miRTarBase - #MIRT571143 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HM13   
Synonyms H13, IMP1, IMPAS, IMPAS-1, MSTP086, PSENL3, PSL3, SPP, SPPL1
Description histocompatibility minor 13
Transcript NM_178582   
Other Transcripts NM_030789 , NM_178581 , NM_178580   
Expression
Putative miRNA Targets on HM13
3'UTR of HM13
(miRNA target sites are highlighted)
>HM13|NM_178582|3'UTR
   1 GAACATGACTTTTGGCATCATTCAGAGCCAGGTTTGAATCCTGGCTATAAAACTCAAGGGACTCTTTCCCCTGCACACTG
  81 TAGATGACTAGGACAAGAACAATGACCTCTCTGGGCCACAGTTTCCTTATAGACATGATGAGGATCTGGTGGGTGTTTCC
 161 ACCACCACAGCTGTTGGGAAAGTGATTTGTGAGCAGTAATGTCATGTTAGTTGTGACAGTACTCAGGTGAGTAACACCAG
 241 TACCACCTGCCGGGTGTTGTGGCCTAGCTGTGTGCTAAGTGCCATGTTGGGCTCCTCACACATGATCGTGTTTCGTAAGG
 321 AGCCAGAGGCAGCATAGTGAAAAGTTAGGAGCGTGGGCTCTGGCATTTGACTACCTTACTTTGAGTCCAGACTCTGCCAC
 401 TTAATAGCTCTGTGATCTTGGGCAAGTTACTTAATCTCTCTGGCCTCAATTTCCTGGTGAATGTGGAGAAAAATAATAGT
 481 GCCCTTCCCATGGGGTCATGTGGAAAGCTTTTAGCACAGTATCTGGTGATTTAAAGTGTTCAGTAACTATTAGCTGTTAC
 561 TGTCATTATCTGTGTTAACCTGCCAGACAACCTTATATGGGTTGCTTTTGCTTTCACACCTGTATGATAGTCATGGAAAC
 641 TGAAGCCCAGAGAGGTTAAGAAATTTGCTAGGATCACACCACTAATAAGCAACAGAGCCAGGATTCAAACCCAGGTGTGG
 721 CTCCAGAGCCCATCCTCTTCCCACTGCTACCCTAACTCAAACTGCCACATGCTCGTGTCCTTTCAGTGGGGAGAGTGGTT
 801 CATTAGAGGGGGTTGCTACTTTTATTTTGGACAGGCCAGTTCTCCATTCTGCAGGACTATCCCATGTATTACAAACAGTT
 881 GGCAACCTTGCCCTGCTCACCAAATGGGAGTTGCATACCAGTATTCCCCAGCTTGTGACTACAGAGATGTCCCAGTATGT
 961 TTCTTTCTGCCCCGTTGAAGAGGTGCAGCCTCAGGCTGAGAAACACTGATAGACCAAGAGGTGGCCAGGGTTCCCAGAAG
1041 GAAGGAACTCACCTTGAACTTAGCTTTCTTTGAAGGGTAGGAAACCTGGAAGACGTACAAAGGAGGGAGAGGTCAGGTGC
1121 TAGAAAGTTTGTGCACATTGAGGGCATGGGCAGAATCTGCTCCCAAAAGCATTGAAAGCCAATATGAGGCCAGGTGGTGG
1201 CTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACAAGGTCAGGAGATTGAGACCATCCTGGCCAA
1281 CATGGTGAAACCCCGTCTCTACTAAAAATACAAAAAAATTAGCTGGGCATGGTGGTGCATGCCTGTAGTCCCAGCTACTC
1361 AGGAGGCTGAGGTAGGAGAATCATTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATTGCACCACTGCATTCCAGCC
1441 TGGCGACAGAGTGAGACTCCATCTCAAAAAAAAAAAAAAAGCCAATATGAATGTGGCTTCATTCTTCTAGGCACACTGGC
1521 AGGACAGTGTGGTAGTCAGGAGCACAGGGTCAAGAGGCAGGCAGCCTTGGGACAAACACCTGGTGCTGCCAGCTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :||:||| 
Target 5' attGCACCACT---GCATTCCa 3'
1419 - 1437 124.00 -15.70
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::|: ||  || | ||||| 
Target 5' ctGGCGACAGAGTGAGACTCCa 3'
1440 - 1461 124.00 -14.50
3
miRNA  3' guuuGUGGUAA---CAGUGUGAggu 5'
              ||:: ||   | ||||||   
Target 5' gcttCATTCTTCTAGGCACACTggc 3'
1496 - 1520 114.00 -7.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30674107 6 COSMIC
COSN30714003 77 COSMIC
COSN21819232 652 COSMIC
