miRTarBase - #MIRT574595 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol N4BP1   
Synonyms -
Description NEDD4 binding protein 1
Transcript NM_153029   
Expression
Putative miRNA Targets on N4BP1
3'UTR of N4BP1
(miRNA target sites are highlighted)
>N4BP1|NM_153029|3'UTR
   1 AGATTGTGCTGAGCGCTGAGCTTGCGCTCAGGGCTGGCTGATCAAACTCAAGCTCACACCTGTACCTGATGGGAATGAAC
  81 ATAATGTGAAGAAACTTATTTCCCAGTGTAAACGCAGTTGTACAGAAAAAAAATGTTTTGGGTATAAATCTGGGTTTTCA
 161 AAACCAGCTTTTTTCTATATATAAATTATGCTGCTATTACAGATTTAACATTTTCTGTTAAAGGAAAGTCTACATTTTCT
 241 GCCTGTTCAGAACTGTTTAATAGCAGTTACTCTTGAGTGTATTTACCTTTTTATGTTTTTTAAACTATTTTCCTTAAAGC
 321 CGAAAATATTGACAAATGGATATGGTTAGCCTTTATAAATAAATAAAAAAAAAAGTGTTGCTTTCTTAAGGAAAGCAAGA
 401 CGTCTTAAAGTATATTTTCTTGAGATGAGTATGTCCCATCACTACCATGAAGTGTGCTCACCCTTCCAGCCTCCTCTGCC
 481 CTCACCCCCGGAGTTAAAGTGGGTAAGAGTTGGTTTGTTCTGCAGTCTTTGGTTGGAGTGTTGTGAAAGTGGACCCGCGG
 561 TGCCACTAGATGGCACTTGGTGCCTAGCCATGGTGAATGACCAGGGCGAAGTTAGTCTCACAGAATACCAGGGCTAGAAG
 641 ACATCGTGGAGCCCATGGAGTCCCACCCTCCTTCCCCCTTCCACCCTGCGCAAAAGGGGACGGCCCAGTGTGCACGCCGT
 721 CCGGCCATGCCCACAGCCACAGCCACAGCTGAGGAGTGGCCGGGCAGGCAGCAGGCTCCCCAGCCAGGGCTTGACACGCC
 801 CACAGTCAGGGGCCTCCACATGCCTGGCCTGGCTCTGGAAGTCACGTCTTAGCTTCTGAACACCGTAGCGGGTTATGAGG
 881 AAGTTTAATGAAGAGCCCGGTCACTGTGGCCATCTTGTGTCCCCAACTGCAGGAGACGCCCTGATGTGGAGTTTGTACAG
 961 CTTTGCCAAAAAATGGTTTTCTATTCTCAAAAGTGACCCAAGCCAATAAATAGCATTAGTAGCTTCTGTGGGGGGATCCC
1041 AGAGCCCCTGTATTTATTTTCCCTGTGTTTGTCTCTAGTGTCCTCCTAAACAGCCTTTCCTGTGAGTCTTTCTCAGAATT
1121 GATATCTTAATATTGTCTGTTCTAGGTGTTGCCCAAATTCAGTGTCAGTGAAGTTCTTTTCCTGGGCAATCTTAACATCT
1201 TTACTCTTATTGTCTGGACCTTCAAAGGGCTTTGTATTTTACACCTGCGCCCCCAGGCTGCTCACAGTCGGCTTGCTGCC
1281 TGTCCTGCCTGTCCGGATCTTGTCTCCTAGTCCTGAGGAGCGGAGGCTGAGAACTCAGTGCTGGTTTGTAAATGGTGAGG
1361 GGACTTGGGGGCATCCCAGAGTGCTCCCTCCAGGCCTGCTTCTTGGTTTTGTTTGATCACTGCGTTCTTCAAGGGATGAA
1441 TCCAGAGCCCTCCATGAGGCCAAGCTTGTCCTTCAATCATGTTTCCTCTCAGATGCGTCCGTGATGCCTCCTAATGTGGA
1521 ACTGGTTGTCCATTGTTTGGGCCTATGGCCAAGTCACCCAGCTGTGGAAGCAGAGGTAGAAGACGAGGCCAGCCAGGAGG
1601 GCGACTTCAGTCACAGCTCCCATGCCTCAGCTTTGTACCTGTTTTCAAAAGCACAACTGAGGTGTGCGGGCTGGAGCTGT
1681 CTTGCAGTGATTCTGGCCTTCTGGCTCATGGTTCAGTCCAGCAGCCTGGCTGACCCACTATTTCTCCTCTGCTTCAGAGG
1761 AAACCCAGGAAATGCCCTTACTGCCAGGCTGAGTCTCCACCCATGCTGGTTGGTGCTGGCTAGGCTGAGGGGGCCACCAC
1841 TTTTCCTGGCTAGAAGCTACTTGACCTTTGATGTTTGAGTTCTGTAAGTCTTCGTGTTCTGACTTACTGCTTCAGAGGGA
1921 TTGGCCTGTCCCCTTTCCCTTTCTCGGCTATGGGAAGGAAGGATTGCTCATTGGTTGCCTTCATCAGTTACAGCATGAGA
2001 CGGAATTCATCATTCCTTCCGAAACCCCTGATATTTAATATTTAATATTTAAAAACCCAAATTATCAAACCATTAAGAAC
2081 TCATTACTGGTTCTCAGCCTCCTCCAGTACTAGCCTCAGTGTGGCTGCTGCATAAGTATCTGTAGCCTGTCTACCTCCTG
2161 CAGTGGGGCCGCTCGCCTCTTCCCTGTCTACTGCTCAGGCTCTCCCACTTCGTGGCATCCATGTAAAGTAGGTGGCAGGG
2241 CAGAGATGTCACTCTCATTCAACAGGGAGGATGTCTGTTGCTCAGAGAGGTTGTCCTGAGGGGCTGGGTGATTCCTGGGC
2321 CTACATTCTTCCCGAGGCTCCAGGCCGCTGTCTCTGGAAGTAAAAGAGCCTTGTCTGACCTTAATGCAAGCAGTCTGTTT
2401 GAACCCCTGTAGGCTGCATTCAGGAGACAGAAGGTGTCTGGGCCATCCTGGGCGGCCGGTCAGCGTTGCTAGGCAGGCTC
2481 GGCTGTCTGGCCGGGACTTGGGCCTGGGTGGCTTTTGAGACCAGTGAAGAAGGGAGAGCCGGCCTCATGCCGATGCGGCT
2561 TGTGGCACGGCTGGGATGTGAGGGAGGACTCAGATCTACACACAGAAACCCCTCTTCTCCCCGCCCTCCCCCAGCTCCTA
2641 CCTGCCTCCCACGCCTCAGGTGTGGCTGCCTGTGGGACCATCCCCCAACCCCTTTCCTCGCACCTCCTTGTCCTCACCCA
2721 GTTCCTGCAGTGTCTCTGACCCACGCCTCCCGCCTCCTGGCCGACTTGCCCAGGAGGTGTCTCTGGCTCACCTCCGTCTG
2801 TTCATCACCTTCCTCCCCAGTGTTTCCACTTATCTTGGATGTTTTAGATTGAAACAGCCTGATTCCCGGAAGAATCCTCT
2881 TCATTCATTGCTAGTGCTTCCCCTCACCTCCCACTCTCCACTTCCCAGTTTGCAAATGTGGCTTTCGCCCACCAAGTGAA
2961 AGCGGACTGAGAGCAGCCCTTGGGGACGGCCCGGTGCCTGGCTGCAAGGCCGCGCTGGGGCTCTGTCTTGGTGCACATGG
3041 CTTGACCGGACTTTCCCTGCTTCCCACCACTTCCCTCACTCCCAGACCTCCCTCATTCTTTTTGTCTCTTCTTTTTGCCT
3121 AAAGCCAGTCCTTAACACCCTATTCTTCCTCTGCAGGTGGCTTGCAGACTTTTCCCCACCTTTGGGGCTCGTGGTGGTGG
3201 AGAGGGCAGCTGGTGTTAAGAATGTAGGTTACCGGGCATGACCCGGCAGATGCTTGCCCAGTAGTTCTGGAGGAAGGCCC
3281 GGGAATCTGCAAATGAGCGCATTCCCCAGGCAGTTCCCATGCAGGTGATCCACGGACCACATGTTGAGAAACTGCAGTCA
3361 CCCTTAGGGCCACACCGTCCCTCTCCTCGCTGTCCCCTCTCTGTAGTGACTGGCCCTGACCTTCAGGAGTGCACTTTCCA
3441 CTCTACCAGGAAGCCCTATGACATCCTCAGGCTCCCCAGACCTGCAGCTTGCATGGGGCCCCTCCCTTCTTCCACACCCA
3521 CCCTCCGTATGGTCCCCTGCTCTGCCCTCGTGCTTTGCTGGCCCCTGCCCGCTACTCCCACTCTCAGACACCCAGGGGTG
3601 GTGGGCCCTAACTGGCTGGCCCCTCCCAGCGCTGCCCTCTGCCGTCCAGATGCTGCAGTGTGGCCAGATTTACCTTCCAG
3681 TAACATACTTCTAGTCACCCCTCCTCCTGCGAAGTGATCTGCAGTGGCTGTTTGACCAGACCACAAAGTTCACATCTCCT
3761 GAGCTTAGTGTCCGTGGCTGTCCACCTCCCAGCCATACTTGACTGTCCCCAAACTCTCCCTGCAGCCACATGTTTCCCAT
3841 GACCTGTGGGCTCTGCAGATGGACCTCTCTCCGCTAGAGATGCCCTTCTCCCAAATGGCTTCCCTCCTGGAAGGCCCAGC
3921 CTGAGTCCTCGTCTCCTTTCCAGTGCTTCTGCCAGAAGCATCCCCATGATGTTGTGACCGCACAGCACTTTGTGTCTCGC
