miRTarBase - #MIRT607966 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SNX22   
Synonyms -
Description sorting nexin 22
Transcript NM_024798   
Expression
Putative miRNA Targets on SNX22
3'UTR of SNX22
(miRNA target sites are highlighted)
>SNX22|NM_024798|3'UTR
   1 TCAGTCCAGAGGCCTTTGGCTGCCTCCTAAGAAAGTCATGTGCCTCTGTCCTATGAACTCCATATAAGGCTGGGTCCTCC
  81 TTTGGCCTGGACCCAGGACTTAATTACCCAGTGCCCAGTTGTGCCACATTCCCACTCAAGGCTCAGAACTTGGCTCGCAT
 161 TGGTAGCTGGAGGTGGTAGAATTTGTATGCTCTTAGAGCCCAACAGCCAAGGCAGGGTCAAGAAGATAAGTAATAAAAGA
 241 GGAAGTCAGCCAGGCGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGATGGGTGGATCACCTGAAGTCA
 321 GGAGTTCGAGACCAGCCTGACCACCATGGAGAAACCCCGTCTCTACTAAAAATACAAAATTAGCCGGGCATTGTGGTGGT
 401 GCATGCCTGTAATCCCAGCTACTCGGGAAGCTGAGGTAGGAGAATCTCTTTTTTTTTTTTTTTTTTTTTTTTGAGACGGA
 481 GTTTCACTCTTGTTGCCCAGGCTGGAATGCAATGGCACGATCTCGGCTCACGGCAACCCCCGCTTCCCGGGTTCAAGCAA
 561 TTCTCCTGCCTCAGCCTCTCGAGTAGCTGGGATTACAGGCATCCGCCACCATGCCCGGCTAATTTTTGTATTTTTAATAG
 641 AGATGGGTTTCACCACGTTGGCCAGGCTGGTCTTGTACTCCTGACGTCAGGTGATCCACCCGCCTCGGCTTCCCAAAGTG
 721 CTGGGATTACGGGCGTGAGCCACCGTGCTCGGCCCAAGGCAGGAGAATCTCTTGAAGCCAGGAGGCGGAAGTTGTGGTGA
 801 GCCGAGATCGCGCCACTGCACTCCAGCCTGGGCAACAAGAGTGAAACTCCGTCTCAAAATAAATAAATAATAAAGGAAGA
 881 AGTCAGCTGGGTGCAGAGGCTCATGCCTGTAATCCCAATACTTTAGGAGGCCAAGGCAGGAGGATGCTTGGGTCTGGAAG
 961 TTTGAGACCAGCCAGCGCAACATAGTGAGACCTGTCTCTACCAAAAAAAAAAAAAAAAAAAAAAAATCAATTTAGAGGTA
1041 GGCTATGAAAAAGTACAGATACATCCCTTAACATAGACTGGAGGGTGGTGGCAAGGGGAGCAAATGTGGAGGCCCAGTAG
1121 CTGGCAAAGTTTAGAAGCAGGGGGCAAAAGCTCCTGCCTGACTTTTCCTGGGTAGCTCCTGGGTCAAAATTTCAGGCAGG
1201 ATCCCAGGGAAGGGGCAGGCACCCATTGCCACAGGAGAGTTGCAGGCATGTTGGGATGTAGGCCTAGGGGAGGTGCTGCA
1281 GGCTCAAGAACCAGGCCCACACATTATATATTAAAAAAAAAAAAACCCACATTTTTTTTTATTGGTCAGTGTTGGTAGGA
1361 GTTTGTTACAAAAGTGAGTCCATGGGCCTGTGGAATGTGAGGGGAGTGGGTCCGCTCCACCAGATGCCAGCACCGGGGCC
1441 AGTGCAGCTCAGAGCCCTGTGGCGGACTACAGGGCCTGCACAGACGGTCACTCAAAGAAAGATGTCCCTGTGCCCTACTC
1521 CTTGGCGATGGCAAAGGGCTTCTCCACCTCGATCTTGCCGCAGTCTGCGATGATCACATCCTTCAGGGGTTTATCCCGGC
1601 TGTCTGTCTTGGTGCTCTCCACCTTCCGCACCACCTCCTGGAAAAGAAAGGTGGAAGCAGGAGGGCATGGTGGATCAGGA
1681 GGTCCACCGCTCAGGAGAAAGGCCCCAGCGTATGGCTCAGGAGGGCTAAGACCCACAAGTGATCAACAGCACACAAAACT
1761 GGAGGCACCAAAATTCTAACAGACTCCTGGCCAGAGCAGGGAGAATGCAGATTTGACGAGGGGGTACAGGAATTTTGTTC
1841 CTTTGAAGTAAGACCCAGGTTGGGCCAAGGGTGAGGAGGAGGAAGAGGGTGACCAGGGCATGTGGCTTCTCAGGGACATT
1921 GCGTTCAGCTGCACTCTGTATACCTCAGGGGTGGGACCAGCACGTCACTGAGTGAAGGAGGGGAGGGAGGCTCTGGCAGT
2001 TGTGCAGCCTTCCTGGCTGGGCTCTGAGGGGGCTGGAAGAATTTAGAACCTTGGAGGCATGGAGGTACAGGGTTTATTCT
2081 GGACAGGAGCACTGGGCTGCATCTGTGGGTTGGGTCCTTTTGGGAAAGGGATGGACACATGGAGCTCCTGCCCTGGGGTC
2161 TGTGTTGAATCCCCGGTGAGGATTGCCCAGTAGTAGCCCTTGCTTCCACAACTCACCATGCCCTCTAGAACTTTGCCAAA
2241 CACCACATGCTTGCCATCTAGCCAGGCTGTCTTGACTGTCGTGATGAAGAACTGGGAGCCGTTGGTGTCTTTGCCTGCGT
2321 TGGCCATGCTCACCCAGCCAGGCCCGTAGTGCTTCAGTTTGAAGTTCTCATCGGGGAAGCGCTCACCGTAGATGCTCTTT
2401 CCTGGGAAAAAAGACAGAGCAGGTCAGGGGCGCTGGATTGCGCCAAACCAAGCAGACATTCGGGGCCAGGACTGAGGGGG
2481 CTTAACCTGTCCTCTGTGCCAGGCTAGGCTGGAGTGGACTACAAGGACATAAAAGCAGCGTCCTTCCTATCTTCTGGCCT
2561 CAGAGCCAAGCCATGCTGACTGAGGCCAAGTGGGGCATCAGGCCAGGCTGATGTGGTGAACAGCTCACAGAAGGATTACT
2641 TTGAGAAGATAGTTTTGTGGCTTTTAAATAAGGCGCATGTTATCAGCTCCCCTTAGCTATGGCCCAGGCCTGCCACGGAG
2721 GGACTTTGGTGGAGGGAAGTGCCGTGCAGGATGCAGGGGAGTCAACAGGGTCGGAACTCTCCAGAAAAGGAGGACTGCTG
2801 TGGCTGACCAGCCTGTTTTCCTATGAGCACAAAAGACACAGGCATAGCTGCAGAGGAGAAAGCAGCCAGAGATGTGTGGG
2881 GAGGGGCAGAAAAGAGGGGCTGCCCCTTGGATTCTGGAGAGTCAAAGCCTCTTAACAAGGAATGAACAGGAATAAAAGAC
