miRTarBase - #MIRT617552 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTO1   
Synonyms CGI-02, COXPD10
Description mitochondrial tRNA translation optimization 1
Transcript NM_001123226   
Other Transcripts NM_012123 , NM_133645   
Expression
Putative miRNA Targets on MTO1
3'UTR of MTO1
(miRNA target sites are highlighted)
>MTO1|NM_001123226|3'UTR
   1 CTTTCAATTCATAAAAGATTTTTAAAGAGCATATAAATAATTTGATCAATACAACAGTATAGATAAAAGAATTATTTAGC
  81 ACATGTTAAAATAGCTTTATTAGGTTACTATGGGTTTGCCATTAATTTCTGAGTGGGACAGAAATTATAATTGTGCTTTT
 161 TCGTGTATATGAAAAAACTAGTCGTAAACAATTTGTACTCTTTCTTTAAGGAGCTGTAATACAAATAACTTTGTGCAGTG
 241 TTCATCAAAGAGAGAGACAGTGAACCTAAAACTGAACCTGGAATAAAACTCAACATGCAGATTTGCCTACTCATAGGGAC
 321 TTTGCCTATTAAGTCTACCAAATTAAAAGTCTTATCATTCAGCGTGTTTTGAGAGTTAATAATCTTTTGCTTGGTTATAC
 401 TAGGCTAGGAAGCAATATCAAAGCCCTTAAATTCTCAAGACTAAAGACTTGAGATTATATAAAATTATCCAGAATCATTC
 481 AGCTAATACTATTGGAATATAGTATGTAGGGTGAAAGTTGACAGAAATCTGTACTTCTTCAGGAAATCCTCACTGGTAAT
 561 TGTTTTGAACATTAATGAAAGCCCTATAAAATAGAAAGATTGGAAATCACCATTGTTTCCTATTATCCACAGTGTGGATG
 641 GATACTTATTTGGTGACCTAGTTATGGGAGAATTGAGTAACGTTAGTTATTTTATATCATACCATAAAAATATTTTCTTA
 721 AAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||||  ||  |:::||||: 
Target 5' taAACA--AT--TTGTACTCTt 3'
185 - 202 108.00 -8.90
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            :|||  | | | ::|||:| 
Target 5' ttGACAGAAATCT-GTACTTCt 3'
518 - 538 103.00 -7.10
3
miRNA  3' guUUGUGGUAA--C-AGUGUGAggu 5'
            |: |:||||  | | |:|||   
Target 5' ccAGAATCATTCAGCTAATACTatt 3'
469 - 493 102.00 -6.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30157089 28 COSMIC
COSN30513840 31 COSMIC
COSN31529797 44 COSMIC
COSN30539485 48 COSMIC
COSN31597752 49 COSMIC
COSN31576492 70 COSMIC
COSN31604328 98 COSMIC
COSN17038008 135 COSMIC
COSN21651408 372 COSMIC
COSN9912883 619 COSMIC
COSN15139869 874 COSMIC
COSN27982188 971 COSMIC
COSN9806529 1789 COSMIC
COSN7897148 2034 COSMIC
COSN16991647 2331 COSMIC
COSN6331577 2441 COSMIC
COSN14714705 2936 COSMIC
COSN29882694 3778 COSMIC
COSN2176584 4084 COSMIC
COSN29152859 4285 COSMIC
COSN24151146 4287 COSMIC
COSN7795029 4950 COSMIC
COSN22536952 5024 COSMIC
COSN22532184 5025 COSMIC
COSN32111256 5144 COSMIC
COSN15732136 5865 COSMIC
COSN19190589 6007 COSMIC
COSN17945762 6143 COSMIC
COSN17496065 6154 COSMIC
COSN23428204 6201 COSMIC
COSN6514522 6259 COSMIC
COSN23281479 6304 COSMIC
COSN2176585 6738 COSMIC
COSN15918860 7025 COSMIC
COSN14976610 7198 COSMIC
COSN14704428 7199 COSMIC
COSN22738556 7390 COSMIC
COSN6331579 7839 COSMIC
COSN9806530 8019 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778880919 8 dbSNP
rs749572149 11 dbSNP
rs1252268065 14 dbSNP
rs1006760335 18 dbSNP
rs752423236 24 dbSNP
rs763176745 28 dbSNP
rs745717355 29 dbSNP
rs771883034 34 dbSNP
rs764281639 47 dbSNP
rs775556192 48 dbSNP
rs760099438 53 dbSNP
rs1357478086 58 dbSNP
rs568109705 61 dbSNP
rs1435555508 64 dbSNP
rs765507246 70 dbSNP
rs1397108894 82 dbSNP
rs74599996 87 dbSNP
rs1299737392 107 dbSNP
rs1460248002 109 dbSNP
rs1238342551 111 dbSNP
rs1443665311 119 dbSNP
rs1025663040 122 dbSNP
rs1475962208 129 dbSNP
rs554760195 130 dbSNP
rs960715043 137 dbSNP
rs1367051452 140 dbSNP
rs1251869756 154 dbSNP
rs77517996 163 dbSNP
rs1050604207 164 dbSNP
rs758050376 169 dbSNP
rs10728 172 dbSNP
rs1234132429 177 dbSNP
rs948124766 181 dbSNP
rs189764625 184 dbSNP
rs763378248 185 dbSNP
rs778251010 201 dbSNP
rs979607167 216 dbSNP
rs1464068572 217 dbSNP
rs1444416201 219 dbSNP
rs1001087740 224 dbSNP
rs925422824 227 dbSNP
rs1333479035 230 dbSNP
rs1462703502 230 dbSNP
rs1377863317 235 dbSNP
rs1452160608 236 dbSNP
rs145795187 237 dbSNP
rs1031275253 241 dbSNP
rs935601695 244 dbSNP
rs777364657 274 dbSNP
rs892432567 282 dbSNP
rs1342038483 292 dbSNP
rs1364931204 299 dbSNP
rs1184633082 301 dbSNP
rs902076894 306 dbSNP
rs558387786 310 dbSNP
rs933701546 311 dbSNP
rs1051195226 313 dbSNP
rs1014039330 314 dbSNP
rs1199942006 329 dbSNP
rs1287954371 334 dbSNP
rs1209366374 338 dbSNP
rs1258173655 339 dbSNP
rs1351521159 346 dbSNP
rs751095444 356 dbSNP
rs779505286 361 dbSNP
rs1237877682 363 dbSNP
rs1201376599 364 dbSNP
rs181246036 365 dbSNP
rs1442830274 377 dbSNP
rs1329039239 383 dbSNP
rs1006605611 392 dbSNP
rs1400881603 405 dbSNP
rs1425862311 416 dbSNP
rs1156240050 423 dbSNP
rs1016785421 424 dbSNP
rs1188680583 427 dbSNP
rs781233042 437 dbSNP
rs1001363623 439 dbSNP
rs1034119670 450 dbSNP
rs951902152 464 dbSNP
rs1245294633 466 dbSNP
rs1198460422 467 dbSNP
rs984635160 469 dbSNP
rs745792159 475 dbSNP
rs186077656 477 dbSNP
rs1469415668 478 dbSNP
rs1214524138 483 dbSNP
rs992205000 488 dbSNP
rs1280922050 490 dbSNP
rs1024051481 492 dbSNP
rs1342643705 512 dbSNP
rs1273992693 525 dbSNP
rs1431026437 532 dbSNP
rs969500814 534 dbSNP
rs961727167 538 dbSNP
rs1404639089 541 dbSNP
rs779723849 549 dbSNP
rs1174839298 554 dbSNP
rs979459953 566 dbSNP
rs1423513022 570 dbSNP
rs1324570729 585 dbSNP
rs925475122 593 dbSNP
rs749021608 623 dbSNP
rs1278836671 631 dbSNP
rs935526655 633 dbSNP
rs976191786 636 dbSNP
rs1191652578 640 dbSNP
rs1487993554 645 dbSNP
rs1221165845 648 dbSNP
rs1258259343 654 dbSNP
rs1212978926 658 dbSNP
rs528536619 665 dbSNP
rs1257321634 666 dbSNP
rs988256948 668 dbSNP
rs555780675 669 dbSNP
rs933567059 682 dbSNP