4001 TTTGAGCACTTGCCACTCTGGCTGGTGCTGCTGCCACTGATTGTGTACTGTCTTGCTGCCCTTTCTAGACTGTGAGCTCC
4081 TCGTGGGCAGGGACCGCCTGTGTTCTCTGTATTTCCCACGGCGCCTAGCACAGTGCCTTGCACTTGATAGGTGCTTAATA
4161 AATGTCTGCTCAACTGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  ||||  ||||||| 
Target 5' atatataaATTA--TGCTGCTa 3'
177 - 196 150.00 -13.60
2
miRNA  3' guguuUGGUAAUA-----CACGACGAu 5'
               :||| | |     |||||||| 
Target 5' cacttGCCACTCTGGCTGGTGCTGCTg 3'
4007 - 4033 149.00 -18.60
3
miRNA  3' guGUUUGGUAAUACACGACGAu 5'
            :|||  |  | |||:|||| 
Target 5' aaTAAAAAAAAAAGTGTTGCTt 3'
362 - 383 140.00 -10.94
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31486436 11 COSMIC
COSN31541301 31 COSMIC
COSN30513173 59 COSMIC
COSN30495857 66 COSMIC
COSN31508384 94 COSMIC
COSN31578999 125 COSMIC
COSN31599928 129 COSMIC
COSN31571447 310 COSMIC
COSN20112853 365 COSMIC
COSN22601541 559 COSMIC
COSN30538642 583 COSMIC
COSN27062293 718 COSMIC
COSN23040166 868 COSMIC
COSN26538085 999 COSMIC
COSN31523742 1020 COSMIC
COSN29882032 1137 COSMIC
COSN15660764 1490 COSMIC
COSN31961201 1669 COSMIC
COSN17595682 1946 COSMIC
COSN21645943 2365 COSMIC
COSN22733965 2460 COSMIC
COSN21319961 2517 COSMIC
COSN15963465 2700 COSMIC
COSN24952877 2744 COSMIC
COSN24567041 2781 COSMIC
COSN21097649 2938 COSMIC
COSN28831396 3387 COSMIC
COSN16036767 3398 COSMIC
COSN2520834 3517 COSMIC
COSN8500389 3784 COSMIC
COSN1699035 3941 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1252841475 2 dbSNP
rs1296028702 5 dbSNP
rs778343070 8 dbSNP
rs758750465 12 dbSNP
rs753035562 13 dbSNP
rs11866667 14 dbSNP
rs372613628 15 dbSNP
rs570902054 18 dbSNP
rs1465567790 21 dbSNP
rs143735071 24 dbSNP
rs760739461 25 dbSNP
rs750417433 26 dbSNP
rs767432062 29 dbSNP
rs761517518 30 dbSNP
rs374398437 33 dbSNP
rs199782053 36 dbSNP
rs1408303743 41 dbSNP
rs762745952 43 dbSNP
rs775254121 49 dbSNP
rs1325437341 51 dbSNP
rs1370042535 53 dbSNP
rs1384421387 56 dbSNP
rs1431134742 58 dbSNP
rs1271891340 62 dbSNP
rs958017324 73 dbSNP
rs1032326222 75 dbSNP
rs1359701001 78 dbSNP
rs999394111 80 dbSNP
rs1182429368 90 dbSNP
rs966634631 91 dbSNP
rs1248341689 99 dbSNP
rs1176059811 107 dbSNP
rs765563693 113 dbSNP
rs780825866 114 dbSNP
rs886107696 120 dbSNP
rs1219849190 127 dbSNP
rs1475406031 133 dbSNP
rs1047899553 134 dbSNP
rs1189261432 134 dbSNP
rs866777172 134 dbSNP
rs949155782 135 dbSNP
rs1008066797 138 dbSNP
rs889511772 139 dbSNP
rs111733638 141 dbSNP
rs1401079777 142 dbSNP
rs1049507170 144 dbSNP
rs995284127 145 dbSNP
rs1319977846 146 dbSNP
rs1057279728 150 dbSNP
rs562047580 152 dbSNP
rs937532753 164 dbSNP
rs749637417 174 dbSNP
rs768052219 177 dbSNP
rs1230877516 180 dbSNP
rs746465465 184 dbSNP
rs1350863300 198 dbSNP
rs779874961 200 dbSNP
rs1282675224 210 dbSNP
rs548637554 223 dbSNP
rs1446751672 239 dbSNP
rs1212286244 248 dbSNP
rs1260166805 250 dbSNP
rs1484750358 253 dbSNP
rs202150105 260 dbSNP
rs979000244 261 dbSNP
rs80099509 266 dbSNP
rs1364718209 270 dbSNP
rs1157044961 275 dbSNP
rs1158869197 275 dbSNP
rs1455155160 276 dbSNP
rs940887903 281 dbSNP
rs1361953086 282 dbSNP
rs1418847185 284 dbSNP
rs913228734 294 dbSNP
rs1480460955 295 dbSNP
rs1377122296 296 dbSNP
rs1270497350 303 dbSNP
rs908126070 305 dbSNP
rs989260468 313 dbSNP
rs954800832 318 dbSNP
rs1030861519 320 dbSNP
rs370169012 321 dbSNP
rs1046975778 322 dbSNP
rs750256086 329 dbSNP
rs374923523 333 dbSNP
rs1016150706 337 dbSNP
rs949592483 339 dbSNP
rs916760926 343 dbSNP
rs1006149217 349 dbSNP
rs778656505 355 dbSNP
rs1262002804 356 dbSNP
rs1207224874 360 dbSNP
rs1485112403 364 dbSNP
rs958153357 365 dbSNP
rs562330817 368 dbSNP
rs377348736 374 dbSNP
rs1232473329 375 dbSNP
rs1396452663 375 dbSNP
rs3833064 375 dbSNP
rs796461419 375 dbSNP
rs1438891091 381 dbSNP
rs1173965762 385 dbSNP
rs545721341 401 dbSNP
rs896222371 402 dbSNP
rs978072172 407 dbSNP
rs1325751796 411 dbSNP
rs1171894460 414 dbSNP
rs1281516962 420 dbSNP
rs1396652971 427 dbSNP
rs532271708 428 dbSNP
rs966561657 429 dbSNP
rs1326480257 431 dbSNP
rs1375614434 442 dbSNP
rs1019549341 444 dbSNP
rs1008451585 448 dbSNP
rs111383244 449 dbSNP
rs906041812 451 dbSNP
rs1233211823 452 dbSNP
rs1252386315 454 dbSNP
rs1341593837 459 dbSNP
rs1028599089 462 dbSNP
rs1272572800 465 dbSNP
rs756384937 471 dbSNP
rs995253055 474 dbSNP
rs1195724966 482 dbSNP
rs553062956 489 dbSNP
rs933330000 490 dbSNP
rs880399 491 dbSNP
rs1373532517 493 dbSNP
rs1476110633 499 dbSNP
rs1165595469 500 dbSNP
rs1036659451 502 dbSNP
rs1398904667 511 dbSNP
rs1003898764 515 dbSNP
rs1461702347 522 dbSNP
rs1327468911 530 dbSNP
rs1392805103 535 dbSNP
rs879318329 537 dbSNP
rs886660929 538 dbSNP
rs539849142 556 dbSNP