2961 AGCTGTGAGTGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGG--UAACA--GUGUGAGGu 5'
            |:::||  :||||  ||||:||| 
Target 5' ccAGTGCCCAGTTGTGCCACATTCCc 3'
108 - 133 148.00 -16.00
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|:||| |   :|||||| 
Target 5' atcGCGCCACT---GCACTCCa 3'
807 - 825 136.00 -17.50
3
miRNA  3' guUUGUGG---UAACA--GUGUGAGGu 5'
            ::||||   ||| |  || ||||| 
Target 5' gaGGCACCAAAATTCTAACAGACTCCt 3'
1762 - 1788 130.00 -15.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
316695 1311 ClinVar
316696 1313 ClinVar
316697 1313 ClinVar
316698 1326 ClinVar
316699 1326 ClinVar
885311 1362 ClinVar
885312 1436 ClinVar
885313 1451 ClinVar
886214 1495 ClinVar
886215 1502 ClinVar
316700 1504 ClinVar
811804 1552 ClinVar
757737 1561 ClinVar
426916 1565 ClinVar
316701 1570 ClinVar
218476 1598 ClinVar
41422 1600 ClinVar
16925 1607 ClinVar
674934 1659 ClinVar
675189 1754 ClinVar
1204758 1818 ClinVar
886216 2204 ClinVar
31846 2254 ClinVar
16926 2295 ClinVar
993764 2301 ClinVar
886217 2302 ClinVar
316702 2320 ClinVar
31842 2322 ClinVar
423387 2328 ClinVar
266118 2344 ClinVar
316703 2382 ClinVar
887218 2387 ClinVar
993834 2403 ClinVar
811590 2463 ClinVar
COSN26996274 28 COSMIC
COSN30527893 32 COSMIC
COSN26996268 46 COSMIC
COSN30149775 47 COSMIC
COSN31503601 80 COSMIC
COSN1178916 83 COSMIC
COSN30086455 103 COSMIC
COSN30108708 123 COSMIC
COSN31573496 162 COSMIC
COSN216254 230 COSMIC
COSN22233611 370 COSMIC
COSN32061897 1019 COSMIC
COSN31579350 1205 COSMIC
COSN1178918 1219 COSMIC
COSN31534286 1315 COSMIC
COSN18738562 1341 COSMIC
COSN31614257 1400 COSMIC
COSN26996270 1405 COSMIC
COSN18715413 1419 COSMIC
COSN30473530 1436 COSMIC
COSN21115687 1441 COSMIC
COSN26552343 1448 COSMIC
COSN30529818 1459 COSMIC
COSN31483499 1468 COSMIC
COSN31546079 1484 COSMIC
COSN26996272 1487 COSMIC
COSN31578443 1490 COSMIC
COSN30512844 1497 COSMIC
COSM5971495 1527 COSMIC
COSM3503039 1528 COSMIC
COSM1659637 1537 COSMIC
COSM8126380 1551 COSMIC
COSM4716931 1552 COSMIC
COSM7245487 1555 COSMIC
COSM2255695 1560 COSMIC
COSM470949 1561 COSMIC
COSM470950 1562 COSMIC
COSM7595370 1573 COSMIC
COSM963914 1598 COSMIC
COSM8070311 1639 COSMIC
COSN30511891 1678 COSMIC
COSN6642410 1754 COSMIC
COSN31779070 1819 COSMIC
COSN5399788 1930 COSMIC
COSN18738883 2005 COSMIC
COSN30154936 2040 COSMIC
COSN31526996 2043 COSMIC
COSN30154128 2054 COSMIC
COSN510865 2074 COSMIC
COSN30484500 2075 COSMIC
COSN23454025 2117 COSMIC
COSN31550400 2122 COSMIC
COSN31489242 2130 COSMIC
COSN31489106 2131 COSMIC
COSN30149572 2142 COSMIC
COSN28864632 2174 COSMIC
COSN30462022 2181 COSMIC
COSM6237697 2237 COSMIC
COSM8819714 2277 COSMIC
COSM5027991 2279 COSMIC
COSM963915 2282 COSMIC
COSM8014444 2297 COSMIC
COSM5612281 2298 COSMIC
COSM9238146 2300 COSMIC
COSM700729 2306 COSMIC
COSM9471719 2320 COSMIC
COSM6347122 2323 COSMIC
COSM5740367 2325 COSMIC
COSM4716932 2329 COSMIC
COSM6990173 2337 COSMIC
COSM8178582 2344 COSMIC
COSM1323893 2346 COSMIC
COSM5705931 2346 COSMIC
COSM3664757 2347 COSMIC
COSM8317602 2348 COSMIC
COSM434137 2352 COSMIC
COSM7299376 2368 COSMIC
COSM9559245 2375 COSMIC
COSM3503040 2377 COSMIC
COSM8860004 2381 COSMIC
COSM5849532 2385 COSMIC
COSM3690482 2388 COSMIC
COSM4166616 2389 COSMIC
COSM7999231 2403 COSMIC
COSN31533680 2415 COSMIC
COSN30535472 2431 COSMIC
COSN26996271 2432 COSMIC
COSN31592789 2441 COSMIC
COSN30761324 2443 COSMIC
COSN20078201 2487 COSMIC
COSN31505168 2491 COSMIC
COSN29918768 2514 COSMIC
COSN30211052 2919 COSMIC
