miRTarBase - #MIRT607655 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BTN3A2   
Synonyms BT3.2, BTF4, BTN3.2, CD277
Description butyrophilin subfamily 3 member A2
Transcript NM_007047   
Expression
Putative miRNA Targets on BTN3A2
3'UTR of BTN3A2
(miRNA target sites are highlighted)
>BTN3A2|NM_007047|3'UTR
   1 TGCTCTAATGGAAAAATGGCCCTCTTCAAGCCTGGTGAGGAAATGCTTCAGATGAGGCTCCACCTTGTTAAATAAATTGG
  81 ATGTATGGAAAAATAGACTGCAGAAAAGGGGAACTCATTTAGCTCACGAGTGGTCGAGTGAAGATTGAAAATTAACCTCT
 161 GAGGGCCAGCACAGCAGCTCATGCCTGTAATCCTAGCACTTTGGAAGGCTGAGGAGGGCGGATCACAAGGTCAGGAGATC
 241 AAGACCATCCTGGCTAACACGGTGAAACCCCGTCTCTACTAAAAATACAAAAAATAAAAAATTAGCCGGGCATGGTGACG
 321 GGCACCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGGCATGAACCCGGAAGGCAGAGCTTGCAGTGAGCCG
 401 AGATCACGCCACTGCACTCCAGCCTGGGAGACAGAGCGAGACTCTGTCTCAAGAAAAAAAAAAAAAAAAAAAAAGAAAAG
 481 AAAATTAACCTCTGAGTATAAAGCATCAGTGGGCAGAATCAATGTGGGGAGGGAAACAACAAAAATGTAGAAAGAGGATC
 561 CTTGTTGCTTCTTGGGGCCGCATCAGGGTATTGGGTTAGGCAGATACTGACCTTACTTTCATTTCCCCTCTGGTCACTAG
 641 ACCCCTGGGGCTTTCACCAATGACATTGATGAGAGAATCACATTCAGGGCAGGCTAGGGACACGGGGTTCTGGAAGGACC
 721 TCCTCAGCATGGCCCAAGCCTTGCATGCTGTGGCTCTTAAATCCAGGAAAAATGGCTGACCCCATGGACACCTCCTCAAA
 801 CTCTCTGCAGCAGATGTAATTCTGTATCCAGACATGGCAAATGCCATCCTCCTTGTTTCTGAGGACCAGAGGAGTGTACA
 881 GCGTGCTGAGGAGCCCCATGACCTACCAGACAACCCTGAGAGATTTGAATGGCGTTACTGTGTGCTTGGCTGTGAAAGCT
 961 TCATGTCAGAGAGACACTACTGGGAGGTGGAAGTGGGGGACAGAAAAGAGTGGCATATTGGGGTATGTAGTAAGAACGTG
1041 GAGAGGAAAAAAGTTTGGGTCAAAATGACACCGGAGAACGGATACTGGACTATGGGCCTGACTGATGGGAATAAGTATCG
1121 GGCTCTCACTGAGCCCAGAACCAACCTGAAACTTCCTGAGCCTCCTAGGAAAGTGGGGGTCATCCTGGACTATGAGACTG
1201 GACATATCTCGTTCTACAATGCCACGGATGGATCTCATATCTACACATTTCTGCACGCCTCTTCCTCTGAGCCTCTGTAT
1281 CCTGTATTCAGAATTTTGACCTTGGAGCCCACTGCCCTGACCGTTTGCCCAATACCAAAAGTAGAGAGTTCCCCCGATCC
1361 CGACCTAGTGCCTGATCATTCCCTGGAGATACCACTGACCCCAGGCTTAGCTAATGAAAGTGGGGAGCCTCAGGCTGAAG
1441 TAACATCTCTGCTTCTCCCTGCCCAGCCTGGAGCTAAGGGTCTCACCCTCCACAACAGCCAGTCAGAACCATAAAGCTAC
1521 AGGCACACACTGAAGCACTTTACTGATATTCATTCAATTATTCCATAGGACAGTTGTTTGAGTTTGGTGCCACCTTATTG
1601 GCCCCTTTATACAGATAAGGAAACTGGGGTGTAGAAAAGTGTATTGACTTTACAAAGCAGACAGGAATAGTGAACAACAG
1681 AGCTGGGATCTGAACAACAATGACTAACATTAATGGAGAATTTAAAACGTTCTGAGTGCTGTGTTATGAGCTTTGGTGGG
1761 TGTCACTCCTTTAATCCTCACAACACCCTGTCAGGTAGTCTCATTTGGCAAGTATGGAAGCAGAGGCAGGGCAACATTAA
1841 GTAGCTTACATAACTCACACGGTAATTTGTGCAGTTGGGAGATGTTCAGCTTCAGTCCCTGGCCAATTGCCCGTTCTTTT
1921 CCAGCCTGATTTTTCCTGCATGGGAAGAGCCCACATGTAGCCCTGAGGTTCCCTTCCCAGGACAGCTCCAGGATCGAGAT
2001 CACTGTGAGTGGTTGTGGAGTTAAGACCCCTATGGACTCCTTCCCAGCTGATTATCAGAGCCTTAGACCCAGCACTCCTT
2081 GGATTGGCTCTGCAGAGTGTCTTGGTTGAGAGAATAACGTTGCAGTTCCCACAGGGCATGTGACTTTGAAAGAGACTAGA
2161 GGCCACACTCAGTTAATAATGGGGCACAGATGTGTTCCCACCCAACAAATGTGATAAGTGATCGTGCAGCCAGAGCCAGC
2241 CTTCCTTCAGTCAAGGTTTCCAGGCAGAGCAAATACCCTAGAGATTCTCTGTAATATTGGTAATTTGGATGAAGGAAGCT
2321 AGAAGAATTACAGGGATGTTTTTAATCCCACTATGGACTCAGTCTCCTGGAAAAGGATCTGTCCACTCCTGGTCATTGGT
2401 GGATGTTAAACCCATATTCCTTTCAACTGCTGCCTGCTAGGGAAAACTGCTCCTCATTATCATCACTATTATTGCTCACC
2481 ACTGTATCCCCTCTACTGGGCAAGTGCTTGTCAAGTTCTAGTTGTTCAATAAATTTGTTAATAATGCTGACTCTTCAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||| |   :|||||| 
Target 5' atcACGCCACT---GCACTCCa 3'
403 - 421 140.00 -18.10
2
miRNA  3' guUUGUGGU-AACAGUGUGAGgu 5'
            :| ||:|   | |||||||  
Target 5' aaGAGACTAGAGGCCACACTCag 3'
2150 - 2172 132.00 -15.50
3
miRNA  3' guUUGUGGUAACAG---UGUGAGGu 5'
            |: :|| | | |   :|||||| 
Target 5' tcAGAGCCTTAGACCCAGCACTCCt 3'
2055 - 2079 132.00 -13.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN24310457 6 COSMIC