rs767722107 557 dbSNP
rs574345729 558 dbSNP
rs1335512754 559 dbSNP
rs1215838854 564 dbSNP
rs1271450624 568 dbSNP
rs554383620 577 dbSNP
rs1208948100 582 dbSNP
rs950594682 583 dbSNP
rs1173549388 588 dbSNP
rs35633615 590 dbSNP
rs1430298291 591 dbSNP
rs544279833 593 dbSNP
rs1013220015 597 dbSNP
rs936723550 601 dbSNP
rs1479843945 607 dbSNP
rs960669120 608 dbSNP
rs111417610 614 dbSNP
rs1427081653 616 dbSNP
rs978042378 619 dbSNP
rs55950580 623 dbSNP
rs1289873184 624 dbSNP
rs1204855240 625 dbSNP
rs879550174 640 dbSNP
rs527798684 642 dbSNP
rs556789756 645 dbSNP
rs758395295 646 dbSNP
rs892019236 647 dbSNP
rs752888707 649 dbSNP
rs1340180060 650 dbSNP
rs1321287192 653 dbSNP
rs767035127 654 dbSNP
rs1272122332 656 dbSNP
rs1261162438 661 dbSNP
rs986717548 668 dbSNP
rs954139731 675 dbSNP
rs1028150487 676 dbSNP
rs1053799039 682 dbSNP
rs973903472 684 dbSNP
rs1294512532 687 dbSNP
rs35793171 687 dbSNP
rs1253663382 689 dbSNP
rs1422943363 692 dbSNP
rs1453104035 696 dbSNP
rs540174490 699 dbSNP
rs763534774 701 dbSNP
rs138897573 702 dbSNP
rs943430815 708 dbSNP
rs1015365277 714 dbSNP
rs554401062 715 dbSNP
rs369163945 716 dbSNP
rs1416714254 718 dbSNP
rs533962968 719 dbSNP
rs866905154 721 dbSNP
rs568410894 722 dbSNP
rs1013828345 723 dbSNP
rs534698051 725 dbSNP
rs755143910 728 dbSNP
rs1285230621 730 dbSNP
rs144562714 730 dbSNP
rs984609743 749 dbSNP
rs1235280288 750 dbSNP
rs1482628982 750 dbSNP
rs950541578 750 dbSNP
rs371877606 751 dbSNP
rs1252177389 759 dbSNP
rs1055182886 761 dbSNP
rs1438461578 762 dbSNP
rs114796388 770 dbSNP
rs1194164090 771 dbSNP
rs1437196173 772 dbSNP
rs1172281695 777 dbSNP
rs1033762762 778 dbSNP
rs1001850483 780 dbSNP
rs903920452 782 dbSNP
rs1444328623 784 dbSNP
rs1246372207 786 dbSNP
rs1308342303 795 dbSNP
rs1371417092 797 dbSNP
rs531809570 798 dbSNP
rs1276355780 801 dbSNP
rs1311134283 810 dbSNP
rs1384781262 814 dbSNP
rs1252714193 816 dbSNP
rs945476697 817 dbSNP
rs1456213292 818 dbSNP
rs762166363 820 dbSNP
rs570569965 821 dbSNP
rs1455838609 824 dbSNP
rs1011676821 832 dbSNP
rs113535394 844 dbSNP
rs551945313 845 dbSNP
rs1330248417 846 dbSNP
rs1172553436 850 dbSNP
rs1053340878 851 dbSNP
rs532136024 864 dbSNP
rs902132030 865 dbSNP
rs1394967852 867 dbSNP
rs552062748 870 dbSNP
rs560036106 877 dbSNP
rs796406028 893 dbSNP
rs189132859 897 dbSNP
rs1049190167 898 dbSNP
rs537283403 899 dbSNP
rs1197677972 905 dbSNP
rs879702493 906 dbSNP
rs1273373599 907 dbSNP
rs1470109155 917 dbSNP
rs1179698306 923 dbSNP
rs774947902 926 dbSNP
rs1188767289 931 dbSNP
rs7197732 937 dbSNP
rs992046592 938 dbSNP
rs1165934610 942 dbSNP
rs1361329338 943 dbSNP
rs1406902359 962 dbSNP
rs1289403553 965 dbSNP
rs1321399819 967 dbSNP
rs560916654 969 dbSNP
rs1431477732 974 dbSNP
rs1290544911 975 dbSNP
rs1351230952 976 dbSNP
rs1337791852 977 dbSNP
rs895378981 983 dbSNP
rs1439335771 992 dbSNP
rs1293560746 998 dbSNP
rs1336425492 1002 dbSNP
rs1033908589 1007 dbSNP
rs1289663068 1015 dbSNP
rs1317887803 1019 dbSNP
rs1349392775 1023 dbSNP
rs1001103375 1029 dbSNP
rs1406452138 1030 dbSNP
rs904011951 1031 dbSNP
rs980377734 1033 dbSNP
rs967706214 1036 dbSNP
rs544019351 1045 dbSNP
rs1401679711 1046 dbSNP
rs112671145 1052 dbSNP
rs1042575284 1056 dbSNP
rs987859356 1057 dbSNP
rs36125839 1064 dbSNP
rs1160387775 1065 dbSNP
rs1358499887 1077 dbSNP
rs945474611 1078 dbSNP
rs536918296 1079 dbSNP
rs1469660371 1080 dbSNP
rs1341704257 1082 dbSNP
rs745791559 1091 dbSNP
rs1351858821 1094 dbSNP
rs575398383 1095 dbSNP
rs997717755 1098 dbSNP
rs902080075 1099 dbSNP
rs1430152026 1102 dbSNP
rs1017882887 1108 dbSNP
rs1007539942 1109 dbSNP
rs887777691 1110 dbSNP
rs1201848719 1114 dbSNP
rs183997007 1119 dbSNP
rs1268456426 1122 dbSNP
rs191517090 1126 dbSNP
rs1174177141 1131 dbSNP
rs1056689242 1139 dbSNP
rs1335933355 1142 dbSNP
rs1448508096 1146 dbSNP
rs1220508173 1151 dbSNP
rs766662339 1176 dbSNP
rs1307584690 1178 dbSNP
rs1376623198 1182 dbSNP
rs1235745041 1183 dbSNP
rs921293561 1186 dbSNP
rs577487150 1189 dbSNP
rs1199901255 1190 dbSNP
rs1286235763 1200 dbSNP
rs548083428 1202 dbSNP
rs941295084 1204 dbSNP
rs1196947029 1205 dbSNP
rs1236205972 1206 dbSNP
rs908365034 1208 dbSNP
rs1438832871 1210 dbSNP
rs982617758 1211 dbSNP
rs971130386 1215 dbSNP
rs368301343 1217 dbSNP
rs757015590 1220 dbSNP
rs529211481 1225 dbSNP
rs1396555665 1236 dbSNP
rs914902988 1248 dbSNP
rs991144333 1249 dbSNP
rs1224824312 1250 dbSNP
rs1400045493 1255 dbSNP
rs1442014093 1258 dbSNP
rs958604818 1269 dbSNP
rs1343210399 1270 dbSNP
rs1292603220 1275 dbSNP
rs1032665693 1287 dbSNP
rs1320084909 1291 dbSNP
rs781302562 1294 dbSNP
rs1257595301 1295 dbSNP
rs1347352397 1296 dbSNP
rs1214041485 1298 dbSNP
rs1316834457 1302 dbSNP