rs41434449 1754 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759942219 2 dbSNP
rs147669682 3 dbSNP
rs1236257102 4 dbSNP
rs752967094 11 dbSNP
rs935100126 12 dbSNP
rs755943992 14 dbSNP
rs777377399 18 dbSNP
rs371451934 30 dbSNP
rs757103328 33 dbSNP
rs1440935470 38 dbSNP
rs1226543923 39 dbSNP
rs767878852 44 dbSNP
rs778791613 53 dbSNP
rs994083433 64 dbSNP
rs763192988 65 dbSNP
rs879232797 69 dbSNP
rs1395545166 70 dbSNP
rs1338626459 73 dbSNP
rs1433169177 77 dbSNP
rs1450122489 83 dbSNP
rs28720194 88 dbSNP
rs984806456 93 dbSNP
rs1227073861 98 dbSNP
rs1427505747 107 dbSNP
rs1391666532 109 dbSNP
rs1170650459 110 dbSNP
rs1422780448 111 dbSNP
rs905406978 113 dbSNP
rs540520547 117 dbSNP
rs1486279376 125 dbSNP
rs1026978795 130 dbSNP
rs1203488112 132 dbSNP
rs887097372 147 dbSNP
rs1252152287 150 dbSNP
rs564988457 157 dbSNP
rs572867609 158 dbSNP
rs1228904043 160 dbSNP
rs1356014770 162 dbSNP
rs976161688 163 dbSNP
rs966283186 180 dbSNP
rs768139643 190 dbSNP
rs1372154128 193 dbSNP
rs1029327267 196 dbSNP
rs1347674051 199 dbSNP
rs753276318 199 dbSNP
rs923376942 216 dbSNP
rs1284325489 227 dbSNP
rs368236203 228 dbSNP
rs1411900355 233 dbSNP
rs1180618097 243 dbSNP
rs1473797245 246 dbSNP
rs1251678052 248 dbSNP
rs531991449 250 dbSNP
rs112839248 254 dbSNP
rs1209530186 255 dbSNP
rs966488673 256 dbSNP
rs978338886 257 dbSNP
rs180856278 258 dbSNP
rs62024246 259 dbSNP
rs1471551894 264 dbSNP
rs895885 266 dbSNP
rs1226465775 267 dbSNP
rs1352176634 268 dbSNP
rs1385747074 271 dbSNP
rs916280325 272 dbSNP
rs949049592 273 dbSNP
rs766600574 282 dbSNP
rs1365059589 284 dbSNP
rs1046149379 285 dbSNP
rs896912943 297 dbSNP
rs1294869357 298 dbSNP
rs1461550766 299 dbSNP
rs1362280879 300 dbSNP
rs1402657721 310 dbSNP
rs993639712 311 dbSNP
rs1319271074 312 dbSNP
rs1459271755 313 dbSNP
rs1198600639 320 dbSNP
rs1364821245 320 dbSNP
rs1358629019 326 dbSNP
rs1445850030 328 dbSNP
rs1048400130 329 dbSNP
rs917643381 331 dbSNP
rs1384091766 340 dbSNP
rs549203768 341 dbSNP
rs567844556 342 dbSNP
rs1261174111 343 dbSNP
rs1232303445 346 dbSNP
rs888027717 347 dbSNP
rs1307529884 348 dbSNP
rs528630846 356 dbSNP
rs1017540159 359 dbSNP
rs1317972232 359 dbSNP
rs113826624 360 dbSNP
rs1205331735 361 dbSNP
rs1172453950 365 dbSNP
rs1277423870 367 dbSNP
rs550640457 376 dbSNP
rs931610218 376 dbSNP
rs1174572526 378 dbSNP
rs1030339064 381 dbSNP
rs1048609738 385 dbSNP
rs1440371043 386 dbSNP
rs145215991 387 dbSNP
rs1243237042 392 dbSNP
rs1004141774 393 dbSNP
rs1342687844 393 dbSNP
rs550974248 394 dbSNP
rs925143705 402 dbSNP
rs569408897 403 dbSNP
rs997337113 408 dbSNP
rs536735059 418 dbSNP
rs991119048 421 dbSNP
rs185255145 425 dbSNP
rs1394798106 426 dbSNP
rs1377710338 433 dbSNP
rs948996568 435 dbSNP
rs1429443812 437 dbSNP
rs1338714472 440 dbSNP
rs1170667479 443 dbSNP
rs1407014956 445 dbSNP
rs1475803926 446 dbSNP
rs1186817172 447 dbSNP
rs1367958820 447 dbSNP
rs1446660006 447 dbSNP
rs1032235503 449 dbSNP
rs1188740746 449 dbSNP
rs1197150686 449 dbSNP
rs1241915767 449 dbSNP
rs1283075323 449 dbSNP
rs1294406831 449 dbSNP
rs1331204698 449 dbSNP
rs1339569508 449 dbSNP
rs1369060532 449 dbSNP
rs1386612709 449 dbSNP
rs1390211140 449 dbSNP
rs1409627403 449 dbSNP
rs1482576834 449 dbSNP
rs1491235796 449 dbSNP
rs759317254 449 dbSNP
rs956371966 449 dbSNP
rs1491580506 450 dbSNP
rs1419963734 451 dbSNP
rs1329974679 452 dbSNP
rs1472165814 454 dbSNP
rs1249346123 455 dbSNP
rs987767915 456 dbSNP
rs1438062171 457 dbSNP
rs1288624988 461 dbSNP
rs1338072654 466 dbSNP
rs1336235287 469 dbSNP
rs74547905 470 dbSNP
rs917572483 471 dbSNP
rs1228311056 473 dbSNP