COSN32254018 8 COSMIC
COSN30741596 11 COSMIC
COSN26583795 43 COSMIC
COSN14957084 61 COSMIC
COSN28832839 64 COSMIC
COSN21243724 125 COSMIC
COSN28647881 309 COSMIC
COSN19747459 384 COSMIC
COSN30110389 420 COSMIC
COSN17211531 589 COSMIC
COSN24229669 622 COSMIC
COSN22925751 822 COSMIC
COSN6317132 1054 COSMIC
COSN16561405 1091 COSMIC
COSN26334561 1203 COSMIC
COSN30142648 1208 COSMIC
COSN31959983 1236 COSMIC
COSN30127571 1313 COSMIC
COSN31535828 1315 COSMIC
COSN31531299 1464 COSMIC
COSN15869280 1508 COSMIC
COSN30127575 1539 COSMIC
COSN31517604 1546 COSMIC
COSN28670767 1567 COSMIC
COSN30531047 1624 COSMIC
COSN24384722 1647 COSMIC
COSN31962585 1649 COSMIC
COSN30532405 1653 COSMIC
COSN22646196 1740 COSMIC
COSN15565227 1866 COSMIC
COSN26224498 1869 COSMIC
COSN2157864 2126 COSMIC
COSN26309519 2159 COSMIC
COSN30526882 2187 COSMIC
COSN31504976 2209 COSMIC
COSN30543007 2218 COSMIC
COSN26856878 2233 COSMIC
COSN18731026 2238 COSMIC
COSN30133514 2242 COSMIC
COSN26555101 2251 COSMIC
COSN30182363 2255 COSMIC
COSN28387622 2257 COSMIC
COSN30514762 2259 COSMIC
COSN20075604 2260 COSMIC
COSN30170333 2273 COSMIC
COSN18731027 2274 COSMIC
COSN30472561 2286 COSMIC
COSN30122808 2293 COSMIC
COSN14213624 2329 COSMIC
COSN26968183 2330 COSMIC
COSN26859342 2347 COSMIC
COSN30169247 2373 COSMIC
COSN26859513 2376 COSMIC
COSN31586609 2399 COSMIC
COSN30534600 2419 COSMIC
COSN30526425 2425 COSMIC
COSN30529101 2430 COSMIC
COSN18731028 2434 COSMIC
COSN31959984 2442 COSMIC
COSN5628479 2445 COSMIC
COSN26507183 2449 COSMIC
COSN30524546 2486 COSMIC
COSN31572520 2490 COSMIC
COSN30179183 2492 COSMIC
COSN30521310 2504 COSMIC
COSN30536217 2510 COSMIC
COSN30492622 2515 COSMIC
COSN31539309 2575 COSMIC
COSN31588130 2580 COSMIC
COSN30514648 2581 COSMIC
COSN30110526 2582 COSMIC
COSN30182684 2584 COSMIC
COSN30193814 2597 COSMIC
COSN32059282 2604 COSMIC
COSN32059283 2632 COSMIC
COSN31598122 2633 COSMIC
COSN31511694 2635 COSMIC
COSN30102106 2647 COSMIC
COSN30103763 2652 COSMIC
COSN30136940 2653 COSMIC
COSN30460618 2661 COSMIC
COSN32059284 2671 COSMIC
COSN30182087 2679 COSMIC
COSN26968184 2682 COSMIC
COSN31959986 2687 COSMIC
COSN8513853 2687 COSMIC
COSN31585653 2691 COSMIC
COSN30476040 2697 COSMIC
COSN30506175 2719 COSMIC
COSN30479512 2750 COSMIC
COSN31560011 2751 COSMIC
COSN31499225 2752 COSMIC
COSN31499904 2752 COSMIC
COSN30480339 2755 COSMIC
COSN31553954 2756 COSMIC
COSN30520495 2757 COSMIC
COSN30120433 2758 COSMIC
COSN30184506 2758 COSMIC
COSN30475010 2778 COSMIC
COSN30475011 2779 COSMIC
COSN18731029 2791 COSMIC
COSN30153316 2797 COSMIC
COSN31578036 2800 COSMIC
COSN31576321 2823 COSMIC
COSN30169546 2827 COSMIC
COSN31959987 2833 COSMIC
COSN30151910 2834 COSMIC
COSN30522473 2865 COSMIC
COSN30149807 2886 COSMIC
COSN30123536 2911 COSMIC
COSN8351932 2919 COSMIC
COSN1330334 2995 COSMIC
COSN31546221 3009 COSMIC
COSN23762912 3074 COSMIC
COSN24569828 3416 COSMIC
COSN7868815 3477 COSMIC
COSN21218932 3838 COSMIC
rs2073526 64 GWAS
rs1985732 1567 GWAS
rs28551159 1774 GWAS
rs13218591 2238 GWAS
rs9393716 2274 GWAS
rs34637389 3397 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750688550 4 dbSNP
rs756234925 6 dbSNP
rs1346051025 7 dbSNP
rs1339165501 12 dbSNP
rs1436174045 16 dbSNP
rs200045648 20 dbSNP
rs1292204783 24 dbSNP
rs200421033 27 dbSNP
rs1235673034 29 dbSNP
rs1275728843 33 dbSNP
rs372501672 35 dbSNP
rs1030984048 37 dbSNP
rs1350891716 41 dbSNP
rs749396118 45 dbSNP
rs901869538 50 dbSNP
rs768829523 53 dbSNP
rs539639682 56 dbSNP
rs2073526 64 dbSNP
rs1029084708 65 dbSNP
rs1489288586 76 dbSNP
rs1239977719 77 dbSNP
rs953972173 80 dbSNP
rs1241366675 88 dbSNP
rs916960629 90 dbSNP