COSN5968592 1085 COSMIC
COSN16586884 1473 COSMIC
COSN21640517 2402 COSMIC
COSN21640849 2435 COSMIC
COSN21474654 2727 COSMIC
COSN24155141 3089 COSMIC
COSN22393583 3250 COSMIC
COSN23665202 3354 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759957424 1 dbSNP
rs1182984684 7 dbSNP
rs1383144477 10 dbSNP
rs963826837 13 dbSNP
rs1446262838 15 dbSNP
rs368766161 18 dbSNP
rs1396063913 26 dbSNP
rs775802773 33 dbSNP
rs763501730 37 dbSNP
rs1395346994 41 dbSNP
rs1037387359 45 dbSNP
rs767193640 46 dbSNP
rs371262676 48 dbSNP
rs764574492 50 dbSNP
rs1266512904 56 dbSNP
rs1373302091 65 dbSNP
rs1205647855 66 dbSNP
rs973412457 69 dbSNP
rs1258718020 78 dbSNP
rs1215684104 81 dbSNP
rs1173666329 86 dbSNP
rs574210945 87 dbSNP
rs1035592680 96 dbSNP
rs538447959 97 dbSNP
rs779753124 101 dbSNP
rs929328385 107 dbSNP
rs1329424111 112 dbSNP
rs1469838988 115 dbSNP
rs981983360 122 dbSNP
rs1014036308 125 dbSNP
rs1384861820 128 dbSNP
rs749222867 130 dbSNP
rs770309025 131 dbSNP
rs927903740 133 dbSNP
rs937818036 141 dbSNP
rs1175138645 142 dbSNP
rs1054992396 161 dbSNP
rs200696305 163 dbSNP
rs1193344589 166 dbSNP
rs1430210952 168 dbSNP
rs1327282907 174 dbSNP
rs543520815 183 dbSNP
rs1192607648 195 dbSNP
rs191848454 202 dbSNP
rs142770853 206 dbSNP
rs946435354 211 dbSNP
rs1224194033 231 dbSNP
rs573930029 232 dbSNP
rs969755596 235 dbSNP
rs1042151356 239 dbSNP
rs1260132048 252 dbSNP
rs1484819202 253 dbSNP
rs1276875986 255 dbSNP
rs1206676489 257 dbSNP
rs1356508363 259 dbSNP
rs1262116942 260 dbSNP
rs1315261730 269 dbSNP
rs1412382246 270 dbSNP
rs979530917 278 dbSNP
rs1167954521 286 dbSNP
rs925330643 295 dbSNP
rs148338252 303 dbSNP
rs956888273 305 dbSNP
rs902143844 308 dbSNP
rs1259342749 309 dbSNP
rs997864084 315 dbSNP
rs1030538698 316 dbSNP
rs890743047 330 dbSNP
rs1196405139 335 dbSNP
rs1480514074 337 dbSNP
rs1051084751 347 dbSNP
rs910235904 349 dbSNP
rs1007669898 353 dbSNP
rs1017753291 354 dbSNP
rs1295471811 358 dbSNP
rs1157703633 360 dbSNP
rs184351003 364 dbSNP
rs1452216503 374 dbSNP
rs1329144523 376 dbSNP
rs1392559240 387 dbSNP
rs973869434 390 dbSNP
rs1160675554 392 dbSNP
rs189099978 398 dbSNP
rs1330168372 408 dbSNP
rs1026399540 431 dbSNP
rs1461872599 437 dbSNP
rs1419985551 439 dbSNP
rs551603505 449 dbSNP
rs1161199921 454 dbSNP
rs950772341 456 dbSNP
rs181720943 460 dbSNP
rs570371103 462 dbSNP
rs1182799516 469 dbSNP
rs1404683417 469 dbSNP
rs1236415053 472 dbSNP
rs141705920 476 dbSNP
rs776250690 477 dbSNP
rs1198137787 481 dbSNP
rs982141916 491 dbSNP
rs927851223 502 dbSNP
rs550387938 506 dbSNP
rs1056886118 519 dbSNP
rs990752423 520 dbSNP
rs375969033 524 dbSNP
rs915030072 532 dbSNP
rs151030793 533 dbSNP
rs1405643034 543 dbSNP
rs1374262399 569 dbSNP
rs946578572 573 dbSNP