rs1240163507 473 dbSNP
rs868845398 474 dbSNP
rs572999780 478 dbSNP
rs1281649209 479 dbSNP
rs1342369118 481 dbSNP
rs1225030695 482 dbSNP
rs1263210639 486 dbSNP
rs1456959385 487 dbSNP
rs1196646930 488 dbSNP
rs1252517642 490 dbSNP
rs1438356446 492 dbSNP
rs1197817225 493 dbSNP
rs1165652007 495 dbSNP
rs1456628873 500 dbSNP
rs1405628260 510 dbSNP
rs1178733512 512 dbSNP
rs1470369106 517 dbSNP
rs533710589 519 dbSNP
rs980918429 520 dbSNP
rs1479577859 525 dbSNP
rs1253061442 526 dbSNP
rs926834671 528 dbSNP
rs558832066 532 dbSNP
rs931458683 533 dbSNP
rs1465124997 534 dbSNP
rs1273337027 542 dbSNP
rs1443374288 543 dbSNP
rs1048640433 547 dbSNP
rs1046097203 549 dbSNP
rs918336456 550 dbSNP
rs1343399628 553 dbSNP
rs1258424420 559 dbSNP
rs1401127741 561 dbSNP
rs1424174057 562 dbSNP
rs929749134 564 dbSNP
rs940026863 575 dbSNP
rs1395239092 581 dbSNP
rs1392496630 582 dbSNP
rs1463123231 584 dbSNP
rs1047876771 599 dbSNP
rs887966003 601 dbSNP
rs1329777323 604 dbSNP
rs1442273163 605 dbSNP
rs1406358846 606 dbSNP
rs1236877812 613 dbSNP
rs1348876767 617 dbSNP
rs1297092336 618 dbSNP
rs1283580335 629 dbSNP
rs1226309108 631 dbSNP
rs12917230 641 dbSNP
rs1364148956 642 dbSNP
rs1290605695 643 dbSNP
rs62024247 645 dbSNP
rs543838237 646 dbSNP
rs1395329937 647 dbSNP
rs1050252156 651 dbSNP
rs562131358 657 dbSNP
rs888971352 658 dbSNP
rs1187676918 667 dbSNP
rs1472765784 670 dbSNP
rs997434320 672 dbSNP
rs1030330763 675 dbSNP
rs966813604 676 dbSNP
rs1255946706 679 dbSNP
rs1209224671 695 dbSNP
rs1000048716 698 dbSNP
rs1264966225 700 dbSNP
rs189135532 701 dbSNP
rs1309410265 702 dbSNP
rs181897309 707 dbSNP
rs1227742111 716 dbSNP
rs1199911452 719 dbSNP
rs990658910 720 dbSNP
rs371998646 722 dbSNP
rs1477623335 723 dbSNP
rs1023515959 729 dbSNP
rs1460139763 731 dbSNP
rs970670643 732 dbSNP
rs1972984 735 dbSNP
rs1404203382 736 dbSNP
rs918284023 737 dbSNP
rs929722602 738 dbSNP
rs541911048 745 dbSNP
rs1175764555 746 dbSNP
rs1481741269 748 dbSNP
rs778860175 751 dbSNP
rs1332736903 752 dbSNP
rs909646022 753 dbSNP
rs942159626 760 dbSNP
rs1235056259 762 dbSNP
rs1355913031 763 dbSNP
rs1287506518 766 dbSNP
rs185724057 773 dbSNP
rs1039182148 781 dbSNP
rs1375118226 787 dbSNP
rs900762410 788 dbSNP
rs1339369108 794 dbSNP
rs1391615085 795 dbSNP
rs745822835 796 dbSNP
rs191958624 802 dbSNP
rs1411781336 804 dbSNP
rs902538312 805 dbSNP
rs999543791 807 dbSNP
rs546849346 810 dbSNP
rs565606000 811 dbSNP
rs1222872151 812 dbSNP
rs932618859 816 dbSNP
rs1214336324 819 dbSNP
rs1049849011 827 dbSNP
rs1285063333 827 dbSNP
rs1012083065 829 dbSNP
rs936069074 831 dbSNP
rs1053655309 837 dbSNP
rs1385874988 838 dbSNP
rs1368228763 840 dbSNP
rs1327351898 842 dbSNP
rs1023506288 851 dbSNP
rs532841413 852 dbSNP
rs1287605835 862 dbSNP
rs970618483 866 dbSNP
rs1263903517 868 dbSNP
rs1429243560 872 dbSNP
rs892293617 872 dbSNP
rs181848744 888 dbSNP
rs1025287941 894 dbSNP
rs1025578230 906 dbSNP
rs951090435 910 dbSNP
rs983812957 916 dbSNP
rs906212724 919 dbSNP
rs1261017615 923 dbSNP
rs1203284223 938 dbSNP
rs569274717 940 dbSNP
rs942493782 967 dbSNP
rs536605413 977 dbSNP
rs548675865 978 dbSNP
rs1451168071 982 dbSNP
rs1033438467 984 dbSNP
rs1305105760 984 dbSNP
rs1325317752 985 dbSNP
rs952502789 989 dbSNP
rs974876353 990 dbSNP
rs1385253431 992 dbSNP
rs1394905912 993 dbSNP
rs1433204857 995 dbSNP
rs1377525430 998 dbSNP
rs1174474951 1001 dbSNP
rs766712363 1002 dbSNP
rs767546979 1002 dbSNP
rs1191010817 1003 dbSNP
rs1209912507 1003 dbSNP
rs1211150235 1003 dbSNP
rs1267910947 1003 dbSNP
rs1282067572 1003 dbSNP