rs923025318 683 dbSNP
rs1050787099 687 dbSNP
rs931751075 702 dbSNP
rs772453380 705 dbSNP
rs368829859 713 dbSNP
rs547084570 715 dbSNP
rs1050186282 732 dbSNP
rs1425045771 735 dbSNP
rs773518660 740 dbSNP
rs760885461 751 dbSNP
rs898228326 757 dbSNP
rs1168828332 765 dbSNP
rs1480118985 766 dbSNP
rs1477597940 776 dbSNP
rs1335639070 780 dbSNP
rs1418676049 781 dbSNP
rs574788912 789 dbSNP
rs565318786 791 dbSNP
rs1205015668 808 dbSNP
rs896440221 810 dbSNP
rs146615750 811 dbSNP
rs1197629620 813 dbSNP
rs1335012826 815 dbSNP
rs1466766581 822 dbSNP
rs1294657559 823 dbSNP
rs1226113748 827 dbSNP
rs1023651429 829 dbSNP
rs969339138 836 dbSNP
rs560279315 838 dbSNP
rs557902636 839 dbSNP
rs1000804404 847 dbSNP
rs572574857 860 dbSNP
rs1465351184 875 dbSNP
rs1395483242 879 dbSNP
rs892750222 887 dbSNP
rs550168037 902 dbSNP
rs140182550 904 dbSNP
rs1177741507 910 dbSNP
rs1298667741 910 dbSNP
rs1236148433 912 dbSNP
rs1046860532 928 dbSNP
rs988309281 933 dbSNP
rs1468694803 952 dbSNP
rs905205847 972 dbSNP
rs1274632222 973 dbSNP
rs923395179 979 dbSNP
rs765709459 983 dbSNP
rs1224835797 992 dbSNP
rs1379689966 997 dbSNP
rs1384523149 1003 dbSNP
rs1307610952 1005 dbSNP
rs1302793000 1007 dbSNP
rs1312313448 1013 dbSNP
rs564409356 1016 dbSNP
rs910907947 1017 dbSNP
rs942365228 1022 dbSNP
rs531875688 1026 dbSNP
rs1038027820 1036 dbSNP
rs570063604 1041 dbSNP
rs929707129 1042 dbSNP
rs1046892817 1052 dbSNP
rs550197961 1053 dbSNP
rs951850031 1058 dbSNP
rs562069401 1065 dbSNP
rs1219265808 1070 dbSNP
rs1264445563 1071 dbSNP
rs1242210750 1080 dbSNP
rs1013524879 1098 dbSNP
rs1356511332 1102 dbSNP
rs1284473727 1106 dbSNP
rs1045413448 1110 dbSNP
rs1349085341 1111 dbSNP
rs1006045688 1112 dbSNP
rs1014789910 1117 dbSNP
rs1189503263 1123 dbSNP
rs1000858119 1130 dbSNP
rs1289589544 1139 dbSNP
rs1032303334 1148 dbSNP
rs1358603509 1149 dbSNP
rs1157998571 1159 dbSNP
rs150328286 1163 dbSNP
rs956791492 1169 dbSNP
rs962291208 1193 dbSNP
rs879237497 1201 dbSNP
rs1432299500 1203 dbSNP
rs548516626 1225 dbSNP
rs1195268925 1230 dbSNP
rs1487033773 1238 dbSNP
rs1010033132 1240 dbSNP
rs1378708610 1251 dbSNP
rs1216525409 1262 dbSNP
rs137876748 1263 dbSNP
rs1159056265 1267 dbSNP
rs1258197535 1268 dbSNP
rs953091150 1271 dbSNP
rs763259048 1276 dbSNP
rs1231524205 1283 dbSNP
rs1311870672 1291 dbSNP
rs1364832154 1293 dbSNP
rs925031330 1309 dbSNP
rs936822177 1310 dbSNP
rs1052629125 1331 dbSNP
rs1297586092 1332 dbSNP
rs1367688434 1332 dbSNP
rs189553699 1334 dbSNP
rs1306558862 1335 dbSNP
rs552381349 1336 dbSNP
rs1242720961 1341 dbSNP
rs1172408969 1344 dbSNP
rs1287222266 1349 dbSNP
rs914145978 1363 dbSNP
rs771219036 1368 dbSNP
rs1422304412 1370 dbSNP
rs963614600 1371 dbSNP
rs570443159 1378 dbSNP
rs1258834138 1380 dbSNP
rs1046664210 1384 dbSNP
rs763789181 1386 dbSNP
rs1483142419 1387 dbSNP
rs760981288 1396 dbSNP
rs879115125 1398 dbSNP
rs751183583 1404 dbSNP
rs1200765856 1410 dbSNP
rs1236537507 1412 dbSNP
rs888568784 1415 dbSNP
rs1441798436 1417 dbSNP
rs1277715617 1420 dbSNP
rs756829975 1426 dbSNP
rs1005989969 1428 dbSNP
rs1179549191 1430 dbSNP
rs1015198113 1432 dbSNP
rs1310508330 1438 dbSNP
rs897668078 1441 dbSNP
rs1384345008 1447 dbSNP
rs1333048000 1448 dbSNP
rs780551447 1452 dbSNP
rs180740803 1468 dbSNP
rs1030250314 1472 dbSNP
rs1366154193 1476 dbSNP
rs952989887 1480 dbSNP
rs1350412134 1481 dbSNP
rs979130551 1484 dbSNP
rs1460986151 1489 dbSNP
rs1328725971 1491 dbSNP
rs1239189885 1495 dbSNP
rs1401966162 1496 dbSNP
rs1447038509 1502 dbSNP
rs1313981627 1508 dbSNP
rs1180889043 1515 dbSNP
rs985827097 1522 dbSNP
rs1378902025 1525 dbSNP
rs949273833 1526 dbSNP
rs1032077205 1535 dbSNP
rs1263686529 1539 dbSNP
rs1315359876 1553 dbSNP
rs149458809 1554 dbSNP
rs1281409600 1557 dbSNP
rs1198031806 1558 dbSNP
rs905158777 1559 dbSNP
rs1444269685 1564 dbSNP
rs987901679 1569 dbSNP
rs914033449 1570 dbSNP
rs1406702013 1571 dbSNP
rs949584399 1574 dbSNP
rs1459174335 1575 dbSNP
rs1162067945 1576 dbSNP
rs146071223 1592 dbSNP
rs1381472119 1593 dbSNP
rs1160869265 1596 dbSNP
rs1438245428 1596 dbSNP
rs1237908741 1599 dbSNP
rs926931105 1599 dbSNP
rs1199853668 1600 dbSNP
rs1453481302 1603 dbSNP
rs1265427030 1605 dbSNP
rs367941653 1607 dbSNP
rs1209312274 1614 dbSNP
rs1354373808 1615 dbSNP
rs938012559 1617 dbSNP
rs1288048311 1620 dbSNP
rs1237807832 1623 dbSNP
rs7765670 1624 dbSNP
rs765071427 1625 dbSNP
rs1414393061 1633 dbSNP
rs1427873773 1641 dbSNP
rs1322384597 1645 dbSNP
rs1400052293 1648 dbSNP
rs940077196 1649 dbSNP
rs1401807017 1650 dbSNP
rs1466377433 1650 dbSNP
rs1418334063 1652 dbSNP
rs768549560 1654 dbSNP
rs1465753672 1658 dbSNP
rs1335662293 1659 dbSNP
rs1357071863 1664 dbSNP
rs1446217492 1665 dbSNP
rs897614191 1675 dbSNP
rs1173509958 1676 dbSNP
rs1479166181 1679 dbSNP
rs1380409158 1680 dbSNP
rs566492643 1688 dbSNP
rs554148846 1689 dbSNP
rs1276936987 1698 dbSNP
rs377595750 1707 dbSNP
rs527602301 1707 dbSNP
rs752701209 1707 dbSNP
rs1219340416 1710 dbSNP
rs1278100195 1712 dbSNP
rs1214368675 1713 dbSNP
rs1487889803 1713 dbSNP
rs776931885 1716 dbSNP
rs200513135 1717 dbSNP
rs963622883 1718 dbSNP
rs889061016 1720 dbSNP
rs775677728 1722 dbSNP
rs1007220934 1723 dbSNP
rs951146371 1732 dbSNP
rs1398757028 1733 dbSNP
rs1345109158 1737 dbSNP
rs1191417614 1738 dbSNP
rs1335319918 1741 dbSNP