rs1306296706 577 dbSNP
rs1441043391 578 dbSNP
rs1042491200 591 dbSNP
rs1315087042 592 dbSNP
rs768541057 595 dbSNP
rs1261208666 597 dbSNP
rs1012838891 601 dbSNP
rs1358549369 603 dbSNP
rs1219961407 616 dbSNP
rs17092263 628 dbSNP
rs1050748832 632 dbSNP
rs890690798 651 dbSNP
rs969428369 665 dbSNP
rs1378736210 669 dbSNP
rs1007744787 682 dbSNP
rs1490393408 693 dbSNP
rs1190824500 695 dbSNP
rs1039277170 700 dbSNP
rs1219999950 711 dbSNP
rs1420328196 713 dbSNP
rs899288004 715 dbSNP
rs1161959781 723 dbSNP
rs1285368307 724 dbSNP
rs1381464003 729 dbSNP
rs1032452513 735 dbSNP
rs774349983 736 dbSNP
rs995053488 743 dbSNP
rs139481041 744 dbSNP
rs1272637543 745 dbSNP
rs988343297 754 dbSNP
rs923474222 755 dbSNP
rs1319999489 763 dbSNP
rs1417659464 770 dbSNP
rs556764979 775 dbSNP
rs549689254 776 dbSNP
rs115778717 784 dbSNP
rs941721423 802 dbSNP
rs575437330 817 dbSNP
rs959372676 832 dbSNP
rs1297701190 847 dbSNP
rs1243228506 852 dbSNP
rs1196235391 854 dbSNP
rs1487519634 856 dbSNP
rs1284782817 859 dbSNP
rs764969853 867 dbSNP
rs973037805 889 dbSNP
rs990701406 896 dbSNP
rs919041203 899 dbSNP
rs1371331477 907 dbSNP
rs1393210117 910 dbSNP
rs1218169694 917 dbSNP
rs1362515497 919 dbSNP
rs1271873447 923 dbSNP
rs1397840200 927 dbSNP
rs1339595078 929 dbSNP
rs187180327 951 dbSNP
rs538706519 955 dbSNP
rs929064184 960 dbSNP
rs1381881229 967 dbSNP
rs915165302 974 dbSNP
rs45565636 975 dbSNP
rs1413998188 984 dbSNP
rs114059600 986 dbSNP
rs1044350018 996 dbSNP
rs1477163829 997 dbSNP
rs1359742721 1005 dbSNP
rs904421266 1007 dbSNP
rs1189152331 1009 dbSNP
rs564109169 1010 dbSNP
rs1484009955 1014 dbSNP
rs190755584 1024 dbSNP
rs1032337964 1046 dbSNP
rs45625042 1054 dbSNP
rs1009659966 1057 dbSNP
rs1177256816 1060 dbSNP
rs1239334811 1068 dbSNP
rs1234942388 1069 dbSNP
rs139781758 1078 dbSNP
rs1302660585 1086 dbSNP
rs553358577 1089 dbSNP
rs954927845 1095 dbSNP
rs180811602 1096 dbSNP
rs1424731925 1099 dbSNP
rs1333509832 1103 dbSNP
rs1170095382 1106 dbSNP
rs1017893713 1107 dbSNP
rs1463602597 1113 dbSNP
rs963589585 1135 dbSNP
rs573195723 1137 dbSNP
rs1425943112 1140 dbSNP
rs1411099391 1143 dbSNP
rs1039688471 1144 dbSNP
rs1480790446 1146 dbSNP
rs899446368 1147 dbSNP
rs1239444992 1163 dbSNP
rs776752601 1165 dbSNP
rs1457234425 1171 dbSNP
rs562034112 1173 dbSNP
rs1273760697 1182 dbSNP
rs760087998 1183 dbSNP
rs1319707150 1186 dbSNP
rs1311822595 1189 dbSNP
rs529149397 1191 dbSNP
rs928950914 1203 dbSNP
rs992605010 1209 dbSNP
rs1444691373 1211 dbSNP
rs565109889 1212 dbSNP
rs1047914893 1220 dbSNP
rs376989778 1237 dbSNP
rs1003599322 1243 dbSNP
rs1419275487 1244 dbSNP
rs751408454 1253 dbSNP
rs1176185156 1255 dbSNP
rs6058058 1262 dbSNP
rs544338548 1263 dbSNP
rs1211556967 1268 dbSNP