rs1293162700 1003 dbSNP
rs1338245122 1003 dbSNP
rs1357728139 1003 dbSNP
rs1371405736 1003 dbSNP
rs1413378152 1003 dbSNP
rs1484552722 1003 dbSNP
rs200256434 1003 dbSNP
rs3056904 1003 dbSNP
rs5813281 1003 dbSNP
rs751091432 1003 dbSNP
rs752937519 1003 dbSNP
rs759962539 1003 dbSNP
rs1312285303 1004 dbSNP
rs1384836505 1005 dbSNP
rs1313792098 1007 dbSNP
rs1246701187 1008 dbSNP
rs1015743748 1016 dbSNP
rs1308255621 1016 dbSNP
rs1351291126 1021 dbSNP
rs1462514093 1024 dbSNP
rs1373619260 1025 dbSNP
rs1187094293 1027 dbSNP
rs1213877337 1028 dbSNP
rs1262660007 1029 dbSNP
rs1474140060 1030 dbSNP
rs1259337541 1031 dbSNP
rs1188319172 1032 dbSNP
rs922134261 1035 dbSNP
rs3896787 1036 dbSNP
rs1199875468 1040 dbSNP
rs933559176 1041 dbSNP
rs1051943206 1043 dbSNP
rs1197060593 1047 dbSNP
rs1339450732 1051 dbSNP
rs961504331 1052 dbSNP
rs977047566 1057 dbSNP
rs879825466 1059 dbSNP
rs186457893 1067 dbSNP
rs1417654747 1068 dbSNP
rs922815120 1074 dbSNP
rs3858911 1077 dbSNP
rs71394543 1082 dbSNP
rs935287253 1085 dbSNP
rs62024248 1086 dbSNP
rs1392072789 1091 dbSNP
rs1465249847 1102 dbSNP
rs985906288 1102 dbSNP
rs925937604 1104 dbSNP
rs893873199 1107 dbSNP
rs1334112101 1115 dbSNP
rs1165418515 1118 dbSNP
rs1230870945 1121 dbSNP
rs1317036717 1127 dbSNP
rs936101617 1133 dbSNP
rs1251823741 1140 dbSNP
rs1211217018 1143 dbSNP
rs1012366098 1146 dbSNP
rs1274316560 1151 dbSNP
rs1053177421 1156 dbSNP
rs1044901044 1163 dbSNP
rs906341825 1166 dbSNP
rs1348940272 1169 dbSNP
rs140759049 1174 dbSNP
rs1240008181 1176 dbSNP
rs576765793 1183 dbSNP
rs1370449963 1187 dbSNP
rs1453250662 1190 dbSNP
rs945175963 1194 dbSNP
rs1396624239 1198 dbSNP
rs1025948520 1201 dbSNP
rs1371118829 1203 dbSNP
rs951332501 1209 dbSNP
rs1225215758 1213 dbSNP
rs769822290 1217 dbSNP
rs777852394 1221 dbSNP
rs1399935650 1223 dbSNP
rs1307442256 1224 dbSNP
rs1046318977 1227 dbSNP
rs79170101 1231 dbSNP
rs1002123239 1232 dbSNP
rs1191225662 1237 dbSNP
rs1469383853 1239 dbSNP
rs1254238377 1260 dbSNP
rs1215692292 1263 dbSNP
rs1445705211 1266 dbSNP
rs1286790298 1267 dbSNP
rs555991657 1271 dbSNP
rs1347458823 1278 dbSNP
rs1261330127 1284 dbSNP
rs1301475389 1308 dbSNP
rs1033339346 1309 dbSNP
rs202080377 1311 dbSNP
rs1171344776 1313 dbSNP
rs1429932364 1313 dbSNP
rs1455241646 1313 dbSNP
rs5813282 1313 dbSNP
rs1204412320 1314 dbSNP
rs1185366000 1315 dbSNP
rs1474722099 1319 dbSNP
rs1238063597 1322 dbSNP
rs113626158 1326 dbSNP
rs397748288 1326 dbSNP
rs1479946828 1327 dbSNP
rs1213273305 1328 dbSNP
rs62024249 1329 dbSNP
rs1179262163 1331 dbSNP
rs1005281732 1332 dbSNP
rs376202696 1332 dbSNP
rs1271814293 1341 dbSNP
rs1359805012 1341 dbSNP
rs1251768175 1342 dbSNP
rs1432234863 1344 dbSNP
rs1173865896 1345 dbSNP
rs1430764978 1346 dbSNP
rs1015271051 1350 dbSNP
rs1043082 1351 dbSNP
rs1359322214 1352 dbSNP
rs1352619145 1356 dbSNP
rs1407673778 1358 dbSNP
rs1195004182 1360 dbSNP
rs1422324117 1360 dbSNP
rs1255841968 1362 dbSNP
rs574102477 1362 dbSNP
rs1444307906 1365 dbSNP
rs34628002 1370 dbSNP
rs922376502 1371 dbSNP
rs1298521344 1377 dbSNP
rs1483707481 1382 dbSNP
rs1232463798 1394 dbSNP
rs541426098 1398 dbSNP
rs776274131 1402 dbSNP
rs954840080 1405 dbSNP
rs1043016 1408 dbSNP
rs1309296082 1409 dbSNP
rs1803362 1411 dbSNP
rs987657075 1414 dbSNP
rs1333990776 1415 dbSNP
rs924183883 1416 dbSNP
rs1043001 1424 dbSNP
rs935628561 1426 dbSNP
rs572025913 1429 dbSNP
rs1297220216 1430 dbSNP
rs202116920 1435 dbSNP
rs540855873 1436 dbSNP
rs1804426 1437 dbSNP
rs2230223 1451 dbSNP
rs9091 1453 dbSNP
rs201075610 1464 dbSNP
rs373762582 1465 dbSNP