rs1269332375 96 dbSNP
rs985348183 101 dbSNP
rs1344336509 102 dbSNP
rs1212287608 119 dbSNP
rs1016851052 126 dbSNP
rs971038157 130 dbSNP
rs570002469 132 dbSNP
rs979734903 135 dbSNP
rs191840210 136 dbSNP
rs555755613 139 dbSNP
rs1252918723 143 dbSNP
rs1429788172 148 dbSNP
rs1389021259 160 dbSNP
rs1322505765 161 dbSNP
rs1468125473 164 dbSNP
rs1405240810 168 dbSNP
rs1176211047 170 dbSNP
rs113005694 171 dbSNP
rs1417016653 175 dbSNP
rs962645428 177 dbSNP
rs768474081 178 dbSNP
rs913077889 187 dbSNP
rs972666490 197 dbSNP
rs370896790 199 dbSNP
rs1174232744 207 dbSNP
rs1255889695 208 dbSNP
rs1042497300 213 dbSNP
rs72841532 219 dbSNP
rs1227897310 221 dbSNP
rs939039994 225 dbSNP
rs535130657 231 dbSNP
rs557961736 242 dbSNP
rs577157338 243 dbSNP
rs1401497264 257 dbSNP
rs1039019939 258 dbSNP
rs1467141777 261 dbSNP
rs565129970 263 dbSNP
rs995115807 271 dbSNP
rs1299437703 274 dbSNP
rs1028296242 280 dbSNP
rs948212745 284 dbSNP
rs377396690 294 dbSNP
rs776366215 297 dbSNP
rs1256086354 301 dbSNP
rs733528 309 dbSNP
rs576426126 315 dbSNP
rs1024049996 327 dbSNP
rs971113729 342 dbSNP
rs980205023 346 dbSNP
rs1343194721 353 dbSNP
rs904095589 354 dbSNP
rs1243579854 361 dbSNP
rs935561016 366 dbSNP
rs1313347440 383 dbSNP
rs2073527 384 dbSNP
rs913100402 396 dbSNP
rs561730718 398 dbSNP
rs1409869128 403 dbSNP
rs1372093590 406 dbSNP
rs1161221336 420 dbSNP
rs1228228160 421 dbSNP
rs901805538 425 dbSNP
rs183684646 429 dbSNP
rs1166140655 432 dbSNP
rs547513910 442 dbSNP
rs945900649 446 dbSNP
rs986622318 448 dbSNP
rs912006832 450 dbSNP
rs997527520 454 dbSNP
rs1050935077 456 dbSNP
rs114264868 462 dbSNP
rs1265763587 463 dbSNP
rs533385695 464 dbSNP
rs566001526 471 dbSNP
rs1315100065 473 dbSNP
rs900516210 479 dbSNP
rs762989547 480 dbSNP
rs1351726484 492 dbSNP
rs1193723545 499 dbSNP
rs1300938729 509 dbSNP
rs1385827597 522 dbSNP
rs1049322437 523 dbSNP
rs1294526225 525 dbSNP
rs1459761669 530 dbSNP
rs1396285575 539 dbSNP
rs2073528 549 dbSNP
rs150175710 562 dbSNP
rs962551658 563 dbSNP
rs2073529 565 dbSNP
rs1001311199 566 dbSNP
rs757611279 571 dbSNP
rs1451302451 574 dbSNP
rs1268279296 584 dbSNP
rs1034480743 591 dbSNP
rs1484763670 598 dbSNP
rs1025571207 601 dbSNP
rs755202226 605 dbSNP
rs1020245984 611 dbSNP
rs1280865460 614 dbSNP
rs575958241 620 dbSNP
rs768006723 624 dbSNP
rs1292070836 627 dbSNP
rs1390272300 629 dbSNP
rs549372110 636 dbSNP
rs1231847349 639 dbSNP
rs535632350 642 dbSNP
rs1328011157 643 dbSNP
rs566107034 647 dbSNP
rs2073530 649 dbSNP
rs558265756 652 dbSNP
rs912416109 659 dbSNP
rs2073531 662 dbSNP
rs974865789 673 dbSNP
rs969189588 682 dbSNP
rs930702735 687 dbSNP
rs979168992 689 dbSNP
rs369750873 692 dbSNP
rs1477738024 694 dbSNP
rs1378486097 699 dbSNP
rs1201201966 705 dbSNP
rs1447466796 707 dbSNP
rs925425912 724 dbSNP
rs1247129466 728 dbSNP
rs935508695 729 dbSNP
rs1466228715 735 dbSNP
rs1261170680 741 dbSNP
rs1199441607 745 dbSNP
rs1345032343 759 dbSNP
rs1309678041 762 dbSNP
rs1243069699 766 dbSNP
rs1265164731 773 dbSNP
rs778203407 774 dbSNP
rs1363497150 777 dbSNP
rs1052596627 779 dbSNP
rs923585305 780 dbSNP
rs933307154 781 dbSNP
rs1436242119 783 dbSNP
rs1213882750 798 dbSNP
rs1368055137 805 dbSNP
rs1254356769 813 dbSNP
rs1050477090 819 dbSNP
rs886721929 841 dbSNP
rs1463141450 843 dbSNP
rs940928454 849 dbSNP
rs1045938368 862 dbSNP
rs1174557628 865 dbSNP
rs889178511 887 dbSNP
rs907394353 891 dbSNP
rs1389746474 903 dbSNP
rs1002070067 912 dbSNP
rs1451081780 916 dbSNP
rs1006283297 917 dbSNP
rs1037799507 918 dbSNP
rs1235673831 926 dbSNP
rs898293849 930 dbSNP
rs1262339002 935 dbSNP
rs1442530403 941 dbSNP
rs749782962 942 dbSNP
rs1193551495 945 dbSNP