rs1269178413 1303 dbSNP
rs1457236081 1308 dbSNP
rs1449835746 1318 dbSNP
rs968305925 1321 dbSNP
rs150262007 1322 dbSNP
rs1010154185 1334 dbSNP
rs1373206344 1337 dbSNP
rs1478483818 1354 dbSNP
rs1178598158 1355 dbSNP
rs1168100611 1356 dbSNP
rs1479516810 1362 dbSNP
rs746015816 1365 dbSNP
rs1422421223 1368 dbSNP
rs1462313053 1370 dbSNP
rs1017828970 1371 dbSNP
rs891180951 1375 dbSNP
rs1051601708 1379 dbSNP
rs768133597 1387 dbSNP
rs996964217 1388 dbSNP
rs899830884 1399 dbSNP
rs1319536393 1400 dbSNP
rs888062803 1413 dbSNP
rs866589528 1418 dbSNP
rs1475601497 1423 dbSNP
rs1038411685 1424 dbSNP
rs1213400919 1430 dbSNP
rs142618007 1450 dbSNP
rs1267066007 1464 dbSNP
rs1353978186 1471 dbSNP
rs1263711376 1474 dbSNP
rs1263730465 1478 dbSNP
rs908459979 1479 dbSNP
rs1190813807 1491 dbSNP
rs1046869439 1496 dbSNP
rs1475353056 1497 dbSNP
rs949937894 1500 dbSNP
rs1367144710 1506 dbSNP
rs917120398 1507 dbSNP
rs991631806 1525 dbSNP
rs1300125673 1527 dbSNP
rs958488168 1532 dbSNP
rs1214860878 1533 dbSNP
rs554945901 1535 dbSNP
rs1268732121 1538 dbSNP
rs138868971 1540 dbSNP
rs939142548 1545 dbSNP
rs1418388921 1547 dbSNP
rs905042636 1560 dbSNP
rs925614058 1563 dbSNP
rs1356174249 1571 dbSNP
rs1398067972 1578 dbSNP
rs187435686 1584 dbSNP
rs915180961 1585 dbSNP
rs1442207518 1591 dbSNP
rs968233769 1598 dbSNP
rs1339298922 1600 dbSNP
rs1355826396 1602 dbSNP
rs1214318439 1603 dbSNP
rs1284769334 1614 dbSNP
rs1021174761 1615 dbSNP
rs374371592 1619 dbSNP
rs1009848553 1621 dbSNP
rs1253554777 1624 dbSNP
rs1423622893 1625 dbSNP
rs1183051336 1626 dbSNP
rs1382525390 1627 dbSNP
rs1158561367 1630 dbSNP
rs1171392018 1630 dbSNP
rs955708207 1632 dbSNP
rs935025536 1640 dbSNP
rs1467590278 1646 dbSNP
rs1029867744 1648 dbSNP
rs1401706101 1651 dbSNP
rs370502581 1656 dbSNP
rs899925384 1659 dbSNP
rs1038339037 1662 dbSNP
rs1378829954 1664 dbSNP
rs184242566 1667 dbSNP
rs751642569 1668 dbSNP
rs886997057 1682 dbSNP
rs1047410427 1685 dbSNP
rs1211562419 1686 dbSNP
rs372223785 1687 dbSNP
rs1482748909 1697 dbSNP
rs1198882441 1698 dbSNP
rs1448665154 1702 dbSNP
rs1243652664 1707 dbSNP
rs1178575350 1713 dbSNP
rs1185385003 1717 dbSNP
rs966165420 1718 dbSNP
rs3760017 1723 dbSNP
rs986335912 1728 dbSNP
rs1462746530 1730 dbSNP
rs766557599 1740 dbSNP
rs551119151 1741 dbSNP
rs759044617 1756 dbSNP
rs937060331 1757 dbSNP
rs925709684 1761 dbSNP
rs146928987 1774 dbSNP
rs1220848251 1775 dbSNP
rs1204626865 1777 dbSNP
rs945701570 1798 dbSNP
rs993885390 1800 dbSNP
rs1218878807 1808 dbSNP
rs1259518193 1810 dbSNP
rs867104067 1811 dbSNP
rs1308831488 1813 dbSNP
rs1198353590 1819 dbSNP
rs962074794 1821 dbSNP
rs1489777670 1832 dbSNP
rs560438346 1838 dbSNP
rs750976666 1840 dbSNP
rs1424618913 1841 dbSNP
rs1478154291 1855 dbSNP
rs765778276 1865 dbSNP
rs546605978 1866 dbSNP
rs1228067130 1874 dbSNP
rs1421699353 1879 dbSNP
rs1463886307 1882 dbSNP
rs529995047 1884 dbSNP
rs762103765 1885 dbSNP
rs1384057223 1886 dbSNP
rs988794589 1887 dbSNP
rs905327125 1893 dbSNP
rs955680278 1894 dbSNP
rs1317744123 1897 dbSNP
rs1244663669 1903 dbSNP
rs1291657380 1905 dbSNP
rs1010721855 1915 dbSNP
rs1400037152 1919 dbSNP
rs1030210344 1931 dbSNP
rs1052381622 1939 dbSNP
rs1315731460 1945 dbSNP
rs1039341 1946 dbSNP
rs1323864340 1950 dbSNP
rs1220015147 1951 dbSNP
rs370403106 1952 dbSNP
rs1488674741 1957 dbSNP
rs1195870115 1963 dbSNP
rs964100540 1964 dbSNP
rs1477657923 1965 dbSNP
rs1182656485 1970 dbSNP
rs1414278703 1987 dbSNP
rs1406812231 1992 dbSNP
rs763692021 1995 dbSNP
rs1017042965 1996 dbSNP
rs74372789 2001 dbSNP
rs760351561 2002 dbSNP
rs1025683036 2009 dbSNP
rs1337766765 2012 dbSNP
rs1168249175 2016 dbSNP
rs774057803 2020 dbSNP
rs775037861 2021 dbSNP
rs1226921229 2026 dbSNP
rs895743317 2030 dbSNP
rs1055998011 2034 dbSNP
rs986270969 2041 dbSNP
rs1355103386 2048 dbSNP
rs757305050 2053 dbSNP
rs952210565 2053 dbSNP
rs937195960 2055 dbSNP
rs1487972573 2056 dbSNP
rs920807542 2058 dbSNP
rs1239392130 2060 dbSNP
rs1473669393 2065 dbSNP
rs972351039 2067 dbSNP
rs1165376467 2077 dbSNP
rs1421920749 2078 dbSNP
rs1440310263 2080 dbSNP
rs1160369124 2088 dbSNP
rs1255394960 2095 dbSNP
rs771565605 2096 dbSNP
rs1481342693 2098 dbSNP
rs189200899 2101 dbSNP
rs1399541585 2104 dbSNP
rs564996358 2105 dbSNP
rs1334432317 2117 dbSNP
rs1360483928 2118 dbSNP
rs1445323621 2124 dbSNP
rs1314876262 2125 dbSNP
rs1042766941 2128 dbSNP
rs945837299 2138 dbSNP
rs912880233 2147 dbSNP
rs1307630367 2151 dbSNP
rs987162135 2161 dbSNP
rs1353117294 2162 dbSNP
rs1201060656 2165 dbSNP
rs1280803028 2169 dbSNP
rs934196730 2170 dbSNP
rs922896294 2171 dbSNP
rs975549026 2174 dbSNP
rs763724067 2175 dbSNP
rs1308365491 2177 dbSNP
