5 1 1
MIRT726874 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726902 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726910 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726967 PGD phosphogluconate dehydrogenase 1 1
MIRT726974 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727021 PANK1 pantothenate kinase 1 1 1
MIRT727028 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727038 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727068 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727096 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727137 MTMR4 myotubularin related protein 4 1 1
MIRT727154 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727176 MLXIP MLX interacting protein 1 1
MIRT727198 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727223 MED11 mediator complex subunit 11 1 1
MIRT727228 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727262 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727268 LRRC57 leucine rich repeat containing 57 1 1
MIRT727271 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727297 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727349 KLC2 kinesin light chain 2 1 1
MIRT727377 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727385 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727426 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727483 HYOU1 hypoxia up-regulated 1 1 1
MIRT727523 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727585 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727605 GANAB glucosidase II alpha subunit 1 1
MIRT727619 GABARAP GABA type A receptor-associated protein 1 1
MIRT727647 FRYL FRY like transcription coactivator 1 1
MIRT727701 FAM73A mitoguardin 1 1 1
MIRT727719 AMER1 APC membrane recruitment protein 1 1 1
MIRT727814 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727856 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727860 DPP8 dipeptidyl peptidase 8 1 1
MIRT727866 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727876 DICER1 dicer 1, ribonuclease III 1 1
MIRT727910 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727913 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727917 CUL2 cullin 2 1 1
MIRT727924 CSDE1 cold shock domain containing E1 1 1
MIRT727936 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727953 CPNE1 copine 1 1 1
MIRT727999 RHOV ras homolog family member V 1 1
MIRT728006 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728019 CDC27 cell division cycle 27 1 1
MIRT728047 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728092 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728101 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728127 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728133 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728194 BSG basigin (Ok blood group) 1 1
MIRT728237 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728265 ATP13A3 ATPase 13A3 1 1
MIRT728290 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728330 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728384 AFF4 AF4/FMR2 family member 4 1 1
MIRT728400 ACOX1 acyl-CoA oxidase 1 1 1
MIRT731341 CXCL10 C-X-C motif chemokine ligand 10 1 1
Error report submission
MIRT ID*
Your e-Mail*