rs1341074362 946 dbSNP
rs1274906954 956 dbSNP
rs1229682910 958 dbSNP
rs1162448724 960 dbSNP
rs1282948204 969 dbSNP
rs757889543 970 dbSNP
rs1341571531 971 dbSNP
rs1336288608 978 dbSNP
rs892869039 984 dbSNP
rs1370249926 993 dbSNP
rs1431400804 998 dbSNP
rs1353423720 1001 dbSNP
rs1011268577 1002 dbSNP
rs1462194683 1014 dbSNP
rs1473115754 1015 dbSNP
rs1239102684 1018 dbSNP
rs960685866 1019 dbSNP
rs537513588 1024 dbSNP
rs1023276674 1025 dbSNP
rs967009723 1026 dbSNP
rs1252107505 1031 dbSNP
rs779502824 1032 dbSNP
rs1008159504 1035 dbSNP
rs1288228968 1044 dbSNP
rs377042754 1047 dbSNP
rs543060742 1047 dbSNP
rs545900370 1048 dbSNP
rs9348715 1048 dbSNP
rs1357755755 1050 dbSNP
rs9393715 1051 dbSNP
rs1226661028 1054 dbSNP
rs9348716 1064 dbSNP
rs747990850 1067 dbSNP
rs769607219 1070 dbSNP
rs1308895231 1076 dbSNP
rs1411851598 1078 dbSNP
rs1348341106 1079 dbSNP
rs979116470 1084 dbSNP
rs1322700783 1098 dbSNP
rs1405738551 1106 dbSNP
rs925034991 1107 dbSNP
rs956864709 1109 dbSNP
rs1412012249 1114 dbSNP
rs555367981 1115 dbSNP
rs1487324383 1124 dbSNP
rs952216146 1138 dbSNP
rs984780776 1144 dbSNP
rs1452491210 1145 dbSNP
rs572031952 1150 dbSNP
rs1275601014 1152 dbSNP
rs1207337720 1156 dbSNP
rs1328606440 1158 dbSNP
rs1289123367 1168 dbSNP
rs1230274142 1171 dbSNP
rs1365842527 1173 dbSNP
rs1274475744 1176 dbSNP
rs1436949173 1179 dbSNP
rs1351337153 1180 dbSNP
rs1318495899 1185 dbSNP
rs1456686154 1194 dbSNP
rs762906601 1199 dbSNP
rs202070996 1203 dbSNP
rs1160826734 1211 dbSNP
rs1430935349 1214 dbSNP
rs188300236 1216 dbSNP
rs1214455060 1219 dbSNP
rs1260733415 1222 dbSNP
rs1486814249 1223 dbSNP
rs1179995736 1225 dbSNP
rs138643110 1227 dbSNP
rs1255227784 1228 dbSNP
rs1187046693 1231 dbSNP
rs933608905 1232 dbSNP
rs1269319190 1233 dbSNP
rs928887483 1245 dbSNP
rs532887522 1250 dbSNP
rs1310458943 1252 dbSNP
rs1219994963 1258 dbSNP
rs9379871 1260 dbSNP
rs1056353769 1263 dbSNP
rs1434083715 1274 dbSNP
rs910522254 1275 dbSNP
rs1438814587 1277 dbSNP
rs1410011060 1281 dbSNP
rs1322393531 1283 dbSNP
rs1400259274 1284 dbSNP
rs12206621 1287 dbSNP
rs1346993453 1289 dbSNP
rs1037788252 1294 dbSNP
rs767918584 1304 dbSNP
rs1041457465 1314 dbSNP
rs1387907499 1317 dbSNP
rs902856490 1318 dbSNP
rs1449230603 1323 dbSNP
rs1356560494 1340 dbSNP
rs554252916 1347 dbSNP
rs929783710 1351 dbSNP
rs1046917145 1378 dbSNP
rs1210880886 1379 dbSNP
rs771641434 1386 dbSNP
rs1272735827 1388 dbSNP
rs1013474403 1396 dbSNP
rs964299430 1397 dbSNP
rs1406930577 1407 dbSNP
rs1307111667 1408 dbSNP
rs996722758 1410 dbSNP
rs772864404 1412 dbSNP
rs1297673633 1414 dbSNP
rs1394163153 1419 dbSNP
rs529438383 1421 dbSNP
rs746181730 1422 dbSNP
rs1378315482 1423 dbSNP
rs1302966398 1431 dbSNP
rs181807690 1432 dbSNP
rs566221189 1447 dbSNP
rs984854756 1453 dbSNP
rs528748517 1460 dbSNP
rs1212744230 1468 dbSNP
rs1249256460 1478 dbSNP
rs962058825 1484 dbSNP
rs1173191003 1492 dbSNP
rs1422633769 1508 dbSNP
rs3757138 1509 dbSNP
rs1182578407 1510 dbSNP
rs1486660105 1511 dbSNP
rs144525958 1512 dbSNP
rs988695237 1523 dbSNP
rs1030472853 1531 dbSNP
rs187160266 1532 dbSNP
rs955055984 1541 dbSNP
rs914735620 1551 dbSNP
rs1234611064 1552 dbSNP
rs148632805 1555 dbSNP
rs1348020434 1558 dbSNP
rs190829915 1559 dbSNP
rs1985732 1567 dbSNP
rs1300311442 1576 dbSNP
rs1370285699 1578 dbSNP
rs1441066076 1579 dbSNP
rs910835374 1590 dbSNP
rs1298361720 1592 dbSNP
rs1374941637 1603 dbSNP
rs942003838 1604 dbSNP
rs1302658946 1605 dbSNP
rs1476244274 1611 dbSNP
rs1409785012 1612 dbSNP
rs764222165 1615 dbSNP
rs181656598 1616 dbSNP
rs1272253497 1624 dbSNP
rs1488004765 1625 dbSNP
rs919323567 1636 dbSNP
rs1436987335 1648 dbSNP