rs1039340 2178 dbSNP
rs1017138601 2179 dbSNP
rs1307648515 2190 dbSNP
rs386790520 2191 dbSNP
rs1405840001 2192 dbSNP
rs1010670950 2194 dbSNP
rs1172703700 2200 dbSNP
rs1426621252 2202 dbSNP
rs1412462579 2207 dbSNP
rs577550906 2211 dbSNP
rs1367692249 2228 dbSNP
rs984202981 2239 dbSNP
rs183841382 2241 dbSNP
rs1449411530 2245 dbSNP
rs1329937773 2252 dbSNP
rs560718571 2254 dbSNP
rs540616730 2255 dbSNP
rs1456230533 2257 dbSNP
rs1052745976 2267 dbSNP
rs1223147667 2270 dbSNP
rs1258880496 2279 dbSNP
rs1026034853 2282 dbSNP
rs1367775060 2306 dbSNP
rs1159809055 2307 dbSNP
rs1236109833 2310 dbSNP
rs1014261410 2315 dbSNP
rs1437203744 2316 dbSNP
rs1199477169 2325 dbSNP
rs895700956 2333 dbSNP
rs1034285354 2334 dbSNP
rs528544383 2335 dbSNP
rs1001429822 2337 dbSNP
rs575068258 2346 dbSNP
rs1466844564 2347 dbSNP
rs770863361 2352 dbSNP
rs1396221554 2361 dbSNP
rs749078244 2369 dbSNP
rs1009905348 2370 dbSNP
rs1326042107 2382 dbSNP
rs1040695436 2389 dbSNP
rs1270634605 2390 dbSNP
rs1404367625 2394 dbSNP
rs1279099312 2395 dbSNP
rs891545788 2404 dbSNP
rs1051843169 2406 dbSNP
rs1320328405 2413 dbSNP
rs1216994533 2415 dbSNP
rs933014389 2417 dbSNP
rs942358431 2424 dbSNP
rs751752916 2434 dbSNP
rs889517916 2434 dbSNP
rs1210366985 2436 dbSNP
rs1048177250 2449 dbSNP
rs376629070 2453 dbSNP
rs551563688 2454 dbSNP
rs1488385927 2457 dbSNP
rs942972763 2458 dbSNP
rs930767180 2464 dbSNP
rs554925056 2465 dbSNP
rs1165541077 2469 dbSNP
rs1241889840 2480 dbSNP
rs547113152 2481 dbSNP
rs775289114 2492 dbSNP
rs928233966 2493 dbSNP
rs1295045538 2495 dbSNP
rs982048271 2497 dbSNP
rs969376760 2505 dbSNP
rs1224204554 2510 dbSNP
rs575198901 2511 dbSNP
rs1357244800 2517 dbSNP
rs1281645840 2531 dbSNP
rs989532173 2540 dbSNP
rs918699497 2541 dbSNP
rs993210571 2542 dbSNP
rs375310011 2544 dbSNP
rs538725183 2546 dbSNP
rs566596378 2548 dbSNP
rs958396341 2552 dbSNP
rs1030830918 2554 dbSNP
rs999787641 2555 dbSNP
rs3743778 2556 dbSNP
rs1019562820 2557 dbSNP
rs1386377353 2564 dbSNP
rs1157686810 2565 dbSNP
rs1480490628 2566 dbSNP
rs1430946591 2567 dbSNP
rs1001397206 2568 dbSNP
rs1432962264 2569 dbSNP
rs1262936988 2580 dbSNP
rs968611138 2582 dbSNP
rs1207271380 2587 dbSNP
rs1463879391 2588 dbSNP
rs1268083581 2590 dbSNP
rs1021374512 2591 dbSNP
rs1245429397 2591 dbSNP
rs1204335285 2593 dbSNP
rs1325818651 2595 dbSNP
rs1254455556 2601 dbSNP
rs1232894989 2602 dbSNP
rs1010088663 2605 dbSNP
rs1006522604 2607 dbSNP
rs1245166701 2611 dbSNP
rs1309804462 2614 dbSNP
rs1355266354 2617 dbSNP
rs533396906 2620 dbSNP
rs372117047 2622 dbSNP
rs1048126973 2623 dbSNP
rs1201812370 2626 dbSNP
rs1319864442 2631 dbSNP
rs1461100373 2633 dbSNP
rs997699438 2634 dbSNP
rs931050416 2640 dbSNP
rs868280307 2641 dbSNP
rs567552833 2652 dbSNP
rs1038753725 2653 dbSNP
rs942896308 2659 dbSNP
rs910141437 2660 dbSNP
rs1483950909 2669 dbSNP
rs1301259219 2674 dbSNP
rs1403639013 2678 dbSNP
rs1170429078 2679 dbSNP
rs1465178011 2682 dbSNP
rs375108940 2685 dbSNP
rs1331983451 2687 dbSNP
rs1379088408 2688 dbSNP
rs1389569388 2690 dbSNP
rs1195725594 2699 dbSNP
rs928212488 2701 dbSNP
rs1312246569 2704 dbSNP
rs1234975677 2713 dbSNP
rs930174570 2716 dbSNP
rs1323303981 2717 dbSNP
rs1199721789 2720 dbSNP
rs1448072836 2727 dbSNP
rs1479982896 2728 dbSNP
rs79562236 2729 dbSNP
rs1268166173 2732 dbSNP
rs1184798182 2737 dbSNP
rs1174584288 2738 dbSNP
rs564860874 2744 dbSNP
rs1171169911 2745 dbSNP
rs1276661555 2750 dbSNP
rs1199957038 2751 dbSNP
rs960432976 2752 dbSNP
rs1253334006 2762 dbSNP
rs927261814 2763 dbSNP
rs1339849410 2764 dbSNP
rs989478565 2769 dbSNP
rs1453358268 2774 dbSNP
rs3743779 2775 dbSNP
rs1280787696 2778 dbSNP
rs1031531659 2782 dbSNP
rs1218856962 2785 dbSNP
rs1260459001 2787 dbSNP
rs1331547083 2789 dbSNP
rs1306070619 2791 dbSNP
rs968583082 2792 dbSNP
rs1021510099 2795 dbSNP
rs111862754 2796 dbSNP
rs955879403 2800 dbSNP
rs1489518283 2801 dbSNP
rs1197423020 2808 dbSNP
rs1268229678 2808 dbSNP
rs758560380 2809 dbSNP
rs1478307334 2810 dbSNP
rs1196095451 2813 dbSNP
rs1428189784 2816 dbSNP
rs997269122 2823 dbSNP
rs560562989 2830 dbSNP
rs186599881 2832 dbSNP
rs1169686657 2833 dbSNP
rs574890197 2835 dbSNP
rs561649723 2839 dbSNP
rs1019509085 2844 dbSNP
rs1300821919 2848 dbSNP
rs1446912231 2856 dbSNP
rs1017242645 2857 dbSNP
rs1005911420 2860 dbSNP
rs888674345 2867 dbSNP
rs1048628758 2868 dbSNP
rs889748641 2869 dbSNP
rs151157712 2877 dbSNP
rs531157882 2890 dbSNP
rs1324066965 2893 dbSNP
rs575263705 2895 dbSNP
rs1291203216 2900 dbSNP
rs779591331 2901 dbSNP
rs1252888748 2903 dbSNP
rs1240527815 2910 dbSNP
rs897312168 2911 dbSNP
rs1037205257 2918 dbSNP
rs1414250194 2920 dbSNP
rs1446439290 2920 dbSNP
rs1273572008 2925 dbSNP