rs1476624666 1478 dbSNP
rs367916633 1482 dbSNP
rs1185135574 1484 dbSNP
rs771559275 1486 dbSNP
rs532903614 1487 dbSNP
rs1250124752 1488 dbSNP
rs927810757 1490 dbSNP
rs753313770 1494 dbSNP
rs2307248 1495 dbSNP
rs1481699837 1498 dbSNP
rs770217370 1499 dbSNP
rs1412404574 1500 dbSNP
rs201974607 1502 dbSNP
rs763342854 1504 dbSNP
rs1432718363 1506 dbSNP
rs1467998336 1507 dbSNP
rs1005144213 1512 dbSNP
rs766839875 1514 dbSNP
rs142381852 1515 dbSNP
rs774983936 1517 dbSNP
rs1223993251 1520 dbSNP
rs1036746834 1521 dbSNP
rs1221711291 1524 dbSNP
rs759753798 1527 dbSNP
rs767641975 1528 dbSNP
rs752983598 1533 dbSNP
rs1379081455 1536 dbSNP
rs200904948 1539 dbSNP
rs756245364 1541 dbSNP
rs775716090 1542 dbSNP
rs1214968303 1543 dbSNP
rs1804427 1547 dbSNP
rs763983999 1551 dbSNP
rs753616327 1553 dbSNP
rs1479203449 1554 dbSNP
rs1202140531 1555 dbSNP
rs1378874702 1557 dbSNP
rs757054086 1560 dbSNP
rs143287832 1561 dbSNP
rs1029326377 1563 dbSNP
rs1007167118 1564 dbSNP
rs1085307852 1565 dbSNP
rs1408318644 1569 dbSNP
rs369889089 1570 dbSNP
rs530126062 1587 dbSNP
rs779488612 1588 dbSNP
rs1251117783 1590 dbSNP
rs1458247138 1591 dbSNP
rs746706260 1593 dbSNP
rs200864554 1598 dbSNP
rs776320521 1599 dbSNP
rs1392376207 1600 dbSNP
rs398122834 1600 dbSNP
rs749670269 1601 dbSNP
rs1353135775 1603 dbSNP
rs1238192507 1604 dbSNP
rs137853869 1607 dbSNP
rs369952028 1619 dbSNP
rs775006610 1624 dbSNP
rs760065852 1628 dbSNP
rs767732148 1629 dbSNP
rs775675512 1631 dbSNP
rs1197613651 1633 dbSNP
rs760777976 1638 dbSNP
rs878958952 1639 dbSNP
rs112393084 1640 dbSNP
rs1441160035 1641 dbSNP
rs879243616 1642 dbSNP
rs989724311 1652 dbSNP
rs764273426 1657 dbSNP
rs754080129 1658 dbSNP
rs2253557 1659 dbSNP
rs948001783 1661 dbSNP
rs377032173 1662 dbSNP
rs750380543 1665 dbSNP
rs1386090615 1666 dbSNP
rs758291391 1668 dbSNP
rs779934719 1669 dbSNP
rs751075971 1670 dbSNP
rs1308866459 1673 dbSNP
rs1360400083 1674 dbSNP
rs1248709372 1677 dbSNP
rs1455636670 1678 dbSNP
rs754493288 1684 dbSNP
rs780772293 1686 dbSNP
rs1196816908 1687 dbSNP
rs1250649939 1688 dbSNP
rs369181494 1689 dbSNP
rs779373821 1690 dbSNP
rs1396963918 1695 dbSNP
rs909768328 1696 dbSNP
rs1296864535 1699 dbSNP
rs1359390950 1701 dbSNP
rs554627987 1702 dbSNP
rs1260897920 1704 dbSNP
rs1184590379 1705 dbSNP
rs1489129514 1709 dbSNP
rs191357754 1711 dbSNP
rs1209686849 1714 dbSNP
rs1490406735 1724 dbSNP
rs886972785 1726 dbSNP
rs1257262610 1730 dbSNP
rs896806324 1732 dbSNP
rs1326393271 1742 dbSNP
rs1239827519 1748 dbSNP
rs41434449 1754 dbSNP
rs1402301603 1761 dbSNP
rs1050842237 1766 dbSNP
rs1312573700 1773 dbSNP
rs1412896927 1779 dbSNP
rs1433097905 1784 dbSNP
rs556052515 1789 dbSNP
rs1007031351 1801 dbSNP
rs867471783 1811 dbSNP
rs764795763 1812 dbSNP
rs150119910 1818 dbSNP
rs182294857 1819 dbSNP
rs1263620002 1820 dbSNP
rs1478711374 1820 dbSNP
rs80308901 1821 dbSNP
rs890861630 1823 dbSNP
rs1484501031 1825 dbSNP
rs751182205 1828 dbSNP
rs1200577583 1849 dbSNP
rs1338158977 1849 dbSNP
rs570380255 1853 dbSNP
rs1221000050 1855 dbSNP
rs1293075535 1856 dbSNP
rs1413269289 1857 dbSNP
rs956866877 1865 dbSNP
rs990062606 1867 dbSNP
rs1020730912 1872 dbSNP
rs1335063170 1873 dbSNP
rs1022515999 1882 dbSNP
rs3888854 1886 dbSNP
rs1394402973 1887 dbSNP
rs1166153636 1894 dbSNP
rs1343679287 1895 dbSNP
rs1467136183 1896 dbSNP
rs138858242 1911 dbSNP
rs1424196993 1913 dbSNP
rs545577945 1915 dbSNP
rs1432923397 1918 dbSNP
rs1270847684 1919 dbSNP
rs1382609414 1921 dbSNP
rs971402202 1921 dbSNP
rs980761506 1923 dbSNP
rs557842653 1924 dbSNP
rs1436788375 1925 dbSNP
rs1034409785 1937 dbSNP
rs577524527 1949 dbSNP
rs939415650 1951 dbSNP
rs535524263 1952 dbSNP
rs1458623805 1954 dbSNP
rs754733890 1961 dbSNP
rs982864753 1964 dbSNP
rs780878576 1965 dbSNP
rs1448374442 1973 dbSNP
rs1358879725 1978 dbSNP
rs1285064328 1980 dbSNP
rs143219457 1984 dbSNP
rs990573204 1986 dbSNP
rs539370673 1998 dbSNP
rs1435333989 2002 dbSNP
rs1325116938 2018 dbSNP
rs1376896832 2028 dbSNP
rs899749857 2028 dbSNP
rs932597682 2029 dbSNP
rs972607985 2033 dbSNP
rs530310624 2035 dbSNP
rs1050698948 2036 dbSNP
rs147098192 2047 dbSNP
rs1385612764 2052 dbSNP
rs933642859 2056 dbSNP
rs1361655863 2065 dbSNP
rs1180005386 2066 dbSNP
rs1469396841 2069 dbSNP
rs552880137 2069 dbSNP
rs1051298485 2072 dbSNP
rs998939575 2073 dbSNP
rs1252975269 2085 dbSNP
rs1212349248 2086 dbSNP
rs1156629520 2088 dbSNP
rs1405976455 2092 dbSNP
rs1291037768 2093 dbSNP
rs1204872377 2094 dbSNP
rs1031385045 2095 dbSNP
rs889506073 2096 dbSNP
rs560280927 2100 dbSNP
rs1311702856 2110 dbSNP
rs892880091 2111 dbSNP
rs1241028637 2121 dbSNP
rs1370320593 2122 dbSNP
rs764378674 2127 dbSNP
rs1434218894 2130 dbSNP
rs1319047166 2148 dbSNP
rs1022506470 2151 dbSNP
rs1351488978 2153 dbSNP
rs1451055733 2157 dbSNP
rs1323991636 2158 dbSNP
rs527635568 2163 dbSNP
rs1237263872 2172 dbSNP
rs1358274687 2172 dbSNP
rs1444855380 2174 dbSNP
rs746413456 2175 dbSNP
rs772749269 2176 dbSNP
rs776044392 2177 dbSNP
rs1230165576 2180 dbSNP
rs760723951 2184 dbSNP
rs763594413 2185 dbSNP
rs1464170016 2186 dbSNP
rs138537382 2188 dbSNP
rs1333524040 2192 dbSNP
rs776724565 2204 dbSNP
rs1454726561 2205 dbSNP
rs761972288 2211 dbSNP
rs879117425 2212 dbSNP
rs879159246 2214 dbSNP
rs878892376 2216 dbSNP
rs879161922 2216 dbSNP
rs1228817029 2217 dbSNP
rs1445618613 2218 dbSNP
rs151284742 2227 dbSNP
rs1316594476 2232 dbSNP
rs1288500048 2236 dbSNP
rs199606428 2237 dbSNP
rs762713590 2243 dbSNP
rs766357669 2244 dbSNP
rs1201779269 2247 dbSNP
rs751507032 2248 dbSNP
rs754448469 2249 dbSNP
rs1423078665 2251 dbSNP
rs201926681 2253 dbSNP
rs28720193 2254 dbSNP
rs777799513 2256 dbSNP
rs200990246 2258 dbSNP
rs1193591711 2261 dbSNP
rs780698990 2264 dbSNP
rs752317657 2270 dbSNP
rs753432576 2273 dbSNP
rs755792823 2275 dbSNP
rs983198858 2279 dbSNP
rs140817860 2280 dbSNP
rs369334476 2281 dbSNP
rs772552633 2282 dbSNP
rs780494412 2284 dbSNP
rs747485022 2293 dbSNP
rs121434559 2295 dbSNP
rs768639196 2301 dbSNP
rs549542551 2302 dbSNP
rs761849545 2303 dbSNP
rs1429828398 2305 dbSNP
rs1218493989 2306 dbSNP
rs770049169 2308 dbSNP
rs1323560458 2309 dbSNP
rs1211592084 2310 dbSNP
rs941474019 2310 dbSNP
rs773405777 2312 dbSNP
rs1010515034 2315 dbSNP
rs1184958319 2316 dbSNP
rs762799337 2319 dbSNP
rs766129397 2320 dbSNP
rs137853868 2322 dbSNP
rs921118137 2324 dbSNP
rs1487269123 2325 dbSNP
rs1416413717 2327 dbSNP
rs1064796395 2328 dbSNP
rs150146348 2330 dbSNP
rs1192796934 2338 dbSNP
rs749436404 2341 dbSNP
rs774166877 2343 dbSNP
rs886039912 2344 dbSNP
rs1174043128 2346 dbSNP
rs373618000 2347 dbSNP
rs766970513 2348 dbSNP
rs771047010 2359 dbSNP
rs752300639 2360 dbSNP
rs755666526 2368 dbSNP
rs1460965375 2371 dbSNP
rs753537023 2373 dbSNP
rs11558597 2374 dbSNP
rs1370321804 2379 dbSNP
rs1220520351 2380 dbSNP
rs780409157 2381 dbSNP
rs886051322 2382 dbSNP
rs568378169 2387 dbSNP
rs755547351 2388 dbSNP
rs138741187 2389 dbSNP
rs748284900 2403 dbSNP
rs112753884 2405 dbSNP
rs1269564174 2407 dbSNP
rs750215489 2412 dbSNP
rs778760386 2412 dbSNP
rs535376686 2413 dbSNP
rs758284578 2416 dbSNP
rs374880244 2419 dbSNP
rs567483567 2420 dbSNP
rs1053236908 2421 dbSNP
rs1354474828 2423 dbSNP
rs749452493 2424 dbSNP
rs779838201 2426 dbSNP
rs28720192 2429 dbSNP
rs372252231 2431 dbSNP
rs759224509 2432 dbSNP
rs767544429 2433 dbSNP
rs775555112 2434 dbSNP
rs905339451 2439 dbSNP
rs1171870522 2440 dbSNP
rs779139279 2442 dbSNP
rs565544479 2443 dbSNP
rs753559721 2453 dbSNP
rs539380059 2462 dbSNP
rs2241995 2463 dbSNP
rs576181114 2465 dbSNP
rs1259880178 2471 dbSNP
rs986525053 2471 dbSNP
rs1219065184 2473 dbSNP
rs1004206724 2477 dbSNP
rs1442457931 2479 dbSNP
rs1310226331 2482 dbSNP
rs746085887 2499 dbSNP
rs942456808 2501 dbSNP
rs1054186117 2512 dbSNP
rs572938461 2514 dbSNP
rs962807255 2518 dbSNP
rs544850568 2525 dbSNP
rs556783576 2528 dbSNP
rs1343292606 2531 dbSNP
rs1403135304 2539 dbSNP
rs1332602905 2540 dbSNP
rs1224745976 2541 dbSNP
rs1348494886 2543 dbSNP
rs1263229835 2551 dbSNP
rs893325558 2558 dbSNP
rs974103756 2562 dbSNP
rs946166952 2564 dbSNP
rs1441601661 2579 dbSNP
rs921360079 2580 dbSNP
rs1199194019 2581 dbSNP
rs1488080842 2585 dbSNP
rs1194070208 2595 dbSNP
rs1223434399 2600 dbSNP
rs907412669 2603 dbSNP
rs1003533452 2608 dbSNP
rs542049949 2613 dbSNP
rs1378454515 2616 dbSNP
rs546466962 2629 dbSNP
rs1198445965 2631 dbSNP
rs1268399080 2634 dbSNP
rs1366031566 2640 dbSNP
rs112215313 2657 dbSNP
rs1201669579 2658 dbSNP
rs542159968 2675 dbSNP
rs113672743 2676 dbSNP
rs1157070244 2688 dbSNP
rs1421675641 2695 dbSNP
rs1381011178 2708 dbSNP
rs556948116 2717 dbSNP
rs1432544949 2718 dbSNP
rs369831615 2723 dbSNP
rs1461894275 2727 dbSNP
rs1166715143 2729 dbSNP
rs1016274322 2731 dbSNP
rs1488671654 2741 dbSNP
rs934606957 2743 dbSNP
rs1284938377 2744 dbSNP
rs1213998417 2745 dbSNP
rs527699458 2758 dbSNP
rs1430763574 2760 dbSNP
rs1302932276 2767 dbSNP
rs1231823563 2768 dbSNP
rs545762413 2768 dbSNP
rs564268620 2773 dbSNP
rs73462555 2774 dbSNP
rs1325384860 2781 dbSNP
rs987110895 2786 dbSNP
rs1296669174 2791 dbSNP
rs867763180 2793 dbSNP
rs910912996 2796 dbSNP
rs776023236 2798 dbSNP
rs989910015 2804 dbSNP
rs8032139 2809 dbSNP
rs946209028 2810 dbSNP
rs12324206 2812 dbSNP
rs1262208134 2818 dbSNP
rs761245746 2824 dbSNP
rs1489077172 2826 dbSNP
rs1002335645 2833 dbSNP
rs1221374728 2838 dbSNP
rs1041928358 2839 dbSNP
rs1199425163 2843 dbSNP
rs928786839 2846 dbSNP
rs1258360197 2849 dbSNP
rs1234616911 2860 dbSNP
rs1057066662 2862 dbSNP
rs896719586 2864 dbSNP
rs561730130 2869 dbSNP
rs1004894076 2873 dbSNP
rs1276723758 2876 dbSNP
rs1225057614 2880 dbSNP
rs1268120394 2883 dbSNP
rs1427948426 2892 dbSNP
rs1333730631 2901 dbSNP
rs1394422764 2906 dbSNP
rs769350679 2909 dbSNP
rs1015863650 2919 dbSNP
rs962655670 2921 dbSNP
rs1056428455 2922 dbSNP
rs894495209 2928 dbSNP
rs995474105 2930 dbSNP
rs1375223520 2944 dbSNP
rs1028324886 2961 dbSNP
rs1478660868 2966 dbSNP
rs769545149 2966 dbSNP
rs1450658184 2967 dbSNP
rs1163323813 2969 dbSNP
rs1423955327 2969 dbSNP
rs1362694380 2974 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BT474
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395167. RNA binding protein: AGO. Condition:BT474 AGO HITS-CLIP Replicate 2 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|:||| |   :|||||| 
Target 5' aucGCGCCACU---GCACUCCa 3'
15 - 33
Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
CLIP-seq Support 1 for dataset GSM1395167
Method / RBP HITS-CLIP / AGO
Cell line / Condition BT474 / BT474 AGO HITS-CLIP Replicate 2
Location of target site ENST00000325881.4 | 3UTR | UGUGGUGAGCCGAGAUCGCGCCACUGCACUCCAGCCUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1