rs1265969574 1655 dbSNP
rs1205553230 1656 dbSNP
rs1234805517 1657 dbSNP
rs1287218829 1666 dbSNP
rs929351636 1667 dbSNP
rs1487585548 1668 dbSNP
rs555666744 1671 dbSNP
rs572268902 1676 dbSNP
rs1337220118 1686 dbSNP
rs1057465893 1690 dbSNP
rs1193092197 1691 dbSNP
rs1395705886 1693 dbSNP
rs1040722039 1699 dbSNP
rs896286163 1703 dbSNP
rs369872392 1704 dbSNP
rs1387047392 1705 dbSNP
rs1158604441 1708 dbSNP
rs1454365830 1714 dbSNP
rs375684300 1715 dbSNP
rs1196949229 1716 dbSNP
rs949243361 1718 dbSNP
rs1267729995 1719 dbSNP
rs3047288 1720 dbSNP
rs1463521544 1721 dbSNP
rs1026875733 1724 dbSNP
rs1352129656 1727 dbSNP
rs1253912114 1730 dbSNP
rs905150725 1732 dbSNP
rs774361333 1736 dbSNP
rs1331299701 1739 dbSNP
rs1000472640 1740 dbSNP
rs1304677885 1755 dbSNP
rs1031989034 1764 dbSNP
rs1320405009 1770 dbSNP
rs376731414 1771 dbSNP
rs563041195 1772 dbSNP
rs28551159 1774 dbSNP
rs1395889904 1776 dbSNP
rs1443070240 1777 dbSNP
rs1175356490 1787 dbSNP
rs1295289203 1795 dbSNP
rs1338574743 1801 dbSNP
rs1003999373 1803 dbSNP
rs187102646 1804 dbSNP
rs1253521435 1815 dbSNP
rs1274776205 1816 dbSNP
rs1320157998 1833 dbSNP
rs1213247796 1834 dbSNP
rs1282001323 1837 dbSNP
rs1236979396 1843 dbSNP
rs1340399386 1846 dbSNP
rs1168255632 1849 dbSNP
rs1186295669 1849 dbSNP
rs1200325953 1849 dbSNP
rs1314926356 1849 dbSNP
rs1366639241 1849 dbSNP
rs1389266620 1849 dbSNP
rs1427613044 1849 dbSNP
rs1432051766 1849 dbSNP
rs1476372197 1849 dbSNP
rs1485681498 1849 dbSNP
rs867892749 1849 dbSNP
rs1014996216 1850 dbSNP
rs1202546431 1855 dbSNP
rs962088503 1858 dbSNP
rs1274433678 1859 dbSNP
rs1215491956 1860 dbSNP
rs1342167703 1860 dbSNP
rs1187278633 1861 dbSNP
rs1282931139 1861 dbSNP
rs796426517 1861 dbSNP
rs1315036051 1862 dbSNP
rs1242029477 1863 dbSNP
rs559869335 1863 dbSNP
rs1475982299 1865 dbSNP
rs111658661 1866 dbSNP
rs60784158 1866 dbSNP
rs61548020 1866 dbSNP
rs1477009421 1867 dbSNP
rs981431060 1867 dbSNP
rs146518896 1870 dbSNP
rs71544679 1870 dbSNP
rs1336079748 1871 dbSNP
rs199864096 1871 dbSNP
rs201140388 1876 dbSNP
rs1394647812 1880 dbSNP
rs1462549754 1881 dbSNP
rs1316220718 1884 dbSNP
rs1036117622 1886 dbSNP
rs1325794044 1887 dbSNP
rs1431315787 1892 dbSNP
rs1009287558 1893 dbSNP
rs1271739031 1894 dbSNP
rs1376646679 1895 dbSNP
rs761989905 1910 dbSNP
rs1461944592 1915 dbSNP
rs1396557585 1919 dbSNP
rs992157059 1920 dbSNP
rs1274016187 1925 dbSNP
rs1456237669 1930 dbSNP
rs1408287166 1933 dbSNP
rs1030499995 1936 dbSNP
rs1245392255 1942 dbSNP
rs1193363490 1944 dbSNP
rs914788922 1946 dbSNP
rs1275579254 1954 dbSNP
rs1206914913 1956 dbSNP
rs1316342676 1957 dbSNP
rs1285259663 1962 dbSNP
rs954899827 1963 dbSNP
rs1343115222 1971 dbSNP
rs1274073641 1972 dbSNP
rs947576985 1974 dbSNP
rs1318393574 1975 dbSNP
rs528782425 1975 dbSNP
rs1017858319 1976 dbSNP
rs552010050 1986 dbSNP
rs1160625802 1991 dbSNP
rs924387378 1994 dbSNP
rs571707261 1996 dbSNP
rs943753064 2004 dbSNP
rs973669914 2006 dbSNP
rs769615055 2011 dbSNP
rs1475074639 2021 dbSNP
rs1255444677 2022 dbSNP
rs780869237 2029 dbSNP
rs530923674 2030 dbSNP
rs12214031 2034 dbSNP
rs888361878 2039 dbSNP
rs1004030510 2041 dbSNP
rs567744466 2049 dbSNP
rs1279866123 2055 dbSNP
rs1234767070 2062 dbSNP
rs1015361110 2067 dbSNP
rs1156321348 2069 dbSNP
rs536719897 2073 dbSNP
rs548930843 2077 dbSNP
rs1213963440 2081 dbSNP
rs906351229 2083 dbSNP
rs565823023 2084 dbSNP
rs1290187584 2093 dbSNP
rs917359024 2097 dbSNP
rs530113292 2099 dbSNP
rs1045328964 2100 dbSNP
rs201645186 2101 dbSNP
rs958957828 2103 dbSNP
rs1428487900 2104 dbSNP
rs926521433 2107 dbSNP
rs1420850171 2116 dbSNP
rs1320170707 2117 dbSNP
rs936566491 2118 dbSNP