rs1005010429 2927 dbSNP
rs796425351 2933 dbSNP
rs1319902084 2934 dbSNP
rs374271769 2938 dbSNP
rs538785177 2946 dbSNP
rs927399548 2947 dbSNP
rs1282375279 2950 dbSNP
rs980044034 2954 dbSNP
rs1243409246 2955 dbSNP
rs1381778349 2955 dbSNP
rs1244437602 2957 dbSNP
rs573293565 2963 dbSNP
rs916853046 2964 dbSNP
rs914597411 2965 dbSNP
rs553142363 2976 dbSNP
rs1407678644 2983 dbSNP
rs936687311 2987 dbSNP
rs988743218 2990 dbSNP
rs1426984797 2992 dbSNP
rs536467507 2993 dbSNP
rs1030130916 3007 dbSNP
rs1237858439 3009 dbSNP
rs1181713342 3011 dbSNP
rs976324344 3012 dbSNP
rs1470550061 3013 dbSNP
rs1405153741 3014 dbSNP
rs1399812570 3027 dbSNP
rs754201477 3039 dbSNP
rs770941232 3047 dbSNP
rs562835314 3048 dbSNP
rs1450857758 3054 dbSNP
rs1006005072 3055 dbSNP
rs1180125066 3055 dbSNP
rs1378346628 3057 dbSNP
rs1444985187 3058 dbSNP
rs1482811599 3063 dbSNP
rs1349978329 3067 dbSNP
rs1269904524 3070 dbSNP
rs887425627 3079 dbSNP
rs1222886414 3084 dbSNP
rs1026432456 3088 dbSNP
rs994394827 3094 dbSNP
rs1287609134 3095 dbSNP
rs142119700 3098 dbSNP
rs746970305 3108 dbSNP
rs1201585076 3110 dbSNP
rs1350753660 3115 dbSNP
rs1289617878 3117 dbSNP
rs1183881888 3120 dbSNP
rs1230692254 3125 dbSNP
rs1469121948 3139 dbSNP
rs1172831011 3142 dbSNP
rs1430909711 3146 dbSNP
rs1057275074 3148 dbSNP
rs1467875881 3153 dbSNP
rs1176244738 3155 dbSNP
rs1401465860 3159 dbSNP
rs985316607 3161 dbSNP
rs764508116 3169 dbSNP
rs1335283164 3174 dbSNP
rs563782091 3180 dbSNP
rs1285250771 3185 dbSNP
rs1343913862 3186 dbSNP
rs550929725 3190 dbSNP
rs371066972 3191 dbSNP
rs537323964 3193 dbSNP
rs571313743 3194 dbSNP
rs961335058 3196 dbSNP
rs1015307359 3200 dbSNP
rs1323461341 3207 dbSNP
rs1199005510 3208 dbSNP
rs989227865 3212 dbSNP
rs1003025427 3213 dbSNP
rs1479285688 3214 dbSNP
rs79918830 3233 dbSNP
rs78515149 3234 dbSNP
rs1424797504 3237 dbSNP
rs923199438 3244 dbSNP
rs759077669 3245 dbSNP
rs1166688588 3246 dbSNP
rs780004994 3262 dbSNP
rs964530020 3265 dbSNP
rs528035147 3267 dbSNP
rs565771881 3279 dbSNP
rs1017474897 3280 dbSNP
rs773818593 3281 dbSNP
rs1430215048 3298 dbSNP
rs148656106 3299 dbSNP
rs1025938049 3300 dbSNP
rs770820237 3301 dbSNP
rs1478885895 3302 dbSNP
rs1244825941 3305 dbSNP
rs1268172912 3307 dbSNP
rs895371893 3311 dbSNP
rs530351420 3312 dbSNP
rs762931467 3325 dbSNP
rs756427217 3333 dbSNP
rs1447444449 3334 dbSNP
rs1489600683 3335 dbSNP
rs1221326765 3336 dbSNP
rs1036339540 3342 dbSNP
rs1269975769 3344 dbSNP
rs1003101988 3352 dbSNP
rs906038318 3362 dbSNP
rs1191540754 3375 dbSNP
rs1372859093 3376 dbSNP
rs1473443225 3376 dbSNP
rs772944241 3377 dbSNP
rs1011583595 3379 dbSNP
rs9941275 3387 dbSNP
rs1220651459 3388 dbSNP
rs79102905 3389 dbSNP
rs1387476017 3393 dbSNP
rs1380742208 3394 dbSNP
rs912683004 3396 dbSNP
rs934673161 3397 dbSNP
rs1274561332 3398 dbSNP
rs1325577199 3401 dbSNP
rs923328259 3403 dbSNP
rs1246629792 3406 dbSNP
rs780450624 3419 dbSNP
rs1317030413 3423 dbSNP
rs1431966161 3424 dbSNP
rs1244673131 3431 dbSNP
rs1040298443 3438 dbSNP
rs1319190466 3444 dbSNP
rs1456744669 3445 dbSNP
rs1486679203 3450 dbSNP
rs1202988037 3454 dbSNP
rs1407016588 3456 dbSNP
rs943308367 3458 dbSNP
rs919800550 3460 dbSNP
rs1412930199 3464 dbSNP
rs910351183 3471 dbSNP
rs961349684 3472 dbSNP
rs984624177 3474 dbSNP
rs1365593712 3477 dbSNP
rs1015672632 3481 dbSNP
rs1475632533 3485 dbSNP
rs1158144092 3486 dbSNP
rs951749641 3488 dbSNP
rs541053328 3503 dbSNP
rs971868109 3506 dbSNP
rs1380549804 3513 dbSNP
rs1464037502 3517 dbSNP
rs1243157446 3524 dbSNP
rs565195052 3526 dbSNP
rs779031580 3527 dbSNP
rs895327494 3530 dbSNP
rs1206021061 3539 dbSNP
rs145014288 3549 dbSNP
rs778074961 3550 dbSNP
rs1417357157 3557 dbSNP
rs1296044121 3567 dbSNP
rs756484837 3570 dbSNP
rs573124864 3571 dbSNP
rs1178411114 3576 dbSNP
rs891194600 3580 dbSNP
rs1469239363 3581 dbSNP
rs1298607493 3584 dbSNP
rs1374916208 3586 dbSNP
rs1389125792 3590 dbSNP
rs1305646884 3596 dbSNP
rs1345794728 3598 dbSNP
rs1384204816 3599 dbSNP
rs1049841671 3602 dbSNP
rs932437484 3603 dbSNP
rs919745155 3608 dbSNP
rs973970155 3609 dbSNP
rs1205870641 3610 dbSNP
rs939913704 3618 dbSNP
rs531197889 3619 dbSNP
rs1011719207 3620 dbSNP
rs1195344392 3622 dbSNP
rs1269695682 3624 dbSNP
rs1171454589 3629 dbSNP
rs981484089 3630 dbSNP
rs1391840782 3633 dbSNP
rs971054515 3635 dbSNP
rs1432340534 3636 dbSNP
rs1022637297 3637 dbSNP
rs542740884 3643 dbSNP
rs1053602398 3644 dbSNP
rs1297167203 3647 dbSNP
rs991191658 3649 dbSNP
rs1183044629 3652 dbSNP
rs1482015036 3653 dbSNP
rs1236500271 3656 dbSNP
rs1345300814 3658 dbSNP
rs998974938 3665 dbSNP
rs1204858162 3668 dbSNP
rs901839757 3669 dbSNP
rs957158501 3671 dbSNP
rs1272863095 3675 dbSNP