rs1204611885 1276 dbSNP
rs562328682 1283 dbSNP
rs1216284465 1288 dbSNP
rs1264614396 1288 dbSNP
rs1461279548 1291 dbSNP
rs186151883 1295 dbSNP
rs968022184 1296 dbSNP
rs373926663 1312 dbSNP
rs978312830 1312 dbSNP
rs923776700 1330 dbSNP
rs1302142061 1338 dbSNP
rs373490889 1341 dbSNP
rs1389010677 1344 dbSNP
rs1030438164 1346 dbSNP
rs955222941 1350 dbSNP
rs529752491 1356 dbSNP
rs1417647459 1377 dbSNP
rs986482168 1384 dbSNP
rs1156459708 1386 dbSNP
rs865896503 1392 dbSNP
rs1418778163 1397 dbSNP
rs145002715 1399 dbSNP
rs566098631 1400 dbSNP
rs1018196585 1415 dbSNP
rs190003637 1416 dbSNP
rs1468266076 1426 dbSNP
rs573920798 1431 dbSNP
rs1026495195 1445 dbSNP
rs920825499 1446 dbSNP
rs950415562 1459 dbSNP
rs1286833869 1465 dbSNP
rs1256638328 1466 dbSNP
rs1301205874 1466 dbSNP
rs1342764929 1466 dbSNP
rs1400918512 1466 dbSNP
rs559799681 1466 dbSNP
rs1363676513 1467 dbSNP
rs992886736 1470 dbSNP
rs917044453 1480 dbSNP
rs1214744077 1481 dbSNP
rs1282217120 1482 dbSNP
rs930885742 1484 dbSNP
rs1173778400 1486 dbSNP
rs1320882616 1487 dbSNP
rs1224806752 1489 dbSNP
rs1265557679 1493 dbSNP
rs1048459887 1511 dbSNP
rs1376938921 1513 dbSNP
rs1171057914 1517 dbSNP
rs1215565459 1523 dbSNP
rs1260737934 1528 dbSNP
rs1240677366 1532 dbSNP
rs925782012 1543 dbSNP
rs1226665935 1544 dbSNP
rs1257155629 1545 dbSNP
rs868722890 1546 dbSNP
rs1482319022 1559 dbSNP
rs551459041 1581 dbSNP
rs1219764713 1590 dbSNP
rs11699147 1597 dbSNP
rs1276665370 1599 dbSNP
rs1056559533 1603 dbSNP
rs895266796 1611 dbSNP
rs945435314 1625 dbSNP
rs1012649051 1627 dbSNP
rs1400855452 1632 dbSNP
rs890426691 1636 dbSNP
rs1022319730 1638 dbSNP
rs552687841 1639 dbSNP
rs1421434655 1640 dbSNP
rs999422585 1646 dbSNP
rs1031345220 1650 dbSNP
rs1039094266 1652 dbSNP
rs537239713 1658 dbSNP
rs1475422510 1683 dbSNP
rs955171476 1687 dbSNP
rs994952685 1692 dbSNP
rs1440963100 1699 dbSNP
rs1346795144 1702 dbSNP
rs557489425 1709 dbSNP
rs1400347828 1710 dbSNP
rs577198155 1720 dbSNP
rs1026547694 1725 dbSNP
rs986627890 1727 dbSNP
rs1017963559 1731 dbSNP
rs963785380 1752 dbSNP
rs370932748 1753 dbSNP
rs974246921 1754 dbSNP
rs919572962 1757 dbSNP
rs1343194316 1768 dbSNP
rs1339548300 1777 dbSNP
rs1309306898 1785 dbSNP
rs1448387819 1789 dbSNP
rs1397958073 1794 dbSNP
rs1330600589 1801 dbSNP
rs1013957085 1805 dbSNP
rs1274887606 1806 dbSNP
rs1161290458 1814 dbSNP
rs929639270 1816 dbSNP
rs1346358882 1833 dbSNP
rs1223767376 1835 dbSNP
rs1384879910 1838 dbSNP
rs182537802 1855 dbSNP
rs1441637119 1858 dbSNP
rs1236811895 1859 dbSNP
rs908163787 1861 dbSNP
rs969713613 1862 dbSNP
rs939493311 1864 dbSNP
rs1208463631 1882 dbSNP
rs1217787658 1883 dbSNP
rs117324032 1884 dbSNP
rs185708928 1886 dbSNP