rs1373450098 2119 dbSNP
rs1257086260 2121 dbSNP
rs1053641998 2129 dbSNP
rs577266243 2132 dbSNP
rs536630019 2133 dbSNP
rs1009688565 2135 dbSNP
rs968947943 2139 dbSNP
rs548594777 2147 dbSNP
rs924792557 2153 dbSNP
rs569939238 2154 dbSNP
rs976916480 2168 dbSNP
rs1351458190 2176 dbSNP
rs1416298696 2178 dbSNP
rs1007709744 2187 dbSNP
rs1296881755 2196 dbSNP
rs1017763302 2202 dbSNP
rs1461785305 2203 dbSNP
rs189964435 2208 dbSNP
rs375635004 2214 dbSNP
rs1422169809 2215 dbSNP
rs1417305322 2220 dbSNP
rs368400868 2221 dbSNP
rs559705655 2227 dbSNP
rs1476347395 2228 dbSNP
rs950743592 2231 dbSNP
rs1036878231 2232 dbSNP
rs13218591 2238 dbSNP
rs1003336609 2239 dbSNP
rs1219219943 2245 dbSNP
rs115643731 2260 dbSNP
rs1273316275 2262 dbSNP
rs565554111 2263 dbSNP
rs1234593629 2264 dbSNP
rs894554515 2273 dbSNP
rs9393716 2274 dbSNP
rs1391183168 2276 dbSNP
rs551007404 2278 dbSNP
rs41266833 2279 dbSNP
rs530141928 2286 dbSNP
rs936512876 2294 dbSNP
rs775902280 2311 dbSNP
rs965538370 2312 dbSNP
rs976945455 2320 dbSNP
rs547033648 2325 dbSNP
rs1410032891 2326 dbSNP
rs538852052 2329 dbSNP
rs953802096 2330 dbSNP
rs984252834 2334 dbSNP
rs111353898 2340 dbSNP
rs1189218296 2346 dbSNP
rs1051891246 2349 dbSNP
rs754160156 2354 dbSNP
rs1336495138 2359 dbSNP
rs534814181 2360 dbSNP
rs551291128 2361 dbSNP
rs1347809027 2366 dbSNP
rs144182156 2367 dbSNP
rs1282951947 2370 dbSNP
rs536918568 2373 dbSNP
rs1309685832 2375 dbSNP
rs1193763891 2376 dbSNP
rs182593871 2379 dbSNP
rs536406747 2383 dbSNP
rs927880142 2389 dbSNP
rs939217832 2391 dbSNP
rs1443234606 2396 dbSNP
rs995043033 2397 dbSNP
rs1026559186 2398 dbSNP
rs573540670 2404 dbSNP
rs1454541581 2411 dbSNP
rs1437971875 2418 dbSNP
rs1365756380 2423 dbSNP
rs536004008 2424 dbSNP
rs1183357981 2433 dbSNP
rs9366654 2434 dbSNP
rs750902615 2436 dbSNP
rs1195386187 2442 dbSNP
rs746814366 2442 dbSNP
rs1260493859 2446 dbSNP
rs1043134578 2448 dbSNP
rs573381973 2450 dbSNP
rs1232555132 2456 dbSNP
rs926080805 2468 dbSNP
rs957860566 2469 dbSNP
rs1397492900 2473 dbSNP
rs111568057 2475 dbSNP
rs565443220 2476 dbSNP
rs1325164919 2485 dbSNP
rs1323997944 2489 dbSNP
rs748350204 2493 dbSNP
rs1442335826 2496 dbSNP
rs373770692 2502 dbSNP
rs544875091 2504 dbSNP
rs561138666 2505 dbSNP
rs998784197 2509 dbSNP
rs1227143186 2511 dbSNP
rs1474422794 2515 dbSNP
rs945263974 2516 dbSNP
rs201823546 2518 dbSNP
rs1028508504 2523 dbSNP
rs987420332 2524 dbSNP
rs184882276 2529 dbSNP
rs1209645391 2541 dbSNP
rs1485780712 2544 dbSNP
rs1250629443 2548 dbSNP
rs943052136 2565 dbSNP
rs954325393 2569 dbSNP
rs546826656 2575 dbSNP
rs1270069219 2576 dbSNP
rs560612660 2578 dbSNP
rs930785031 2579 dbSNP
rs149826859 2586 dbSNP
rs886627205 2599 dbSNP
rs909594899 2600 dbSNP
rs1014889098 2601 dbSNP
rs1373386130 2606 dbSNP
rs1024566208 2607 dbSNP
rs1168381703 2612 dbSNP
rs145787608 2613 dbSNP
rs1415087018 2617 dbSNP
rs1393897761 2621 dbSNP
rs139636053 2622 dbSNP
rs1001526572 2629 dbSNP
rs1328596780 2635 dbSNP
rs1033045661 2638 dbSNP
rs1436365480 2639 dbSNP
rs1272967808 2641 dbSNP
rs535955889 2643 dbSNP
rs554597576 2648 dbSNP
rs1296765598 2649 dbSNP
rs567196970 2652 dbSNP
rs536220251 2653 dbSNP
rs1356348531 2657 dbSNP
rs957476873 2659 dbSNP
rs1439788851 2660 dbSNP
rs946509159 2669 dbSNP
rs552823491 2673 dbSNP
rs1392194963 2677 dbSNP
rs988874702 2679 dbSNP
rs1021179097 2682 dbSNP
rs1419580269 2687 dbSNP
rs1156407755 2698 dbSNP
rs189748143 2701 dbSNP
rs1213778010 2712 dbSNP
rs987755544 2713 dbSNP
rs1053089637 2718 dbSNP
rs144256099 2719 dbSNP
rs943008753 2723 dbSNP
rs1213145240 2734 dbSNP
rs1335501908 2734 dbSNP
rs1262217400 2736 dbSNP
rs559200552 2737 dbSNP