rs1032906530 3681 dbSNP
rs1490841115 3688 dbSNP
rs1220570977 3701 dbSNP
rs1268383918 3702 dbSNP
rs1001071093 3709 dbSNP
rs576846549 3710 dbSNP
rs182699466 3711 dbSNP
rs1426720721 3717 dbSNP
rs910487309 3719 dbSNP
rs1385348321 3721 dbSNP
rs557192046 3725 dbSNP
rs1048894974 3726 dbSNP
rs930458824 3727 dbSNP
rs1348986741 3730 dbSNP
rs142229427 3731 dbSNP
rs1431011413 3731 dbSNP
rs919120453 3735 dbSNP
rs1291063410 3737 dbSNP
rs61399205 3738 dbSNP
rs1214499078 3739 dbSNP
rs1316292850 3745 dbSNP
rs898603596 3746 dbSNP
rs1038598576 3750 dbSNP
rs939881996 3751 dbSNP
rs1317818672 3760 dbSNP
rs1298944709 3764 dbSNP
rs960519931 3767 dbSNP
rs1411836438 3768 dbSNP
rs1484748339 3770 dbSNP
rs571575032 3773 dbSNP
rs558037656 3774 dbSNP
rs368575178 3781 dbSNP
rs970260818 3782 dbSNP
rs908305235 3784 dbSNP
rs915575553 3785 dbSNP
rs1412433564 3786 dbSNP
rs1400949649 3789 dbSNP
rs991139276 3801 dbSNP
rs79435406 3807 dbSNP
rs35325345 3811 dbSNP
rs1434758495 3814 dbSNP
rs1337773595 3817 dbSNP
rs1385670988 3819 dbSNP
rs1451089171 3820 dbSNP
rs1166875758 3826 dbSNP
rs1374075556 3828 dbSNP
rs750413608 3832 dbSNP
rs1282364407 3833 dbSNP
rs71382727 3835 dbSNP
rs1207925144 3838 dbSNP
rs957755092 3839 dbSNP
rs1182290754 3840 dbSNP
rs1462645354 3843 dbSNP
rs1181620640 3850 dbSNP
rs925741206 3860 dbSNP
rs1470159955 3861 dbSNP
rs1178594290 3867 dbSNP
rs1473332838 3870 dbSNP
rs190101666 3872 dbSNP
rs879910927 3872 dbSNP
rs549088339 3873 dbSNP
rs1490629889 3874 dbSNP
rs1021589232 3877 dbSNP
rs901927639 3886 dbSNP
rs767196151 3890 dbSNP
rs1267725162 3891 dbSNP
rs1008475393 3894 dbSNP
rs1018932234 3914 dbSNP
rs955644908 3915 dbSNP
rs1028308125 3929 dbSNP
rs1007576054 3930 dbSNP
rs1307707854 3940 dbSNP
rs1224344635 3943 dbSNP
rs1283706753 3946 dbSNP
rs889147671 3948 dbSNP
rs1348804655 3953 dbSNP
rs1277765594 3966 dbSNP
rs759165494 3968 dbSNP
rs930616192 3972 dbSNP
rs1408955943 3976 dbSNP
rs528975293 3979 dbSNP
rs897643937 3980 dbSNP
rs1391266055 3982 dbSNP
rs1036205697 3986 dbSNP
rs1295203361 3991 dbSNP
rs1172336870 3994 dbSNP
rs1224 3998 dbSNP
rs1412128572 3999 dbSNP
rs1327003925 4005 dbSNP
rs1045581407 4010 dbSNP
rs1349233890 4016 dbSNP
rs927737575 4019 dbSNP
rs949953504 4021 dbSNP
rs773868487 4028 dbSNP
rs947712193 4031 dbSNP
rs915858569 4032 dbSNP
rs1230852805 4036 dbSNP
rs550771564 4040 dbSNP
rs762568325 4042 dbSNP
rs1253246570 4043 dbSNP
rs1216240686 4055 dbSNP
rs990806623 4056 dbSNP
rs1482403724 4060 dbSNP
rs1222799453 4064 dbSNP
rs957681167 4065 dbSNP
rs1198684892 4075 dbSNP
rs1489703039 4075 dbSNP
rs1032224767 4076 dbSNP
rs1458383604 4078 dbSNP
rs1409283862 4080 dbSNP
rs765905870 4082 dbSNP
rs530963763 4083 dbSNP
rs925655565 4085 dbSNP
rs565258063 4086 dbSNP
rs545342070 4087 dbSNP
rs977207903 4088 dbSNP
rs1386418281 4089 dbSNP
rs1322715055 4093 dbSNP
rs1326743685 4094 dbSNP
rs186171697 4096 dbSNP
rs559468063 4099 dbSNP
rs762300104 4108 dbSNP
rs1353894104 4109 dbSNP
rs1028592922 4119 dbSNP
rs1327207918 4120 dbSNP
rs144110527 4122 dbSNP
rs139392025 4123 dbSNP
rs897744894 4131 dbSNP
rs1247998839 4132 dbSNP
rs1333063277 4135 dbSNP
rs1165619824 4139 dbSNP
rs1036581212 4140 dbSNP
rs939213272 4148 dbSNP
rs1457604107 4153 dbSNP
rs1159296000 4162 dbSNP
rs1384897005 4164 dbSNP
rs906405716 4171 dbSNP
rs1366765649 4173 dbSNP
rs1044776015 4174 dbSNP
rs1321195427 4175 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guguuuggUAAUACACGACGAu 5'
                  ||||  ||||||| 
Target 5' -------aAUUA--UGCUGCUa 3'
1 - 13
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000262384.3 | 3UTR | AAUUAUGCUGCUAUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells 0.539 3.3e-3 0.527 4.1e-3 24 Click to see details
GSE32688 Pancreatic cancer 0.447 5.2e-3 0.355 2.3e-2 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.472 1.8e-2 -0.269 1.3e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.374 3.9e-2 -0.307 7.7e-2 23 Click to see details
GSE17498 Multiple myeloma 0.257 5.5e-2 0.129 2.1e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.478 5.8e-2 -0.594 2.1e-2 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.322 5.8e-2 -0.446 1.3e-2 25 Click to see details
GSE21687 Ependynoma primary tumors -0.184 7.3e-2 -0.129 1.5e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.372 1.1e-1 -0.236 2.2e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.114 1.4e-1 0.162 6.4e-2 90 Click to see details
GSE19783 ER- ER- breast cancer 0.112 1.6e-1 0.094 2.0e-1 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.214 1.8e-1 -0.397 4.2e-2 20 Click to see details
GSE21032 Prostate cancer 0.098 1.9e-1 0.143 9.9e-2 83 Click to see details