rs1374014321 1888 dbSNP
rs913184888 1894 dbSNP
rs1437078078 1897 dbSNP
rs1332795583 1901 dbSNP
rs1201722493 1902 dbSNP
rs895214522 1903 dbSNP
rs1404573602 1909 dbSNP
rs1365129598 1922 dbSNP
rs1159477507 1936 dbSNP
rs948140810 1943 dbSNP
rs1044213560 1944 dbSNP
rs1045669862 1948 dbSNP
rs73903603 1950 dbSNP
rs1478620210 1954 dbSNP
rs999939699 1955 dbSNP
rs1197134356 1960 dbSNP
rs190485335 1966 dbSNP
rs558885615 1975 dbSNP
rs1555285 1978 dbSNP
rs1351112641 1979 dbSNP
rs1363365129 1985 dbSNP
rs1219334618 1986 dbSNP
rs1007995382 1991 dbSNP
rs1273020835 1992 dbSNP
rs1435405571 1996 dbSNP
rs1323788397 2002 dbSNP
rs1334704300 2004 dbSNP
rs943354804 2011 dbSNP
rs544083675 2012 dbSNP
rs1278351372 2023 dbSNP
rs1402048616 2028 dbSNP
rs1358900661 2029 dbSNP
rs1158417858 2032 dbSNP
rs561089126 2033 dbSNP
rs1379682571 2034 dbSNP
rs1427794608 2038 dbSNP
rs945741736 2063 dbSNP
rs1480431717 2070 dbSNP
rs1424755976 2077 dbSNP
rs1196345358 2084 dbSNP
rs1487078657 2086 dbSNP
rs1210137846 2087 dbSNP
rs973814597 2090 dbSNP
rs754529539 2091 dbSNP
rs1241328275 2093 dbSNP
rs778663196 2103 dbSNP
rs982889936 2104 dbSNP
rs1047878272 2109 dbSNP
rs908111536 2113 dbSNP
rs1279816264 2117 dbSNP
rs746960976 2120 dbSNP
rs886576799 2122 dbSNP
rs1288519682 2127 dbSNP
rs386813684 2128 dbSNP
rs111401793 2129 dbSNP
rs112235148 2130 dbSNP
rs1437382846 2135 dbSNP
rs970144287 2136 dbSNP
rs567968670 2137 dbSNP
rs770879876 2141 dbSNP
rs1032799435 2146 dbSNP
rs1418265890 2155 dbSNP
rs1182079911 2158 dbSNP
rs1440194263 2170 dbSNP
rs1235212667 2172 dbSNP
rs1202520608 2176 dbSNP
rs760788155 2186 dbSNP
rs988524786 2188 dbSNP
rs1383209992 2191 dbSNP
rs1306706424 2194 dbSNP
rs1313237017 2195 dbSNP
rs1229084665 2196 dbSNP
rs879192530 2202 dbSNP
rs183779280 2210 dbSNP
rs955210826 2212 dbSNP
rs1452029966 2213 dbSNP
rs1401584248 2217 dbSNP
rs1333956254 2221 dbSNP
rs987135342 2224 dbSNP
rs1043780409 2226 dbSNP
rs531977696 2228 dbSNP
rs943388161 2233 dbSNP
rs551700317 2236 dbSNP
rs1330230365 2240 dbSNP
rs974713305 2254 dbSNP
rs188707878 2255 dbSNP
rs1411214248 2256 dbSNP
rs1182380163 2261 dbSNP
rs935330763 2263 dbSNP
rs1239540065 2277 dbSNP
rs531189776 2285 dbSNP
rs930738041 2292 dbSNP
rs146432675 2298 dbSNP
rs1223531495 2299 dbSNP
rs1052408391 2303 dbSNP
rs193268094 2306 dbSNP
rs1285018213 2311 dbSNP
rs1338910417 2316 dbSNP
rs1008068969 2319 dbSNP
rs906109738 2320 dbSNP
rs149085077 2327 dbSNP
rs899624371 2333 dbSNP
rs1294437875 2334 dbSNP
rs182449425 2335 dbSNP
rs892765383 2359 dbSNP
rs8184527 2367 dbSNP
rs539190837 2391 dbSNP
rs1419996531 2392 dbSNP
rs1381607248 2395 dbSNP
rs1020015798 2397 dbSNP
rs1187921837 2399 dbSNP
rs547091345 2401 dbSNP
rs371223838 2404 dbSNP