rs974434222 2738 dbSNP
rs920322934 2749 dbSNP
rs749166240 2751 dbSNP
rs1417409063 2752 dbSNP
rs575868397 2757 dbSNP
rs886570916 2758 dbSNP
rs1343455004 2761 dbSNP
rs1453711293 2765 dbSNP
rs372161396 2778 dbSNP
rs1325064861 2779 dbSNP
rs1005670779 2780 dbSNP
rs879881680 2780 dbSNP
rs112185552 2785 dbSNP
rs555242576 2786 dbSNP
rs9366655 2791 dbSNP
rs1441856109 2794 dbSNP
rs540607105 2799 dbSNP
rs1354445051 2801 dbSNP
rs1193502520 2802 dbSNP
rs1001474005 2812 dbSNP
rs560254689 2818 dbSNP
rs1213727387 2821 dbSNP
rs1446696639 2829 dbSNP
rs1233473730 2838 dbSNP
rs1242059721 2842 dbSNP
rs893152912 2844 dbSNP
rs972398055 2846 dbSNP
rs141246071 2848 dbSNP
rs1373059260 2849 dbSNP
rs1286682829 2858 dbSNP
rs545850739 2859 dbSNP
rs960625095 2862 dbSNP
rs1345419793 2863 dbSNP
rs1319834845 2866 dbSNP
rs1259229809 2881 dbSNP
rs1314580849 2882 dbSNP
rs199952332 2885 dbSNP
rs1215045977 2887 dbSNP
rs200521093 2888 dbSNP
rs368916211 2890 dbSNP
rs201755127 2891 dbSNP
rs371800132 2891 dbSNP
rs200164055 2894 dbSNP
rs1427849285 2904 dbSNP
rs1489186077 2907 dbSNP
rs1475087934 2908 dbSNP
rs966943349 2913 dbSNP
rs770122750 2916 dbSNP
rs1256470720 2923 dbSNP
rs1486133931 2928 dbSNP
rs1183773445 2929 dbSNP
rs987355282 2932 dbSNP
rs1484803285 2933 dbSNP
rs550626861 2945 dbSNP
rs1405929222 2948 dbSNP
rs1977 2952 dbSNP
rs1293268770 2957 dbSNP
rs916445335 2962 dbSNP
rs1361973999 2964 dbSNP
rs974674749 2967 dbSNP
rs1382708722 2969 dbSNP
rs1412584717 2971 dbSNP
rs1433343750 2973 dbSNP
rs1978 2979 dbSNP
rs1376405153 2980 dbSNP
rs1361411815 2983 dbSNP
rs951697658 2989 dbSNP
rs1168905304 2990 dbSNP
rs1409476002 2993 dbSNP
rs983564611 2995 dbSNP
rs1979 2997 dbSNP
rs1370616552 2999 dbSNP
rs934749542 3001 dbSNP
rs1053164831 3011 dbSNP
rs901181553 3016 dbSNP
rs1249566402 3020 dbSNP
rs950253529 3021 dbSNP
rs1045923968 3025 dbSNP
rs566430336 3037 dbSNP
rs1230909489 3043 dbSNP
rs1354441356 3044 dbSNP
rs538749373 3047 dbSNP
rs1293454990 3056 dbSNP
rs1397009262 3059 dbSNP
rs890025382 3060 dbSNP
rs1296789277 3062 dbSNP
rs1005702060 3063 dbSNP
rs1017041824 3064 dbSNP
rs937565919 3065 dbSNP
rs1212568504 3073 dbSNP
rs1459890968 3082 dbSNP
rs1417448715 3088 dbSNP
rs1165863264 3101 dbSNP
rs897307898 3104 dbSNP
rs183010644 3105 dbSNP
rs569521978 3106 dbSNP
rs1010277865 3110 dbSNP
rs1042185342 3116 dbSNP
rs1211281128 3117 dbSNP
rs1333476599 3124 dbSNP
rs891238139 3125 dbSNP
rs571634109 3129 dbSNP
rs1240055455 3136 dbSNP
rs143233475 3137 dbSNP
rs1305402563 3145 dbSNP
rs964551314 3146 dbSNP
rs996057530 3151 dbSNP
rs1378312766 3173 dbSNP
rs1333880645 3195 dbSNP
rs765567423 3210 dbSNP
rs1027574790 3216 dbSNP
rs575093677 3221 dbSNP
rs1316737813 3241 dbSNP
rs1173529212 3250 dbSNP
rs951687823 3256 dbSNP
rs1416507872 3257 dbSNP
rs983168874 3258 dbSNP
rs540543422 3271 dbSNP
rs1233598335 3277 dbSNP
rs554145655 3279 dbSNP
rs1382130967 3305 dbSNP
rs1352404145 3309 dbSNP
rs879031410 3311 dbSNP
rs541952896 3318 dbSNP
rs1211105513 3324 dbSNP
rs1484723829 3326 dbSNP
rs68072215 3333 dbSNP
rs34773212 3337 dbSNP
rs562620936 3339 dbSNP
rs1354800305 3340 dbSNP
rs1311883898 3343 dbSNP
rs66823108 3345 dbSNP
rs878906362 3346 dbSNP
rs14232 3347 dbSNP
rs374436079 3353 dbSNP
rs914859084 3357 dbSNP
rs922674043 3359 dbSNP
rs1420104441 3364 dbSNP
rs530002955 3367 dbSNP
rs1362274371 3379 dbSNP
rs934039049 3380 dbSNP
rs1453795537 3381 dbSNP
rs1220731881 3384 dbSNP
rs763873434 3390 dbSNP
rs546540325 3391 dbSNP
rs560232493 3392 dbSNP
rs34637389 3397 dbSNP
rs1205403013 3411 dbSNP
rs757165562 3416 dbSNP
rs1288682036 3421 dbSNP
rs778799440 3423 dbSNP
rs369456076 3428 dbSNP
rs1257030948 3429 dbSNP