rs982457595 1746 dbSNP
rs1425765807 1748 dbSNP
rs879850930 1752 dbSNP
rs1400451238 1753 dbSNP
rs1031982667 1754 dbSNP
rs763645998 1755 dbSNP
rs1425891221 1758 dbSNP
rs778179814 1765 dbSNP
rs1477495033 1775 dbSNP
rs1422555516 1777 dbSNP
rs1212037942 1789 dbSNP
rs1020713052 1799 dbSNP
rs981016472 1800 dbSNP
rs1198894374 1811 dbSNP
rs971297673 1813 dbSNP
rs982343131 1814 dbSNP
rs926424712 1815 dbSNP
rs936606030 1815 dbSNP
rs1053607837 1836 dbSNP
rs1285324693 1846 dbSNP
rs74891337 1847 dbSNP
rs75862764 1848 dbSNP
rs1450765423 1849 dbSNP
rs186466557 1850 dbSNP
rs1336427625 1852 dbSNP
rs892364760 1854 dbSNP
rs926848065 1863 dbSNP
rs938294133 1866 dbSNP
rs144112673 1867 dbSNP
rs377664233 1867 dbSNP
rs984347497 1870 dbSNP
rs1051763227 1875 dbSNP
rs1399844229 1876 dbSNP
rs115352836 1886 dbSNP
rs771129144 1887 dbSNP
rs940026919 1902 dbSNP
rs142941647 1903 dbSNP
rs1458866172 1912 dbSNP
rs1274360535 1921 dbSNP
rs901291091 1925 dbSNP
rs1255747167 1926 dbSNP
rs899301820 1930 dbSNP
rs1321798256 1946 dbSNP
rs190853428 1947 dbSNP
rs1279692244 1953 dbSNP
rs1352704290 1960 dbSNP
rs751018856 1961 dbSNP
rs1354833486 1969 dbSNP
rs933146486 1972 dbSNP
rs1184688950 1982 dbSNP
rs1379464155 1983 dbSNP
rs1026597151 1993 dbSNP
rs866005742 1996 dbSNP
rs1350566338 2008 dbSNP
rs1441704154 2008 dbSNP
rs1166978294 2013 dbSNP
rs55993579 2017 dbSNP
rs1265193750 2020 dbSNP
rs950991048 2021 dbSNP
rs1441329821 2025 dbSNP
rs1488587731 2033 dbSNP
rs541362614 2041 dbSNP
rs1488574594 2049 dbSNP
rs1247997990 2054 dbSNP
rs1024605485 2068 dbSNP
rs1320509040 2071 dbSNP
rs1051633701 2075 dbSNP
rs1478762401 2078 dbSNP
rs1291668671 2080 dbSNP
rs1241430386 2089 dbSNP
rs533635364 2092 dbSNP
rs1307472352 2094 dbSNP
rs1223484671 2100 dbSNP
rs1368537384 2113 dbSNP
rs1295433620 2123 dbSNP
rs1007459729 2134 dbSNP
rs1364977940 2141 dbSNP
rs1379316056 2152 dbSNP
rs1419409827 2153 dbSNP
rs1434679969 2160 dbSNP
rs761447858 2160 dbSNP
rs1490046623 2161 dbSNP
rs368546349 2161 dbSNP
rs368718082 2161 dbSNP
rs878887699 2161 dbSNP
rs1362954275 2162 dbSNP
rs1420820227 2167 dbSNP
rs1218020755 2170 dbSNP
rs926477099 2170 dbSNP
rs1259381904 2171 dbSNP
rs1323530366 2172 dbSNP
rs1491056964 2173 dbSNP
rs11417526 2174 dbSNP
rs77971982 2175 dbSNP
rs1053706423 2176 dbSNP
rs1275606520 2179 dbSNP
rs1376473456 2180 dbSNP
rs1237626116 2181 dbSNP
rs1287860830 2190 dbSNP
rs893443935 2197 dbSNP
rs1009271156 2199 dbSNP
rs1278868484 2202 dbSNP
rs1209159352 2214 dbSNP
rs1287711049 2216 dbSNP
rs576561698 2222 dbSNP
rs1021123233 2225 dbSNP
rs1288136444 2232 dbSNP
rs1466346264 2239 dbSNP
rs759620706 2240 dbSNP
rs1173519208 2241 dbSNP
rs1004104541 2246 dbSNP
rs945309662 2247 dbSNP
rs1033777836 2251 dbSNP
rs770227069 2253 dbSNP
rs1260248242 2254 dbSNP
rs76968370 2262 dbSNP
rs910142371 2275 dbSNP
rs961666372 2283 dbSNP
rs1483786808 2287 dbSNP
rs1258094602 2291 dbSNP
rs1202034377 2292 dbSNP
rs972798325 2307 dbSNP
rs1258841732 2314 dbSNP
rs1220537039 2324 dbSNP
rs562025368 2326 dbSNP
rs529325341 2330 dbSNP
rs1381106629 2335 dbSNP
rs1300846315 2338 dbSNP
rs1469008016 2348 dbSNP
rs1407092420 2359 dbSNP
rs1172268484 2363 dbSNP
rs547837992 2365 dbSNP
rs613787 2370 dbSNP
rs1399704218 2377 dbSNP
rs569652 2378 dbSNP
rs1424855994 2381 dbSNP
rs899236615 2389 dbSNP
rs1182099712 2392 dbSNP
rs1461090021 2393 dbSNP
rs1239005845 2394 dbSNP
rs552083213 2401 dbSNP
rs543493397 2402 dbSNP
rs1250787972 2404 dbSNP
rs1245453019 2406 dbSNP
rs1047925104 2409 dbSNP
rs1312741248 2415 dbSNP
rs1053696699 2421 dbSNP
rs893769511 2422 dbSNP
rs1358422837 2423 dbSNP
rs1014474851 2424 dbSNP
rs147398968 2438 dbSNP
rs1256847419 2439 dbSNP
rs1163310668 2442 dbSNP
rs1456098849 2450 dbSNP
rs537507054 2456 dbSNP
rs761382414 2457 dbSNP
rs1238477268 2459 dbSNP
rs767127791 2464 dbSNP
rs1438682715 2470 dbSNP
rs1187296154 2471 dbSNP
rs1367199408 2480 dbSNP
rs1180777009 2483 dbSNP
rs1249963917 2496 dbSNP
rs1436240125 2496 dbSNP
rs549487454 2500 dbSNP
rs1001807913 2501 dbSNP
rs1489458513 2503 dbSNP
rs1033417886 2510 dbSNP
rs1245075486 2511 dbSNP
rs1166355532 2515 dbSNP
rs957774881 2523 dbSNP
rs989312614 2525 dbSNP
rs1003269685 2532 dbSNP
rs1033390202 2533 dbSNP
rs1277115331 2539 dbSNP
rs913696184 2542 dbSNP
rs1323723583 2545 dbSNP
rs967035118 2553 dbSNP
rs148464107 2554 dbSNP
rs1005708493 2558 dbSNP
rs1381337741 2567 dbSNP
rs1017138150 2568 dbSNP
rs1468861061 2579 dbSNP
rs141874050 2580 dbSNP
rs973409348 2583 dbSNP
rs1245397970 2584 dbSNP
rs1266814182 2590 dbSNP
rs150646157 2595 dbSNP
rs1315525407 2596 dbSNP
rs1219936741 2599 dbSNP
rs920719180 2639 dbSNP
rs779414255 2640 dbSNP
rs1275084469 2651 dbSNP
rs1234878474 2657 dbSNP
rs930677180 2663 dbSNP
rs1258235374 2673 dbSNP
rs955561272 2675 dbSNP
rs1361731303 2677 dbSNP
rs1320761286 2679 dbSNP
rs1399337931 2689 dbSNP
rs1482734939 2694 dbSNP
rs1198417709 2706 dbSNP
rs1384621940 2710 dbSNP
rs1173409253 2713 dbSNP
rs1479102430 2714 dbSNP
rs1427347461 2717 dbSNP
rs985509587 2721 dbSNP
rs911346340 2735 dbSNP
rs1254487314 2739 dbSNP
rs749928772 2741 dbSNP
rs377655149 2753 dbSNP
rs1265230610 2758 dbSNP
rs1444555032 2760 dbSNP
rs1047933746 2763 dbSNP
rs886581447 2785 dbSNP
rs1201843086 2786 dbSNP
rs1320938926 2787 dbSNP
rs77786971 2790 dbSNP
rs989339406 2793 dbSNP
rs766276110 2812 dbSNP
rs945281763 2817 dbSNP
rs906094705 2821 dbSNP
rs1429193704 2822 dbSNP
rs1001858600 2824 dbSNP
rs1042713258 2826 dbSNP
rs957786246 2827 dbSNP
rs1175866588 2835 dbSNP
rs1466221222 2836 dbSNP
rs1421656400 2838 dbSNP
rs1010575928 2848 dbSNP
rs1475013281 2852 dbSNP
rs1237888845 2857 dbSNP
rs1189318271 2859 dbSNP
rs1172937393 2862 dbSNP
rs1373819780 2874 dbSNP
rs753793965 2884 dbSNP
rs966544341 2885 dbSNP
rs1319430839 2889 dbSNP
rs987690126 2896 dbSNP
rs1213380800 2903 dbSNP
rs1339268874 2913 dbSNP
rs1285227144 2920 dbSNP
rs577321924 2921 dbSNP
rs1415237171 2929 dbSNP
rs911848140 2931 dbSNP
rs939020432 2932 dbSNP
rs9442915 2936 dbSNP
rs974746752 2937 dbSNP
rs1356372837 2940 dbSNP
rs1401243777 2941 dbSNP
rs1409342133 2946 dbSNP
rs894936917 2956 dbSNP
rs1165334118 2957 dbSNP
rs558030572 2972 dbSNP
rs372995487 2977 dbSNP
rs1311159383 2978 dbSNP
rs1384341298 2994 dbSNP
rs1005657661 3004 dbSNP
rs1281700137 3005 dbSNP
rs1230718909 3030 dbSNP
rs200330240 3033 dbSNP
rs62438386 3040 dbSNP
rs1291233408 3041 dbSNP
rs1248720287 3044 dbSNP
rs557395566 3050 dbSNP
rs1212062804 3051 dbSNP
rs1357780263 3054 dbSNP
rs543905339 3055 dbSNP
rs183200172 3056 dbSNP
rs1030336324 3060 dbSNP
rs139666969 3061 dbSNP
rs955396084 3075 dbSNP
rs186898852 3076 dbSNP
rs1422619120 3082 dbSNP
rs1364788622 3088 dbSNP
rs893442545 3100 dbSNP
rs755461380 3106 dbSNP
rs757451828 3106 dbSNP
rs1018355999 3107 dbSNP
rs1435036938 3109 dbSNP
rs1270362920 3110 dbSNP
rs1157846545 3122 dbSNP
rs1225394669 3126 dbSNP
rs1489995528 3131 dbSNP
rs957473071 3132 dbSNP
rs1217800103 3133 dbSNP
rs577283696 3136 dbSNP
rs1305143069 3137 dbSNP
rs1223396036 3138 dbSNP
rs1368430055 3140 dbSNP
rs1285250992 3148 dbSNP
rs559744134 3150 dbSNP
rs1289437825 3154 dbSNP
rs1344798628 3163 dbSNP
rs1366289731 3163 dbSNP
rs1384575857 3166 dbSNP
rs546536029 3168 dbSNP
rs1302883236 3169 dbSNP
rs915054029 3190 dbSNP
rs1371308361 3196 dbSNP
rs945204099 3198 dbSNP
rs977999491 3200 dbSNP
rs879149031 3206 dbSNP
rs1414632368 3213 dbSNP
rs1430853897 3213 dbSNP
rs1285717715 3215 dbSNP
rs964633988 3216 dbSNP
rs927903444 3218 dbSNP
rs527544836 3223 dbSNP
rs1219416293 3235 dbSNP
rs546087729 3235 dbSNP
rs939016343 3237 dbSNP
rs1054742099 3241 dbSNP
rs1259284203 3253 dbSNP
rs974629146 3253 dbSNP
rs1215401137 3256 dbSNP
rs1312963695 3266 dbSNP
rs1265149817 3268 dbSNP
rs1221752299 3269 dbSNP
rs894884771 3273 dbSNP
rs1027676343 3276 dbSNP
rs1278766283 3281 dbSNP
rs952050852 3292 dbSNP
rs941090801 3293 dbSNP
rs1488159182 3302 dbSNP
rs1448347340 3309 dbSNP
rs1208146018 3314 dbSNP
rs907985111 3325 dbSNP
rs1468842384 3342 dbSNP
rs1038087556 3345 dbSNP
rs1423676416 3350 dbSNP
rs1269671536 3365 dbSNP
rs1430793021 3367 dbSNP
rs1454891784 3369 dbSNP
rs191291483 3372 dbSNP
rs1186290143 3374 dbSNP
rs994778773 3375 dbSNP
rs927432025 3382 dbSNP
rs1201934208 3385 dbSNP
rs1159662111 3391 dbSNP
rs1029913685 3392 dbSNP
rs781428153 3400 dbSNP
rs1294667842 3402 dbSNP
rs1305662289 3402 dbSNP
rs1228657061 3405 dbSNP
rs893369096 3417 dbSNP
rs1384648065 3420 dbSNP
rs745987952 3420 dbSNP
rs114811281 3424 dbSNP
rs1294806766 3425 dbSNP
rs1394631877 3426 dbSNP
rs1299359203 3430 dbSNP
rs1464040140 3441 dbSNP
rs1018262602 3475 dbSNP
rs146798569 3479 dbSNP
rs567807383 3483 dbSNP
rs1306701356 3486 dbSNP
rs990191184 3490 dbSNP
rs1387424308 3496 dbSNP
rs529002718 3498 dbSNP
rs547033283 3503 dbSNP
rs902264725 3510 dbSNP
rs1197620970 3514 dbSNP
rs1479648741 3520 dbSNP
rs565681242 3521 dbSNP
rs1250701704 3524 dbSNP
rs116371206 3527 dbSNP
rs1361359849 3529 dbSNP
rs1312619688 3534 dbSNP
rs1225834429 3548 dbSNP
rs72961942 3549 dbSNP
rs1321664319 3553 dbSNP
rs1242642946 3556 dbSNP
rs746995635 3558 dbSNP
rs570388475 3559 dbSNP
rs995992133 3561 dbSNP
rs769090030 3563 dbSNP
rs1162022374 3564 dbSNP
rs1444310759 3571 dbSNP
rs1364581785 3578 dbSNP
rs927884316 3585 dbSNP
rs879415377 3586 dbSNP
rs1249854806 3588 dbSNP
rs1236590407 3589 dbSNP
rs1458882602 3594 dbSNP
rs1177595487 3597 dbSNP
rs960641138 3605 dbSNP
rs1289415523 3608 dbSNP
rs951936721 3613 dbSNP
rs990710410 3614 dbSNP
rs183354911 3616 dbSNP
rs971513329 3625 dbSNP
rs981904055 3626 dbSNP
rs771198586 3632 dbSNP
rs556038911 3634 dbSNP
rs144547416 3638 dbSNP
rs1301741492 3639 dbSNP
rs1464709049 3644 dbSNP
rs541519354 3657 dbSNP
rs1386041678 3663 dbSNP
rs958885859 3665 dbSNP
rs1363342759 3666 dbSNP
rs1451870106 3666 dbSNP
rs941039750 3672 dbSNP
rs1481413475 3673 dbSNP
rs117251845 3684 dbSNP
rs914858884 3685 dbSNP
rs946253178 3687 dbSNP
rs1203059301 3696 dbSNP
rs1349464735 3698 dbSNP
rs941124215 3700 dbSNP
rs1263294279 3709 dbSNP
rs577983150 3713 dbSNP
rs1378949324 3730 dbSNP
rs762193021 3734 dbSNP
rs930143341 3737 dbSNP
rs1051732582 3739 dbSNP
rs1327410476 3746 dbSNP
rs187843164 3751 dbSNP
rs1380813517 3760 dbSNP
rs1388169982 3761 dbSNP
rs1177351161 3764 dbSNP
rs891315636 3768 dbSNP
rs1007122788 3776 dbSNP
rs1427242699 3778 dbSNP
rs145313818 3782 dbSNP
rs1256343602 3795 dbSNP
rs1040171431 3806 dbSNP
rs1309519485 3807 dbSNP
rs893106398 3816 dbSNP
rs900240909 3822 dbSNP
rs1011617193 3824 dbSNP
rs1482186152 3826 dbSNP
rs531539277 3828 dbSNP
rs767095238 3830 dbSNP
rs996045913 3836 dbSNP
rs1020364597 3837 dbSNP
rs967888838 3840 dbSNP
rs149198105 3841 dbSNP
rs1225720649 3843 dbSNP
rs1258143142 3852 dbSNP
rs999353776 3853 dbSNP
rs772898615 3855 dbSNP
rs1048922171 3858 dbSNP
rs192723376 3860 dbSNP
rs528939469 3868 dbSNP
rs760142352 3875 dbSNP
rs1035236415 3876 dbSNP
rs1410528201 3879 dbSNP
rs547483110 3885 dbSNP
rs960531882 3886 dbSNP
rs1410148525 3895 dbSNP
rs1174969766 3896 dbSNP
rs1385586386 3899 dbSNP
rs1185074102 3912 dbSNP
rs990663164 3914 dbSNP
rs1358946353 3921 dbSNP
rs753883830 3927 dbSNP
rs1242064975 3928 dbSNP
rs916532325 3940 dbSNP
rs1438989059 3946 dbSNP
rs565515282 3960 dbSNP
rs532922030 3969 dbSNP
rs1014939256 3973 dbSNP
rs551126739 3974 dbSNP
rs962351828 3976 dbSNP
rs1380847248 3978 dbSNP
rs113490218 3981 dbSNP
rs537789288 3982 dbSNP
rs1356286378 3987 dbSNP
rs1248374691 3989 dbSNP
rs1326807831 3990 dbSNP
rs1428972267 4003 dbSNP
rs929688603 4009 dbSNP
rs1165236987 4014 dbSNP
rs1442459806 4020 dbSNP
rs1050885393 4023 dbSNP
rs1412639477 4024 dbSNP
rs1177358971 4026 dbSNP
rs1470898437 4027 dbSNP
rs1230631771 4034 dbSNP
rs912693081 4035 dbSNP
rs1002855095 4036 dbSNP
rs1293038058 4037 dbSNP
rs1225163806 4045 dbSNP
rs1215370502 4046 dbSNP
rs942852130 4047 dbSNP
rs1278268282 4049 dbSNP
rs1034423972 4050 dbSNP
rs958773006 4052 dbSNP
rs549553754 4055 dbSNP
rs893430256 4065 dbSNP
rs1409175090 4066 dbSNP
rs914710276 4068 dbSNP
rs1304820208 4069 dbSNP
rs1480682372 4073 dbSNP
rs1011557629 4075 dbSNP
rs567869584 4076 dbSNP
rs534774422 4094 dbSNP
rs540343714 4096 dbSNP
rs1003345765 4103 dbSNP
rs1405219092 4105 dbSNP
rs1157763503 4108 dbSNP
rs1472582622 4109 dbSNP
rs1270246833 4112 dbSNP
rs1202135319 4116 dbSNP
rs1487727480 4128 dbSNP
rs1243320063 4129 dbSNP
rs1216835326 4130 dbSNP
rs1475496568 4137 dbSNP
rs1190209567 4138 dbSNP
rs1422641723 4139 dbSNP
rs1413077556 4142 dbSNP
rs758190914 4143 dbSNP
rs1376487463 4148 dbSNP
rs1419604453 4149 dbSNP
rs1285150215 4151 dbSNP
rs1296951871 4151 dbSNP
rs1324288334 4151 dbSNP
rs565423248 4154 dbSNP
rs1366709439 4164 dbSNP
rs182040795 4167 dbSNP
rs1023491666 4174 dbSNP
rs1432548047 4177 dbSNP
rs944400157 4199 dbSNP
rs1157879989 4203 dbSNP
rs781312838 4204 dbSNP
rs962632345 4208 dbSNP
rs921719666 4218 dbSNP
rs187933259 4219 dbSNP
rs1048932195 4225 dbSNP
rs539013821 4232 dbSNP
rs1246430240 4239 dbSNP
rs1487021868 4239 dbSNP
rs1025711109 4266 dbSNP
rs887578271 4269 dbSNP
rs1004820288 4271 dbSNP
rs1398439187 4281 dbSNP
rs192447808 4283 dbSNP
rs907102524 4285 dbSNP
rs575883388 4293 dbSNP
rs986919833 4300 dbSNP
rs1359520774 4306 dbSNP
rs1319503976 4308 dbSNP
rs746101057 4310 dbSNP
rs543319790 4311 dbSNP
rs780124403 4312 dbSNP
rs914812972 4318 dbSNP
rs142539443 4322 dbSNP
rs573798843 4323 dbSNP
rs1041990720 4325 dbSNP
rs540899160 4333 dbSNP
rs551109798 4334 dbSNP
rs774788466 4342 dbSNP
rs1021814733 4343 dbSNP
rs938730785 4353 dbSNP
rs1445435341 4358 dbSNP
rs1396056488 4365 dbSNP
rs1482933000 4366 dbSNP
rs967976625 4371 dbSNP
rs1057143187 4382 dbSNP
rs894588644 4384 dbSNP
rs1012023467 4390 dbSNP
rs977605562 4392 dbSNP
rs1339826550 4398 dbSNP
rs1023397172 4431 dbSNP
rs1296569479 4437 dbSNP
rs1020320246 4441 dbSNP
rs1157311137 4443 dbSNP
rs1387793063 4444 dbSNP
rs1301864479 4447 dbSNP
rs1394954798 4447 dbSNP
rs35669630 4447 dbSNP
rs547733495 4447 dbSNP
rs1401305879 4448 dbSNP
rs1323006434 4453 dbSNP
rs1168352821 4454 dbSNP
rs397888779 4459 dbSNP
rs898348600 4459 dbSNP
rs559385635 4460 dbSNP
rs1185603661 4461 dbSNP
rs1025565200 4466 dbSNP
rs975747049 4471 dbSNP
rs1251269376 4490 dbSNP
rs1375866580 4494 dbSNP
rs1482014617 4496 dbSNP
rs532927132 4502 dbSNP
rs1222933590 4505 dbSNP
rs1263346123 4507 dbSNP
rs1281165032 4517 dbSNP
rs931732289 4521 dbSNP
rs551395791 4522 dbSNP
rs984515089 4525 dbSNP
rs1351354253 4527 dbSNP
rs908940843 4534 dbSNP
rs1405936657 4550 dbSNP
rs563276519 4553 dbSNP
rs1161697456 4554 dbSNP
rs748506448 4559 dbSNP
rs1364498856 4569 dbSNP
rs772449620 4572 dbSNP
rs1471601363 4576 dbSNP
rs531190927 4583 dbSNP
rs111701983 4586 dbSNP
rs1287108210 4590 dbSNP
rs1490786348 4590 dbSNP
rs1469464792 4598 dbSNP
rs1213926913 4612 dbSNP
rs1208912762 4618 dbSNP
rs1237190038 4619 dbSNP
rs770641367 4621 dbSNP
rs1262040813 4627 dbSNP
rs1226059886 4629 dbSNP
rs1457552605 4636 dbSNP
rs963816281 4637 dbSNP
rs1288301786 4646 dbSNP
rs1406033999 4646 dbSNP
rs1333235936 4655 dbSNP
rs150960443 4660 dbSNP
rs1055737442 4664 dbSNP
rs914719593 4666 dbSNP
rs142108525 4669 dbSNP
rs1411272183 4678 dbSNP
rs1177127636 4680 dbSNP
rs1481359724 4684 dbSNP
rs1375790610 4686 dbSNP
rs145765383 4688 dbSNP
rs924928931 4692 dbSNP
rs1447308788 4700 dbSNP
rs938664416 4704 dbSNP
rs1463137503 4706 dbSNP
rs1057090399 4712 dbSNP
rs894495472 4718 dbSNP
rs1399871175 4719 dbSNP
rs1444262144 4728 dbSNP
rs1263188793 4733 dbSNP
rs371348208 4751 dbSNP
rs948784127 4757 dbSNP
rs903260138 4758 dbSNP
rs999469649 4781 dbSNP
rs1273502029 4782 dbSNP
rs1233000952 4787 dbSNP
rs1327322367 4797 dbSNP
rs571709954 4799 dbSNP
rs1336180490 4802 dbSNP
rs398094310 4803 dbSNP
rs78737673 4803 dbSNP
rs1388050140 4809 dbSNP
rs1282425511 4811 dbSNP
rs500225 4816 dbSNP
rs1379782833 4817 dbSNP
rs1400002444 4817 dbSNP
rs149271734 4817 dbSNP
rs500223 4817 dbSNP
rs71000128 4817 dbSNP
rs975632446 4818 dbSNP
rs1028681277 4824 dbSNP
rs1448465321 4828 dbSNP
rs7744305 4828 dbSNP
rs7764194 4829 dbSNP
rs12174387 4833 dbSNP
rs984439868 4834 dbSNP
rs1256973680 4844 dbSNP
rs1440137575 4848 dbSNP
rs1277122004 4857 dbSNP
rs1200337496 4863 dbSNP
rs752653236 4866 dbSNP
rs1300231086 4871 dbSNP
rs898286091 4879 dbSNP
rs1197222329 4885 dbSNP
rs1315932856 4894 dbSNP
rs1450305509 4902 dbSNP
rs1338738380 4906 dbSNP
rs762726604 4909 dbSNP
rs868680439 4913 dbSNP
rs1410440221 4920 dbSNP
rs184463614 4924 dbSNP
rs1025977913 4927 dbSNP
rs1166475525 4930 dbSNP
rs928460606 4945 dbSNP
rs1187452531 4946 dbSNP
rs201595723 4950 dbSNP
rs190161550 4957 dbSNP
rs1184979108 4964 dbSNP
rs1471541063 4965 dbSNP
rs1055661920 4975 dbSNP
rs894384133 4977 dbSNP
rs1007883298 4989 dbSNP
rs1019261948 5002 dbSNP
rs1165795541 5006 dbSNP
rs117209686 5011 dbSNP
rs903270773 5013 dbSNP
rs1460639561 5016 dbSNP
rs1169926394 5020 dbSNP
rs996558034 5025 dbSNP
rs1352238373 5031 dbSNP
rs1020213665 5038 dbSNP
rs555216986 5039 dbSNP
rs969289312 5056 dbSNP
rs977641881 5059 dbSNP
rs141422090 5060 dbSNP
rs192853343 5068 dbSNP
rs1473255989 5069 dbSNP
rs960291920 5070 dbSNP
rs541213180 5080 dbSNP
rs1482948306 5083 dbSNP
rs1276984274 5098 dbSNP
rs952931784 5099 dbSNP
rs1006338164 5100 dbSNP
rs1337834673 5103 dbSNP
rs1289313735 5113 dbSNP
rs1015891688 5136 dbSNP
rs1227657996 5140 dbSNP
rs755759426 5148 dbSNP
rs1433925803 5165 dbSNP
rs1251595787 5167 dbSNP
rs948733576 5169 dbSNP
rs1458389728 5172 dbSNP
rs1037739934 5176 dbSNP
rs1409069689 5183 dbSNP
rs962115991 5186 dbSNP
rs566454630 5189 dbSNP
rs931120268 5204 dbSNP
rs1426390782 5205 dbSNP
rs1046920413 5206 dbSNP
rs1246348921 5209 dbSNP
rs1209551479 5224 dbSNP
rs959893793 5230 dbSNP
rs991276694 5231 dbSNP
rs1208102959 5236 dbSNP
rs1363024077 5237 dbSNP
rs1217271495 5249 dbSNP
rs527328945 5249 dbSNP
rs1366598951 5251 dbSNP
rs1270435880 5255 dbSNP
rs915870152 5258 dbSNP
rs1426884230 5260 dbSNP
rs886953757 5263 dbSNP
rs577621257 5267 dbSNP
rs545134899 5268 dbSNP
rs563241852 5275 dbSNP
rs1477545251 5276 dbSNP
rs899465447 5276 dbSNP
rs1360261273 5279 dbSNP
rs996553592 5289 dbSNP
rs551978884 5293 dbSNP
rs968526135 5296 dbSNP
rs934758016 5297 dbSNP
rs1189508492 5309 dbSNP
rs999024834 5310 dbSNP
rs1188024039 5313 dbSNP
rs901243204 5314 dbSNP
rs1257724367 5315 dbSNP
rs1435234605 5319 dbSNP
rs1031817079 5327 dbSNP
rs199736641 5328 dbSNP
rs755025597 5329 dbSNP
rs960202706 5333 dbSNP
rs779435475 5335 dbSNP
rs748682821 5343 dbSNP
rs1230242771 5359 dbSNP
rs1049918476 5367 dbSNP
rs1296341419 5369 dbSNP
rs530541850 5370 dbSNP
rs1382128929 5379 dbSNP
rs1305132876 5380 dbSNP
rs1464963860 5385 dbSNP
rs1359016721 5386 dbSNP
rs970026641 5389 dbSNP
rs973397190 5390 dbSNP
rs1431955572 5391 dbSNP
rs1383415470 5392 dbSNP
rs1188126371 5398 dbSNP
rs1005766798 5400 dbSNP
rs1258328288 5401 dbSNP
rs1180090496 5405 dbSNP
rs374104863 5410 dbSNP
rs1295770577 5411 dbSNP
rs1016363358 5419 dbSNP
rs920661365 5420 dbSNP
rs961761877 5424 dbSNP
rs753073520 5425 dbSNP
rs1301680581 5427 dbSNP
rs1323049607 5428 dbSNP
rs1309920781 5430 dbSNP
rs772378077 5432 dbSNP
rs570486754 5434 dbSNP
rs1379100483 5435 dbSNP
rs1212221311 5454 dbSNP
rs1309100189 5455 dbSNP
rs1412102367 5458 dbSNP
rs1035436906 5459 dbSNP
rs1048294503 5464 dbSNP
rs1206994744 5465 dbSNP
rs1262644868 5467 dbSNP
rs1432788806 5472 dbSNP
rs1412623447 5474 dbSNP
rs778212175 5478 dbSNP
rs184956910 5479 dbSNP
rs991286520 5484 dbSNP
rs1210104731 5489 dbSNP
rs1489250730 5491 dbSNP
rs915712883 5494 dbSNP
rs1040980590 5495 dbSNP
rs899773499 5501 dbSNP
rs1263256580 5502 dbSNP
rs201435955 5507 dbSNP
rs199750916 5509 dbSNP
rs1243440858 5518 dbSNP
rs1454597681 5528 dbSNP
rs969051600 5531 dbSNP
rs1289550374 5532 dbSNP
rs200541750 5533 dbSNP
rs996501086 5534 dbSNP
rs1349066343 5535 dbSNP
rs778367882 5546 dbSNP
rs1328602139 5556 dbSNP
rs561616865 5559 dbSNP
rs1291933688 5563 dbSNP
rs904203815 5567 dbSNP
rs1457494702 5572 dbSNP
rs998574098 5574 dbSNP
rs1161344751 5575 dbSNP
rs1454858656 5577 dbSNP
rs924503468 5581 dbSNP
rs1031844411 5583 dbSNP
rs1434621938 5584 dbSNP
rs1264868219 5585 dbSNP
rs895978001 5588 dbSNP
rs1014416769 5591 dbSNP
rs1389454266 5593 dbSNP
rs1023157651 5597 dbSNP
rs970313478 5606 dbSNP
rs770729293 5609 dbSNP
rs922720865 5625 dbSNP
rs1211199371 5633 dbSNP
rs776402721 5642 dbSNP
rs1327689522 5645 dbSNP
rs974077507 5655 dbSNP
rs537546864 5664 dbSNP
rs932682947 5666 dbSNP
rs868228720 5670 dbSNP
rs888593058 5670 dbSNP
rs1006116951 5672 dbSNP
rs747538178 5675 dbSNP
rs983522260 5679 dbSNP
rs759158930 5680 dbSNP
rs1235500078 5687 dbSNP
rs1306856328 5690 dbSNP
rs912014749 5692 dbSNP
rs769426696 5703 dbSNP
rs1455629422 5706 dbSNP
rs1387825134 5730 dbSNP
rs1423508258 5735 dbSNP
rs943834863 5742 dbSNP
rs4257823 5744 dbSNP
rs921110350 5749 dbSNP
rs932530803 5750 dbSNP
rs1186134447 5752 dbSNP
rs1463992207 5758 dbSNP
rs1284214473 5762 dbSNP
rs1261362053 5772 dbSNP
rs1201475057 5783 dbSNP
rs1488230416 5784 dbSNP
rs1254597212 5790 dbSNP
rs1373021511 5792 dbSNP
rs1233927787 5795 dbSNP
rs1366185014 5802 dbSNP
rs1212048427 5803 dbSNP
rs1043367556 5804 dbSNP
rs904153748 5809 dbSNP
rs1325882880 5810 dbSNP
rs934352947 5811 dbSNP
rs1052873565 5814 dbSNP
rs9446914 5817 dbSNP
rs1420787606 5820 dbSNP
rs1430107244 5821 dbSNP
rs968603175 5830 dbSNP
rs978986645 5837 dbSNP
rs1448370670 5848 dbSNP
rs1237527178 5851 dbSNP
rs571754959 5854 dbSNP
rs189411822 5855 dbSNP
rs1254583362 5866 dbSNP
rs1210633458 5872 dbSNP
rs550680671 5892 dbSNP
rs535345447 5893 dbSNP
rs1166578024 5905 dbSNP
rs1394793377 5911 dbSNP
rs1338871956 5926 dbSNP
rs1284852969 5934 dbSNP
rs1338645931 5937 dbSNP
rs1031619278 5943 dbSNP
rs1410237834 5945 dbSNP
rs1442045877 5947 dbSNP
rs1164481894 5948 dbSNP
rs1225837074 5948 dbSNP
rs1367267982 5948 dbSNP
rs1372121685 5948 dbSNP
rs1408977797 5948 dbSNP
rs1471490537 5948 dbSNP
rs1483613888 5948 dbSNP
rs201035809 5948 dbSNP
rs1297929555 5954 dbSNP
rs1203360292 5971 dbSNP
rs1254376713 5971 dbSNP
rs1371692160 5971 dbSNP
rs1454178263 5972 dbSNP
rs1290783772 5976 dbSNP
rs1393632103 5976 dbSNP
rs1230101735 5977 dbSNP
rs1354294924 5978 dbSNP
rs1409800493 5979 dbSNP
rs569035162 5980 dbSNP
rs1392377327 5982 dbSNP
rs1474658137 5984 dbSNP
rs866982662 5985 dbSNP
rs1441101444 5988 dbSNP
rs386702674 5989 dbSNP
rs386702675 5989 dbSNP
rs1167718488 5991 dbSNP
rs1325038839 5992 dbSNP
rs1391671036 5993 dbSNP
rs1407297394 5994 dbSNP
rs1393066314 5998 dbSNP
rs374004424 6004 dbSNP
rs1275225140 6005 dbSNP
rs1323903874 6008 dbSNP
rs1393910506 6011 dbSNP
rs1334002709 6013 dbSNP
rs1440077727 6014 dbSNP
rs34293730 6015 dbSNP
rs1175860153 6016 dbSNP
rs1327960577 6018 dbSNP
rs1224908904 6019 dbSNP
rs1269413269 6020 dbSNP
rs1356534923 6021 dbSNP
rs1234768262 6023 dbSNP
rs1204155400 6024 dbSNP
rs1270720269 6026 dbSNP
rs1223993907 6031 dbSNP
rs13199647 6036 dbSNP
rs13215889 6040 dbSNP
rs976751429 6047 dbSNP
rs13199954 6048 dbSNP
rs1481534111 6053 dbSNP
rs922562505 6054 dbSNP
rs1255403954 6057 dbSNP
rs754570202 6058 dbSNP
rs557023778 6062 dbSNP
rs554586775 6064 dbSNP
rs1223003956 6065 dbSNP
rs932735122 6067 dbSNP
rs1276299156 6070 dbSNP
rs1433815477 6077 dbSNP
rs985567064 6078 dbSNP
rs1320620729 6080 dbSNP
rs1391470371 6083 dbSNP
rs13199865 6086 dbSNP
rs909944930 6096 dbSNP
rs1167952167 6099 dbSNP
rs77517343 6100 dbSNP
rs1353116722 6102 dbSNP
rs1400517387 6103 dbSNP
rs1463853439 6104 dbSNP
rs78232246 6104 dbSNP
rs1299181026 6106 dbSNP
rs386702676 6110 dbSNP
rs1252520016 6111 dbSNP
rs77325433 6111 dbSNP
rs80179048 6112 dbSNP
rs572896088 6113 dbSNP
rs941573150 6115 dbSNP
rs1214957328 6116 dbSNP
rs13199878 6118 dbSNP
rs1037604346 6126 dbSNP
rs1280467579 6134 dbSNP
rs1217174828 6135 dbSNP
rs534617977 6137 dbSNP
rs1161492600 6139 dbSNP
rs1308979247 6142 dbSNP
rs149187906 6143 dbSNP
rs77044723 6144 dbSNP
rs180893245 6145 dbSNP
rs11757052 6146 dbSNP
rs1178674996 6149 dbSNP
rs1257586252 6152 dbSNP
rs796138187 6153 dbSNP
rs10943097 6154 dbSNP
rs12200849 6156 dbSNP
rs1451461252 6158 dbSNP
rs1259705170 6161 dbSNP
rs1421219160 6163 dbSNP
rs10943098 6169 dbSNP
rs1483528124 6170 dbSNP
rs1239069715 6171 dbSNP
rs1171596068 6172 dbSNP
rs10943099 6174 dbSNP
rs10943100 6180 dbSNP
rs1443478582 6181 dbSNP
rs1230137697 6186 dbSNP
rs1315445859 6190 dbSNP
rs1339507323 6200 dbSNP
rs79445811 6201 dbSNP
rs78661863 6202 dbSNP
rs62438387 6206 dbSNP
rs1364390994 6209 dbSNP
rs7770360 6210 dbSNP
rs1214561122 6218 dbSNP
rs1394748902 6220 dbSNP
rs372333175 6221 dbSNP
rs77643365 6222 dbSNP
rs377124579 6223 dbSNP
rs1380550363 6224 dbSNP
rs369182473 6228 dbSNP
rs111525451 6230 dbSNP
rs372182438 6231 dbSNP
rs375286633 6232 dbSNP
rs368977143 6242 dbSNP
rs1345537608 6243 dbSNP
rs372662257 6245 dbSNP
rs377478097 6246 dbSNP
rs540660669 6247 dbSNP
rs1213058985 6248 dbSNP
rs369938949 6250 dbSNP
rs185305187 6251 dbSNP
rs1424399762 6252 dbSNP
rs149822557 6255 dbSNP
rs1192687304 6256 dbSNP
rs1019027081 6257 dbSNP
rs372044397 6258 dbSNP
rs1294335457 6259 dbSNP
rs1228311332 6261 dbSNP
rs545097870 6262 dbSNP
rs974841718 6263 dbSNP
rs3013722 6266 dbSNP
rs1322958186 6270 dbSNP
rs1295680070 6276 dbSNP
rs189621737 6280 dbSNP
rs181847613 6284 dbSNP
rs1231963534 6286 dbSNP
rs921058003 6289 dbSNP
rs543072744 6294 dbSNP
rs1412000650 6297 dbSNP
rs1394610336 6306 dbSNP
rs1297779747 6312 dbSNP
rs978691019 6316 dbSNP
rs1351662326 6324 dbSNP
rs1022696351 6334 dbSNP
rs145838786 6336 dbSNP
rs1000072139 6343 dbSNP
rs1184099030 6352 dbSNP
rs1417017074 6356 dbSNP
rs1249421744 6365 dbSNP
rs1210012600 6376 dbSNP
rs1270723195 6378 dbSNP
rs1212431126 6384 dbSNP
rs1334779972 6385 dbSNP
rs1269244388 6393 dbSNP
rs1241660632 6394 dbSNP
rs1431735713 6398 dbSNP
rs1334296527 6402 dbSNP
rs1306615571 6404 dbSNP
rs1387537311 6406 dbSNP
rs542641173 6407 dbSNP
rs1369911256 6422 dbSNP
rs1031882170 6434 dbSNP
rs1460935781 6440 dbSNP
rs369525635 6443 dbSNP
rs1325560173 6450 dbSNP
rs955989697 6452 dbSNP
rs1161237085 6454 dbSNP
rs1368431264 6458 dbSNP
rs1236231867 6461 dbSNP
rs934328278 6463 dbSNP
rs1362988923 6466 dbSNP
rs1199210394 6477 dbSNP
rs1053229040 6480 dbSNP
rs560723905 6481 dbSNP
rs1250688547 6482 dbSNP
rs1222042647 6485 dbSNP
rs673265 6486 dbSNP
rs954056373 6488 dbSNP
rs1349031006 6491 dbSNP
rs1260504492 6494 dbSNP
rs1044128749 6510 dbSNP
rs906007463 6519 dbSNP
rs540583859 6520 dbSNP
rs1234319511 6524 dbSNP
rs985450899 6532 dbSNP
rs1301441824 6542 dbSNP
rs1440304510 6545 dbSNP
rs1365963552 6552 dbSNP
rs995448768 6554 dbSNP
rs941405260 6559 dbSNP
rs1384047332 6567 dbSNP
rs1317063203 6576 dbSNP
rs1049316511 6585 dbSNP
rs1467327547 6613 dbSNP
rs972935880 6615 dbSNP
rs1392910448 6621 dbSNP
rs187079041 6627 dbSNP
rs1250771714 6636 dbSNP
rs1249307538 6640 dbSNP
rs939625198 6642 dbSNP
rs74876960 6651 dbSNP
rs1195929060 6652 dbSNP
rs1247698676 6655 dbSNP
rs1261576550 6664 dbSNP
rs761542908 6666 dbSNP
rs144342190 6675 dbSNP
rs948421310 6677 dbSNP
rs1044449343 6680 dbSNP
rs1343015461 6683 dbSNP
rs1271987379 6686 dbSNP
rs1225259928 6705 dbSNP
rs904274833 6710 dbSNP
rs1000318809 6714 dbSNP
rs1416411612 6721 dbSNP
rs1018932403 6722 dbSNP
rs1373368535 6725 dbSNP
rs966035958 6728 dbSNP
rs996227901 6730 dbSNP
rs550793972 6750 dbSNP
rs953899161 6755 dbSNP
rs1373043494 6756 dbSNP
rs998007323 6756 dbSNP
rs1029620354 6759 dbSNP
rs1392578450 6768 dbSNP
rs979028896 6770 dbSNP
rs1476420851 6776 dbSNP
rs1442773310 6795 dbSNP
rs953940780 6799 dbSNP
rs555284724 6802 dbSNP
rs111671800 6812 dbSNP
rs9446915 6813 dbSNP
rs988709218 6816 dbSNP
rs962843161 6818 dbSNP
rs674708 6821 dbSNP
rs1350698186 6830 dbSNP
rs949730015 6831 dbSNP
rs566763243 6854 dbSNP
rs747408269 6854 dbSNP
rs1235026043 6868 dbSNP
rs1044117407 6900 dbSNP
rs1232178354 6905 dbSNP
rs1355925451 6906 dbSNP
rs781684014 6906 dbSNP
rs376473533 6914 dbSNP
rs1326403287 6915 dbSNP
rs1408886647 6916 dbSNP
rs1362153061 6918 dbSNP
rs1390799144 6925 dbSNP
rs1336452147 6926 dbSNP
rs1476471689 6935 dbSNP
rs1416253510 6937 dbSNP
rs927074780 6942 dbSNP
rs1213986283 6946 dbSNP
rs868767066 6949 dbSNP
rs1234836113 6952 dbSNP
rs201265239 6953 dbSNP
rs1437353755 6960 dbSNP
rs1290672665 6961 dbSNP
rs992277197 6962 dbSNP
rs1049666180 6965 dbSNP
rs191936082 6969 dbSNP
rs553015202 6971 dbSNP
rs1040654868 6972 dbSNP
rs571593437 6974 dbSNP
rs1451531267 6975 dbSNP
rs183250787 6976 dbSNP
rs1459352739 6977 dbSNP
rs563059779 6979 dbSNP
rs12525146 6981 dbSNP
rs1164121819 6982 dbSNP
rs1395425324 6985 dbSNP
rs542751608 6987 dbSNP
rs968569314 6989 dbSNP
rs1050876555 6993 dbSNP
rs1000973115 6995 dbSNP
rs1033238232 7000 dbSNP
rs1006785928 7002 dbSNP
rs1209253927 7004 dbSNP
rs955902935 7009 dbSNP
rs554513624 7010 dbSNP
rs1281882784 7014 dbSNP
rs572769694 7015 dbSNP
rs1290883956 7018 dbSNP
rs186554007 7019 dbSNP
rs971034952 7025 dbSNP
rs1345285647 7026 dbSNP
rs77785482 7029 dbSNP
rs1305119042 7035 dbSNP
rs979762624 7036 dbSNP
rs1339073414 7038 dbSNP
rs926991713 7039 dbSNP
rs1432100501 7040 dbSNP
rs1347372915 7041 dbSNP
rs542538288 7045 dbSNP
rs1400425901 7046 dbSNP
rs1483649630 7047 dbSNP
rs1395956027 7049 dbSNP
rs992287200 7050 dbSNP
rs916713638 7054 dbSNP
rs1048805060 7057 dbSNP
rs908001548 7058 dbSNP
rs577161256 7059 dbSNP
rs1040644859 7060 dbSNP
rs1474281169 7061 dbSNP
rs902118620 7062 dbSNP
rs560808554 7063 dbSNP
rs113353216 7067 dbSNP
rs1346604672 7068 dbSNP
rs530096481 7070 dbSNP
rs761805104 7071 dbSNP
rs1311061594 7072 dbSNP
rs190087440 7073 dbSNP
rs1031093538 7087 dbSNP
rs1396116978 7088 dbSNP
rs1315059075 7089 dbSNP
rs1317132915 7099 dbSNP
rs1324353348 7100 dbSNP
rs2945628 7103 dbSNP
rs1272265073 7104 dbSNP
rs889602806 7105 dbSNP
rs527663361 7106 dbSNP
rs552575962 7109 dbSNP
rs1485146998 7110 dbSNP
rs182330329 7111 dbSNP
rs1206052164 7112 dbSNP
rs1305210454 7112 dbSNP
rs3013723 7113 dbSNP
rs1486667220 7115 dbSNP
rs1201138944 7120 dbSNP
rs772755623 7128 dbSNP
rs202133260 7135 dbSNP
rs186612362 7136 dbSNP
rs552102885 7138 dbSNP
rs370647076 7143 dbSNP
rs1471152526 7144 dbSNP
rs951753514 7146 dbSNP
rs984938559 7147 dbSNP
rs1171614070 7152 dbSNP
rs879653380 7156 dbSNP
rs554344898 7159 dbSNP
rs1466064771 7160 dbSNP
rs572925008 7160 dbSNP
rs533541850 7161 dbSNP
rs558571749 7165 dbSNP
rs1250264107 7166 dbSNP
rs1198635799 7167 dbSNP
rs577078881 7168 dbSNP
rs1275527223 7170 dbSNP
rs969552091 7172 dbSNP
rs570374003 7174 dbSNP
rs1308027681 7175 dbSNP
rs1393356508 7179 dbSNP
rs1371347087 7180 dbSNP
rs1297690897 7182 dbSNP
rs1441638025 7183 dbSNP
rs562709160 7185 dbSNP
rs979617993 7189 dbSNP
rs1033048111 7192 dbSNP
rs956938928 7194 dbSNP
rs1440659370 7197 dbSNP
rs56375536 7198 dbSNP
rs56104432 7199 dbSNP
rs903820160 7200 dbSNP
rs936719851 7202 dbSNP
rs1212330503 7206 dbSNP
rs933749426 7207 dbSNP
rs1052947848 7208 dbSNP
rs188649308 7212 dbSNP
rs1260210288 7215 dbSNP
rs1315350583 7217 dbSNP
rs910963211 7218 dbSNP
rs1010012684 7221 dbSNP
rs193164820 7222 dbSNP
rs567888815 7226 dbSNP
rs1191544311 7229 dbSNP
rs1001371154 7230 dbSNP
rs1433678344 7233 dbSNP
rs1034303486 7237 dbSNP
rs1361553905 7239 dbSNP
rs1173850757 7240 dbSNP
rs1392717811 7241 dbSNP
rs1455223655 7241 dbSNP
rs1491127567 7241 dbSNP
rs869231502 7241 dbSNP
rs11332740 7242 dbSNP
rs1232550104 7242 dbSNP
rs1233707501 7242 dbSNP
rs1262957866 7242 dbSNP
rs1285641351 7242 dbSNP
rs1297586844 7242 dbSNP
rs1326960565 7242 dbSNP
rs143680976 7242 dbSNP
rs544266610 7242 dbSNP
rs746128990 7242 dbSNP
rs761042479 7242 dbSNP
rs773934075 7242 dbSNP
rs776830402 7242 dbSNP
rs879085734 7242 dbSNP
rs1454907744 7243 dbSNP
rs78490871 7247 dbSNP
rs1393318107 7248 dbSNP
rs898407121 7253 dbSNP
rs929873591 7254 dbSNP
rs1459583551 7264 dbSNP
rs63532261 7266 dbSNP
rs951798206 7267 dbSNP
rs1324281548 7269 dbSNP
rs1436181866 7270 dbSNP
rs984495775 7273 dbSNP
rs552242514 7278 dbSNP
rs1370256620 7282 dbSNP
rs896466841 7292 dbSNP
rs1172475815 7295 dbSNP
rs535310149 7298 dbSNP
rs1015072293