rs1169162749 2405 dbSNP
rs1267996557 2408 dbSNP
rs142372153 2411 dbSNP
rs1035332697 2412 dbSNP
rs1237003201 2417 dbSNP
rs776847148 2418 dbSNP
rs973928707 2422 dbSNP
rs6059869 2423 dbSNP
rs1302979246 2428 dbSNP
rs1400199396 2439 dbSNP
rs6059870 2455 dbSNP
rs1326098305 2461 dbSNP
rs371049888 2483 dbSNP
rs1280306306 2487 dbSNP
rs1295754752 2490 dbSNP
rs1318784813 2491 dbSNP
rs1452440727 2506 dbSNP
rs1378062996 2507 dbSNP
rs1178131104 2514 dbSNP
rs980034894 2519 dbSNP
rs983514730 2520 dbSNP
rs117939015 2522 dbSNP
rs1222971837 2524 dbSNP
rs1265629734 2528 dbSNP
rs775822059 2531 dbSNP
rs950300973 2532 dbSNP
rs1256727897 2537 dbSNP
rs759402655 2537 dbSNP
rs1052492078 2545 dbSNP
rs905990026 2546 dbSNP
rs763557574 2549 dbSNP
rs112780405 2553 dbSNP
rs944050329 2558 dbSNP
rs1039589353 2559 dbSNP
rs1219653522 2568 dbSNP
rs1341922027 2569 dbSNP
rs1292998659 2571 dbSNP
rs1260714303 2572 dbSNP
rs145651410 2583 dbSNP
rs1402277480 2585 dbSNP
rs1304125112 2591 dbSNP
rs892819205 2592 dbSNP
rs1263448182 2595 dbSNP
rs995333322 2597 dbSNP
rs1048732563 2598 dbSNP
rs138185573 2605 dbSNP
rs1399968072 2607 dbSNP
rs886958432 2608 dbSNP
rs574553266 2609 dbSNP
rs1173547667 2617 dbSNP
rs1427855170 2618 dbSNP
rs539986384 2619 dbSNP
rs1009893338 2625 dbSNP
rs1384754419 2632 dbSNP
rs112353302 2634 dbSNP
rs1428195652 2635 dbSNP
rs1380885248 2639 dbSNP
rs1300349704 2640 dbSNP
rs1341303006 2645 dbSNP
rs1256918903 2651 dbSNP
rs1404412628 2651 dbSNP
rs1308956379 2652 dbSNP
rs1320439853 2652 dbSNP
rs75946530 2652 dbSNP
rs1268844237 2662 dbSNP
rs1226209463 2663 dbSNP
rs1281405669 2665 dbSNP
rs1332780641 2667 dbSNP
rs1003939716 2671 dbSNP
rs1381863676 2675 dbSNP
rs1260040556 2676 dbSNP
rs890877354 2680 dbSNP
rs764404291 2682 dbSNP
rs1167152999 2686 dbSNP
rs1218500960 2686 dbSNP
rs1461638829 2687 dbSNP
rs1369295527 2690 dbSNP
rs1189635423 2694 dbSNP
rs1442858028 2706 dbSNP
rs1286301787 2710 dbSNP
rs1035439700 2714 dbSNP
rs1179795716 2717 dbSNP
rs1490073126 2722 dbSNP
rs1271281633 2725 dbSNP
rs1196679082 2742 dbSNP
rs1008512682 2746 dbSNP
rs959659463 2751 dbSNP
rs1012620889 2756 dbSNP
rs1266850067 2760 dbSNP
rs1243403598 2762 dbSNP
rs1018115921 2768 dbSNP
rs963808895 2769 dbSNP
rs995404012 2773 dbSNP
rs1023883832 2776 dbSNP
rs1333943241 2783 dbSNP
rs1200283875 2788 dbSNP
rs970075661 2789 dbSNP
rs1363717349 2791 dbSNP
rs1452104490 2795 dbSNP
rs1391633553 2801 dbSNP
rs201608283 2802 dbSNP
rs1160753109 2803 dbSNP
rs1361440581 2805 dbSNP
rs1026832080 2808 dbSNP
rs559808804 2819 dbSNP
rs1384661455 2828 dbSNP
rs1159370279 2829 dbSNP
rs1471418454 2839 dbSNP
rs979722914 2840 dbSNP
rs186799736 2850 dbSNP
rs983400226 2864 dbSNP
rs141428912 2871 dbSNP
rs971511750 2880 dbSNP
rs751928124 2882 dbSNP
rs1306272778 2890 dbSNP
rs1241717499 2891 dbSNP
rs1348387945 2913 dbSNP
rs6059873 2916 dbSNP
rs866279600 2919 dbSNP
rs937463085 2922 dbSNP
rs6120664 2936 dbSNP
rs1301113264 2943 dbSNP
rs1054740954 2946 dbSNP
rs975409227 2960 dbSNP
rs921178151 2962 dbSNP
rs1328332042 2964 dbSNP
rs6059874 2969 dbSNP
rs36118790 2978 dbSNP
rs1158484854 2982 dbSNP
rs1048324043 2987 dbSNP
rs1478671898 2990 dbSNP
rs945733769 2990 dbSNP
rs886901500 2999 dbSNP
rs1194683313 3002 dbSNP
rs1490071301 3007 dbSNP
rs939842179 3010 dbSNP
rs1056892162 3011 dbSNP
rs895605257 3012 dbSNP
rs1444771490 3015 dbSNP
rs1283010591 3017 dbSNP
rs1180920253 3022 dbSNP
rs191635249 3023 dbSNP
rs750504962 3025 dbSNP
rs1222694959 3030 dbSNP
rs184116188 3040 dbSNP
rs904209350 3041 dbSNP
rs530311510 3042 dbSNP
rs1343487678 3043 dbSNP
rs1317776411 3046 dbSNP
rs1276712441 3047 dbSNP
rs1408973065 3050 dbSNP
rs1174663026 3061 dbSNP
rs188871367 3069 dbSNP
rs956862785 3070 dbSNP
rs6088509 3071 dbSNP
rs539087241 3083 dbSNP
rs965462596 3090 dbSNP
rs1462557617 3091 dbSNP
rs1261191787 3095 dbSNP
rs138911493 3117 dbSNP
rs375264775 3120 dbSNP
rs1331920063 3131 dbSNP
rs1259808919 3134 dbSNP
rs1216518067 3141 dbSNP
rs927344895 3149 dbSNP
rs1381854145 3155 dbSNP
rs1243485576 3159 dbSNP
rs1314452269 3160 dbSNP
rs1321881644 3161 dbSNP
rs1226093987 3162 dbSNP
rs1335317806 3163 dbSNP
rs1345535141 3163 dbSNP
rs1469788041 3163 dbSNP
rs397865119 3163 dbSNP
rs5841079 3163 dbSNP
rs1249058009 3164 dbSNP
rs931331889 3165 dbSNP
rs79990511 3166 dbSNP
rs1240799704 3179 dbSNP
rs74430772 3180 dbSNP
rs914865332 3183 dbSNP
rs946283125 3193 dbSNP
rs984409807 3195 dbSNP
rs912241180 3196 dbSNP
rs1169982867 3202 dbSNP
rs943677532 3208 dbSNP
rs1272571041 3216 dbSNP
rs1247083656 3218 dbSNP
rs1039477392 3219 dbSNP
rs1421630086 3223 dbSNP
rs569222160 3224 dbSNP
rs1452506125 3233 dbSNP
rs1378328552 3240 dbSNP
rs1467245717 3248 dbSNP
rs1332029401 3251 dbSNP
rs939830846 3255 dbSNP
rs899576474 3256 dbSNP
rs1057009131 3263 dbSNP
rs567508705 3272 dbSNP
rs895667528 3292 dbSNP
rs1162411577 3297 dbSNP
rs985690876 3305 dbSNP
rs758385767 3320 dbSNP
rs1292954574 3326 dbSNP
rs886910148 3329 dbSNP
rs1218694335 3341 dbSNP
rs1247132326 3347 dbSNP
rs1004147907 3349 dbSNP
rs948429773 3352 dbSNP
rs375829018 3372 dbSNP
rs554846614 3380 dbSNP
rs1317984470 3384 dbSNP
rs1222631204 3394 dbSNP
rs1274994888 3396 dbSNP
rs1323367912 3399 dbSNP
rs367978207 3402 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|||||    |:|||||| 
Target 5' auuGCACCA---CCGCACUCCa 3'
1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000335574.5 | 3UTR | AUUGCACCACCGCACUCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*