rs897339209 3441 dbSNP
rs1479251036 3442 dbSNP
rs1294917064 3445 dbSNP
rs532432507 3450 dbSNP
rs1342610964 3457 dbSNP
rs1310909322 3459 dbSNP
rs1027561855 3462 dbSNP
rs1402830774 3463 dbSNP
rs1174212904 3471 dbSNP
rs951967916 3478 dbSNP
rs1409041291 3480 dbSNP
rs1170905157 3489 dbSNP
rs1372036854 3493 dbSNP
rs1193746430 3495 dbSNP
rs1478630269 3498 dbSNP
rs766189393 3514 dbSNP
rs1014565757 3515 dbSNP
rs758340972 3517 dbSNP
rs1279979343 3520 dbSNP
rs780007804 3527 dbSNP
rs971479355 3528 dbSNP
rs981175149 3531 dbSNP
rs188756861 3540 dbSNP
rs1320289896 3543 dbSNP
rs1360979147 3544 dbSNP
rs1291598343 3554 dbSNP
rs9104 3555 dbSNP
rs958858289 3563 dbSNP
rs1340799447 3572 dbSNP
rs1335900260 3577 dbSNP
rs990306321 3578 dbSNP
rs565734717 3579 dbSNP
rs914806643 3580 dbSNP
rs548787478 3588 dbSNP
rs1466670769 3593 dbSNP
rs193280280 3599 dbSNP
rs956563750 3610 dbSNP
rs1213150242 3614 dbSNP
rs978090223 3616 dbSNP
rs151224928 3619 dbSNP
rs944036698 3620 dbSNP
rs1436639593 3628 dbSNP
rs985541058 3640 dbSNP
rs1039806186 3646 dbSNP
rs748323776 3651 dbSNP
rs1271534237 3653 dbSNP
rs1232938417 3654 dbSNP
rs1357310528 3656 dbSNP
rs770177782 3666 dbSNP
rs1214223564 3673 dbSNP
rs1241936471 3680 dbSNP
rs941333986 3685 dbSNP
rs1048904546 3689 dbSNP
rs536400721 3692 dbSNP
rs72841536 3694 dbSNP
rs1425318461 3697 dbSNP
rs1415495051 3704 dbSNP
rs1165378342 3707 dbSNP
rs1468867601 3710 dbSNP
rs1057022182 3713 dbSNP
rs749725019 3716 dbSNP
rs1473981356 3718 dbSNP
rs1179763390 3719 dbSNP
rs1459468747 3721 dbSNP
rs1251287156 3722 dbSNP
rs1220908553 3728 dbSNP
rs1004771149 3729 dbSNP
rs763464784 3734 dbSNP
rs1015258817 3739 dbSNP
rs896261615 3740 dbSNP
rs1352647440 3745 dbSNP
rs1242279134 3749 dbSNP
rs766968158 3752 dbSNP
rs1407056722 3763 dbSNP
rs34983847 3769 dbSNP
rs1044784972 3770 dbSNP
rs903523301 3771 dbSNP
rs1399347957 3772 dbSNP
rs34625644 3772 dbSNP
rs569378878 3773 dbSNP
rs1002529291 3777 dbSNP
rs576853637 3788 dbSNP
rs1034047833 3797 dbSNP
rs1442144255 3800 dbSNP
rs1030955554 3801 dbSNP
rs1190686197 3803 dbSNP
rs1478373047 3804 dbSNP
rs1248694621 3809 dbSNP
rs1191363320 3810 dbSNP
rs140353954 3816 dbSNP
rs1286556122 3828 dbSNP
rs536673011 3829 dbSNP
rs1345661298 3838 dbSNP
rs199696826 3838 dbSNP
rs79547687 3838 dbSNP
rs577149122 3845 dbSNP
rs1369041497 3855 dbSNP
rs967955509 3856 dbSNP
rs977659788 3857 dbSNP
rs912844001 3861 dbSNP
rs1429644776 3862 dbSNP
rs757872090 3866 dbSNP
rs570526713 3870 dbSNP
rs953212013 3873 dbSNP
rs796920898 3874 dbSNP
rs1374202145 3879 dbSNP
rs1415522935 3880 dbSNP
rs1166225643 3889 dbSNP
rs1219249990 3892 dbSNP
rs150355948 3894 dbSNP
rs183301625 3899 dbSNP
rs756927140 3903 dbSNP
rs188752171 3911 dbSNP
rs34485507 3913 dbSNP
rs1368594538 3916 dbSNP
rs1236860219 3918 dbSNP
rs1210794368 3920 dbSNP
rs1313855076 3928 dbSNP
rs1473486258 3930 dbSNP
rs540569600 3931 dbSNP
rs758250764 3937 dbSNP
rs918085986 3938 dbSNP
rs948206508 3939 dbSNP
rs191626027 3942 dbSNP
rs903595264 3945 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BT474
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395167. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 2 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             ||:||| |   :|||||| 
Target 5' aucACGCCACU---GCACUCCa 3'
17 - 35
Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
CLIP-seq Support 1 for dataset GSM1395167
Method / RBP HITS-CLIP / AGO
Cell line / Condition BT474 / BT474 AGO HITS-CLIP Replicate 2
Location of target site ENST00000396948.1 | 3UTR | CUUGCAGUGAGCCGAGAUCACGCCACUGCACUCCAGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1