GSE28544 Breast cancer -0.174 2.1e-1 -0.570 1.8e-3 24 Click to see details
GSE27834 Pluripotent stem cells -0.188 2.4e-1 0.003 5.0e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.127 2.7e-1 -0.084 3.4e-1 25 Click to see details
GSE38226 Liver fibrosis 0.087 3.5e-1 0.034 4.4e-1 21 Click to see details
GSE19536 Breast cancer -0.016 4.4e-1 0.012 4.5e-1 100 Click to see details
GSE21849 B cell lymphoma -0.026 4.5e-1 -0.005 4.9e-1 29 Click to see details
GSE17306 Multiple myeloma -0.013 4.6e-1 0.051 3.6e-1 49 Click to see details
GSE17306 Multiple myeloma -0.013 4.6e-1 0.051 3.6e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.209 0.03 -0.184 0.05 84 Click to see details
LIHC 0.259 0.04 0.216 0.07 49 Click to see details
KICH -0.349 0.04 -0.323 0.06 25 Click to see details
UCEC -0.28 0.12 -0.240 0.16 19 Click to see details
LUSC -0.188 0.13 -0.169 0.16 38 Click to see details
HNSC 0.178 0.13 0.232 0.07 42 Click to see details
PAAD 0.739 0.13 0.800 0.1 4 Click to see details
BLCA 0.219 0.19 0.141 0.29 18 Click to see details
KIRC 0.094 0.22 0.149 0.11 68 Click to see details
THCA -0.088 0.25 -0.135 0.15 59 Click to see details
PRAD -0.055 0.35 0.007 0.48 50 Click to see details
CESC -0.338 0.39 -0.500 0.33 3 Click to see details
CHOL -0.108 0.39 -0.083 0.42 9 Click to see details
PCPG 0.307 0.4 0.500 0.33 3 Click to see details
KIRP -0.04 0.41 -0.068 0.36 32 Click to see details
STAD 0.021 0.45 -0.037 0.42 32 Click to see details
COAD -0.046 0.46 0.238 0.29 8 Click to see details
LUAD 0.035 0.46 -0.042 0.45 12 Click to see details
ESCA -0.033 0.46 -0.218 0.26 11 Click to see details
ESCA -0.033 0.46 -0.218 0.26 11 Click to see details
ESCA -0.033 0.46 -0.218 0.26 11 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1
MIRT297778 GABPA GA binding protein transcription factor alpha subunit 1 2
MIRT300100 STRADB STE20-related kinase adaptor beta 1 1
MIRT300992 MTMR3 myotubularin related protein 3 1 1
MIRT302611 CRIM1 cysteine rich transmembrane BMP regulator 1 1 3
MIRT302825 SOCS5 suppressor of cytokine signaling 5 1 1
MIRT307141 CTDSPL CTD small phosphatase like 1 2
MIRT313675 ITGA2 integrin subunit alpha 2 1 1
MIRT314051 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 1 4
MIRT317722 PPIL1 peptidylprolyl isomerase like 1 1 4
MIRT319331 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT320626 ZNRF2 zinc and ring finger 2 1 1
MIRT324839 IFT74 intraflagellar transport 74 1 1
MIRT326301 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT327962 CHIC1 cysteine rich hydrophobic domain 1 1 3
MIRT437998 KLF6 Kruppel like factor 6 2 1
MIRT438163 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 3 1
MIRT438610 RET ret proto-oncogene 1 1
MIRT443809 SIDT2 SID1 transmembrane family member 2 2 1
MIRT446508 ASCC1 activating signal cointegrator 1 complex subunit 1 1 1
MIRT447778 DMRT2 doublesex and mab-3 related transcription factor 2 1 1
MIRT448440 TLL1 tolloid like 1 1 1
MIRT449190 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 1 1
MIRT451839 ALDH3B1 aldehyde dehydrogenase 3 family member B1 1 1
MIRT453288 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT453754 CSNK1E casein kinase 1 epsilon 1 1
MIRT454970 TPM2 tropomyosin 2 1 1
MIRT456867 ZNF460 zinc finger protein 460 1 5
MIRT460224 FGFR4 fibroblast growth factor receptor 4 1 1
MIRT460438 DOCK11 dedicator of cytokinesis 11 1 1
MIRT461564 ACTR3B ARP3 actin related protein 3 homolog B 1 1
MIRT463167 ZNF367 zinc finger protein 367 1 5
MIRT464668 UBE2V1 ubiquitin conjugating enzyme E2 V1 1 4
MIRT464751 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 2
MIRT465165 TSC22D2 TSC22 domain family member 2 1 1
MIRT465570 TOB2 transducer of ERBB2, 2 1 1
MIRT465926 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 1 4
MIRT466008 TMEM189 transmembrane protein 189 1 4
MIRT466298 TM4SF1 transmembrane 4 L six family member 1 1 1
MIRT466436 TFAP2A transcription factor AP-2 alpha 1 4
MIRT466917 STK38 serine/threonine kinase 38 1 5
MIRT467002 SSRP1 structure specific recognition protein 1 1 3
MIRT468052 SIK1 salt inducible kinase 1 1 2
MIRT468151 SH3BP4 SH3 domain binding protein 4 1 1
MIRT468676 SEC24A SEC24 homolog A, COPII coat complex component 1 2
MIRT469090 RNF168 ring finger protein 168 1 1
MIRT469415 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT471038 PISD phosphatidylserine decarboxylase 1 5
MIRT471495 PDE4D phosphodiesterase 4D 1 2
MIRT471956 NR6A1 nuclear receptor subfamily 6 group A member 1 1 1
MIRT472263 NFIC nuclear factor I C 1 1
MIRT472665 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit