miRTarBase - #MIRT619247 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TIAL1   
Synonyms TCBP, TIAR
Description TIA1 cytotoxic granule associated RNA binding protein like 1
Transcript NM_001033925   
Other Transcripts NM_003252   
Expression
Putative miRNA Targets on TIAL1
3'UTR of TIAL1
(miRNA target sites are highlighted)
>TIAL1|NM_001033925|3'UTR
   1 GCCGGGACTCTAAAAAAAAATTGTAATTCATGATAGGCTTCGATTTCCTGTGACACTCTGAAGACATGAAAGTAGACATC
  81 GGAAAATGAAAATATTTATTTTAAAAATTGAAATGTTTGGAACCTTTAGCACAGATTTGCTTTGGTGAAGGACACGTGTC
 161 TTCTAGTTCTGCCTTTTTAAGTTTTTGTTCATGATGGATATGAACATGATTTTTCTTTATGTACAAAAACTAAAATAAAG
 241 TCAATAAAGACAATTCTGACTACAAATTTTGATATAATAGGAAAAATGGCTAATACATTTTGATTCTTAGATACTATTCC
 321 ATTTTTATCTTGCTGTTCAGTATTTTAACTCACTGTGTTTTTAAAAGAGCAAAAAAGGGAGGATCGTGAAAACCTGGGAA
 401 TCACATATAAGTTCATCCTGAATCCTGATACTCCCCTCCCCTTCCCTGAGGTGGACCACATTTGAAGTCAGCAGAGAAAA
 481 AGTGTGATATTCAGAAGAAATGCGTGATTTTGGAGTCGCTTTGGAGGAAATATTTTCTTTCTCTATGCCTAAAGAAACTG
 561 AAGCCAGACTGAAGTTTTGCACCCTAAAAAAGGAACAGCATTGTTTGAGTTACTTGAGCAAATGTTGGTGGTCCACGTTA
 641 AGACATATTTTTAAAACTTCCAAAAGTGTCGATTATTAAAATTGTAGTATTTTACATTTCATTTTGGGGGGAAATCCAAG
 721 TATGGTGTTTGTATTGAAGTCAGACAGTCATACTTGTGCTTTTACATGAAGTTTAAATGATACATATTGTAAATATTCAA
 801 TAACTACAGTGTTTAAAAAGCATGCTTCAACATAGAAGTAGCAGCAATGTAATTATTTGAAGTAACACTTAACACACTCC
 881 GCTGCATTGAATGCAGTGGATTGATCAGAATGTTAAGACTGACATTTCCAAGGTTGGCTACTATGTAAAATTAAAATTAC
 961 ACAAATTGTGCAGAAAAAGCCTTAATTTTAATTTCATACAATCTTTGATGCATTAGTATGTTCTAAAATGTCATTGGGAA
1041 TTAGTTTTTTGTTTTTGTTTTTTTTTTTTTTTTTTTTTGCTTTACATTACTTGGTATGTAAATACCTTGATTAAAACCTT
1121 GTAAACCAATTTCAAGGTTACTATAAGTTGTATAGTACAAGTGTTTTTTAAAAATCTTGGGGTGTTTTTAAAAATTAAGA
1201 TATATTTTGCCCAAGAATTTTTTTAACAAGATTGCTAAAAACATCTTATTTAGACACTTCAATGTACCAATTTATAATTG
1281 GATATTCAGTTTAAATAGTACACAGAGTTGTGGCTTTTATTTTCAATTAATTTTTTTCCTTGTGGGCAGTGTGCATGGTA
1361 TAATAAGCCTGAGCAGAGGCTTAAGTTGTATGTGTGCAGAGTTTGTAAAGGAATCAATTGGAAGATGCAGAAGACCGAGG
1441 TTTGCTTTCAAGGTATTTTTCAGGCTGTGTGGGTAAAATTTGCCTCAAATTTCTATCAAACAGGAATGTAAAATAGATAA
1521 AATCCTATGTATTTGAATTGTCAGAGCTAGGGAGTGCAAATGTTTTGGCAATGTATTCAAAATGCTGGCCTGGGCACCAA
1601 AGAGAAAATAGCCTTTTACAGTTACATAGTAAGATGCGATTAGTACCCACAAATTACTGTTTTCTAAACATTTGAAGTTT
1681 TACGATTAGCTTTAAAATAATGATTTTATAAATTGGTGGTCACAATAATTTTGGTATTACTTTCCTCCTTTTCCCACTTA
1761 GCAATATAGCCAAATGTATTCAACATAAAAATTCATAGGGTCTGAAATTCATAGCTGGGCCAAATTTTTTATGGCACCTT
1841 AGTTTTACCATAATGGTCATCTATTACACTCTTCTGTTATAAAATATACCCTTATTTCTTTTGTTTATAGTATCTTTGAG
1921 GAATGTTTTTGGAAAAGTTAATTTATATTTTATAGGGAGAACACTCAATAAATTATGTTAACTGTGCCCCCGAGTTAAAA
2001 ATTTTATGAGTATATGTGAAACTTGAACAACTGAAGACTTTTTTTAATTGATAAAAATGCTTAGTATGCCTGTTTTGGTC
2081 TGCCAGTAAATTAAGTAGCTTATTGAGATAACTAACAGCTAAATATAGCTGTAGTGTTTCCTGACTGTATATTCTATGAT
2161 TTAATAAAATTATCCAGACTAGTTATATTGCCACAGTAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |||||  ||  |||||||| 
Target 5' gtAACAC--TTAACACACTCCg 3'
862 - 881 164.00 -19.10
2
miRNA  3' guUUGUGG--UAACAGUGUGAGGu 5'
            ||||:|  |||   |||||:| 
Target 5' aaAACATCTTATTTAGACACTTCa 3'
1238 - 1261 146.00 -14.34
3
miRNA  3' guUUG-UGGUA-ACAGUGUGAGGu 5'
            ||: ::||| | |:||||||: 
Target 5' atAATGGTCATCTATTACACTCTt 3'
1850 - 1873 144.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2374677 12 COSMIC
COSN30718873 12 COSMIC
COSN30135461 41 COSMIC
COSN31601975 63 COSMIC
COSN31610579 80 COSMIC
COSN30519709 105 COSMIC
COSN18734778 116 COSMIC
COSN31587955 155 COSMIC
COSN30460673 173 COSMIC
COSN31546231 188 COSMIC
COSN30160887 208 COSMIC
COSN31521706 263 COSMIC
COSN26633368 367 COSMIC
COSN31577322 592 COSMIC
COSN31524109 688 COSMIC
COSN29788251 815 COSMIC
COSN30173218 819 COSMIC
COSN22337253 921 COSMIC
COSN16008512 1358 COSMIC
COSN23385571 1652 COSMIC
COSN29743262 1671 COSMIC
COSN15692018 1863 COSMIC
COSN16130388 2050 COSMIC
COSN1473654 2066 COSMIC
COSN29499576 2157 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs371811314 2 dbSNP
rs772511363 3 dbSNP
rs748683256 4 dbSNP
rs1419855207 9 dbSNP
rs745533594 12 dbSNP
rs756751746 12 dbSNP
rs1491272632 13 dbSNP
rs1280646828 16 dbSNP
rs1353477856 17 dbSNP
rs1208377798 18 dbSNP
rs73366847 20 dbSNP
rs746918865 20 dbSNP
rs200630840 21 dbSNP
rs777538092 21 dbSNP
rs371998825 23 dbSNP
rs1469309347 30 dbSNP
rs773689402 33 dbSNP
rs748747035 36 dbSNP
rs1182704036 37 dbSNP
rs1365398289 38 dbSNP
rs779714114 39 dbSNP
rs1039878816 41 dbSNP
rs755726615 42 dbSNP
rs750202071 50 dbSNP
rs781030286 51 dbSNP
rs937079808 60 dbSNP
rs1426355247 66 dbSNP
rs1220794813 71 dbSNP
rs942876799 77 dbSNP
rs190349256 78 dbSNP
rs1438197724 80 dbSNP
rs1338004224 95 dbSNP
rs1243298164 98 dbSNP
rs1315017125 108 dbSNP
rs1360592049 114 dbSNP
rs1248701995 120 dbSNP
rs1272750693 148 dbSNP
rs1051392344 156 dbSNP
rs1196395933 166 dbSNP
rs185036091 178 dbSNP
rs1331347073 179 dbSNP
rs1440588134 190 dbSNP
rs1186707705 191 dbSNP
rs767006818 195 dbSNP
rs1464642940 198 dbSNP
rs1243722876 203 dbSNP
rs1446211507 206 dbSNP
rs1353325675 224 dbSNP
rs1178837194 231 dbSNP
rs566873827 236 dbSNP
rs564146783 240 dbSNP
rs774047928 240 dbSNP
rs1424856505 242 dbSNP
rs1330378389 248 dbSNP
rs1399395243 253 dbSNP
rs966207366 259 dbSNP
rs918223056 274 dbSNP
rs772530282 281 dbSNP
rs1192013556 287 dbSNP
rs529335244 292 dbSNP
rs1454852235 302 dbSNP
rs1295876619 313 dbSNP
rs1441717125 316 dbSNP
rs1238873996 324 dbSNP
rs144276430 330 dbSNP
rs1253337060 332 dbSNP
rs1342926501 339 dbSNP
rs1203173482 340 dbSNP
rs1263673796 343 dbSNP
rs1456489771 344 dbSNP
rs1186386676 348 dbSNP
rs974157147 349 dbSNP
rs1019109014 352 dbSNP
rs1428941304 353 dbSNP
rs1194852253 355 dbSNP
rs941089145 373 dbSNP
rs1375640162 377 dbSNP
rs927068486 381 dbSNP
rs1176528240 385 dbSNP
rs953438343 386 dbSNP
rs376465689 388 dbSNP
rs1249587290 390 dbSNP
rs1361656534 391 dbSNP
rs11199023 394 dbSNP
rs1383176750 398 dbSNP
rs1212098884 399 dbSNP
rs748711274 403 dbSNP
rs1000166312 404 dbSNP
rs979892069 405 dbSNP
rs1284028101 406 dbSNP
rs1325543579 407 dbSNP
rs1206709007 410 dbSNP
rs1231627343 419 dbSNP
rs1355488554 433 dbSNP
rs1206748602 434 dbSNP
rs1486066553 434 dbSNP
rs540422720 435 dbSNP
rs1024640208 438 dbSNP
rs1014517962 440 dbSNP
rs1445459415 444 dbSNP
rs988710610 455 dbSNP
rs956164640 462 dbSNP
rs1471344603 467 dbSNP
rs1030979685 469 dbSNP
rs1226705956 481 dbSNP
rs578128907 503 dbSNP
rs779582945 504 dbSNP
rs868737729 507 dbSNP
rs1449338674 515 dbSNP
rs139632112 517 dbSNP
rs1172091249 518 dbSNP
rs1018406153 532 dbSNP
rs1284213575 533 dbSNP
rs1381217643 539 dbSNP
rs1226717248 541 dbSNP
rs1347444787 541 dbSNP
rs1048546290 545 dbSNP
rs1317454048 545 dbSNP
rs1417437296 546 dbSNP
rs1240852236 563 dbSNP
rs929620915 566 dbSNP
rs919523105 568 dbSNP
rs1007063841 589 dbSNP
rs766711922 594 dbSNP
rs1270653557 596 dbSNP
rs1483497230 607 dbSNP
rs146778667 625 dbSNP
rs866112702 628 dbSNP
rs944934275 628 dbSNP
rs182472972 630 dbSNP
rs773641173 636 dbSNP
rs773789171 637 dbSNP
rs1303973639 639 dbSNP
rs1367766493 645 dbSNP
rs555385867 646 dbSNP
rs527360362 649 dbSNP
rs1297696586 651 dbSNP
rs1373902563 660 dbSNP
rs1393096969 662 dbSNP
rs1310531969 663 dbSNP
rs941058045 667 dbSNP
rs1246515688 669 dbSNP
rs190195287 671 dbSNP
rs1314176705 675 dbSNP
rs979187935 685 dbSNP
rs979860903 688 dbSNP
rs1232986572 690 dbSNP
rs143589330 705 dbSNP
rs949811717 710 dbSNP
rs73366846 711 dbSNP
rs183824129 713 dbSNP
rs1164616091 715 dbSNP
rs1387255337 718 dbSNP
rs1408456659 726 dbSNP
rs1169775739 728 dbSNP
rs955965576 733 dbSNP
rs1033373199 734 dbSNP
rs979421360 741 dbSNP
rs1370272714 749 dbSNP
rs968082134 751 dbSNP
rs1001291542 766 dbSNP
rs539218530 770 dbSNP
rs888201165 786 dbSNP
rs1018292424 787 dbSNP
rs144383599 793 dbSNP
rs1308736541 799 dbSNP
rs1207498788 800 dbSNP
rs1261747338 806 dbSNP
rs1438804186 807 dbSNP
rs1048122298 825 dbSNP
rs994307391 831 dbSNP
rs1245385382 842 dbSNP
rs896840562 844 dbSNP
rs1185666752 860 dbSNP
rs1186122378 862 dbSNP
rs1006943013 864 dbSNP
rs1489168667 867 dbSNP
rs1041103536 871 dbSNP
rs750012803 875 dbSNP
rs550575916 877 dbSNP
rs1174374853 878 dbSNP
rs372483277 880 dbSNP
rs1266841439 881 dbSNP
rs1221740047 891 dbSNP
rs944972731 891 dbSNP
rs1320568895 896 dbSNP
rs1029805543 897 dbSNP
rs1429838969 914 dbSNP
rs1270406788 916 dbSNP
rs1363648440 926 dbSNP
rs879029995 930 dbSNP
rs994766147 932 dbSNP
rs1323405759 939 dbSNP
rs1204829577 941 dbSNP
rs191578959 942 dbSNP
rs781014441 943 dbSNP
rs1445620427 945 dbSNP
rs1277887345 949 dbSNP
rs757068922 953 dbSNP
rs1038622520 955 dbSNP
rs1215600675 958 dbSNP
rs1242849556 960 dbSNP
rs963176586 964 dbSNP
rs1380880864 985 dbSNP
rs1197300457 995 dbSNP
rs1428719311 999 dbSNP
rs1480833373 1000 dbSNP
rs905497373 1001 dbSNP
rs1393215099 1011 dbSNP
rs1050585695 1018 dbSNP
rs575591782 1020 dbSNP
rs1402755465 1023 dbSNP
rs879114031 1024 dbSNP
rs1302188801 1034 dbSNP
rs1332631492 1035 dbSNP
rs1457501578 1036 dbSNP
rs1345567480 1039 dbSNP
rs1321289245 1040 dbSNP
rs1389345623 1043 dbSNP
rs1439847862 1043 dbSNP
rs927472212 1044 dbSNP
rs1162736829 1045 dbSNP
rs1478731706 1048 dbSNP
rs1455251483 1049 dbSNP
rs200599058 1051 dbSNP
rs1349165882 1052 dbSNP
rs949806556 1052 dbSNP
rs1220511065 1053 dbSNP
rs917010101 1055 dbSNP
rs1490533090 1056 dbSNP
rs111740135 1057 dbSNP
rs1201692100 1057 dbSNP
rs369406993 1058 dbSNP
rs5788360 1058 dbSNP
rs1269086093 1060 dbSNP
rs1052945948 1061 dbSNP
rs1422564652 1061 dbSNP
rs560771367 1061 dbSNP
rs1280685139 1062 dbSNP
rs548960485 1062 dbSNP
rs1193447715 1063 dbSNP
rs1244323582 1063 dbSNP
rs1356281260 1063 dbSNP
rs529252152 1063 dbSNP
rs967849500 1064 dbSNP
rs978638690 1064 dbSNP
rs1162696399 1065 dbSNP
rs1385409168 1065 dbSNP
rs1442534901 1065 dbSNP
rs563224031 1066 dbSNP
rs796527757 1066 dbSNP
rs1249886169 1067 dbSNP
rs911194436 1067 dbSNP
rs1259833056 1068 dbSNP
rs1338808827 1068 dbSNP
rs1459933239 1069 dbSNP
rs574920715 1069 dbSNP
rs913271065 1069 dbSNP
rs993230290 1070 dbSNP
rs1372215876 1071 dbSNP
rs1467655888 1072 dbSNP
rs1169156801 1073 dbSNP
rs1270667274 1077 dbSNP
rs1202923560 1079 dbSNP
rs1228166505 1079 dbSNP
rs1280196972 1079 dbSNP
rs1293693955 1079 dbSNP
rs1321282831 1079 dbSNP
rs1326074828 1079 dbSNP
rs1336699465 1079 dbSNP
rs1398214497 1079 dbSNP
rs1403023021 1079 dbSNP
rs1407274142 1079 dbSNP
rs1468734965 1079 dbSNP
rs369013335 1079 dbSNP
rs376646404 1079 dbSNP
rs1302922520 1080 dbSNP
rs1426553144 1080 dbSNP
rs374704870 1080 dbSNP
rs1479854672 1082 dbSNP
rs1176323928 1084 dbSNP
rs1201076856 1091 dbSNP
rs1467837668 1091 dbSNP
rs540733236 1093 dbSNP
rs1251228879 1105 dbSNP
rs1383020025 1106 dbSNP
rs1300324055 1109 dbSNP
rs1343693879 1113 dbSNP
rs770451305 1119 dbSNP
rs1283774757 1121 dbSNP
rs1225756007 1136 dbSNP
rs1313894925 1139 dbSNP
rs955465636 1143 dbSNP
rs1030187687 1152 dbSNP
rs1486096797 1156 dbSNP
rs994339022 1160 dbSNP
rs1302278938 1164 dbSNP
rs1490041458 1166 dbSNP
rs1386381895 1171 dbSNP
rs1268594867 1175 dbSNP
rs1435444132 1179 dbSNP
rs1157322268 1180 dbSNP
rs961883118 1188 dbSNP
rs1017060024 1193 dbSNP
rs1034193325 1200 dbSNP
rs952520587 1202 dbSNP
rs1027213474 1203 dbSNP
rs1404348584 1208 dbSNP
rs1333374278 1209 dbSNP
rs1369593360 1215 dbSNP
rs1005729909 1226 dbSNP
rs1401016788 1227 dbSNP
rs113332929 1230 dbSNP
rs186775941 1238 dbSNP
rs1317284597 1242 dbSNP
rs1460311148 1243 dbSNP
rs1044022750 1262 dbSNP
rs564679648 1264 dbSNP
rs1040721084 1268 dbSNP
rs1379113253 1270 dbSNP
rs1199145855 1272 dbSNP
rs1266728715 1278 dbSNP
rs149651974 1283 dbSNP
rs895560365 1285 dbSNP
rs890729114 1289 dbSNP
rs1050637817 1295 dbSNP
rs1053317313 1296 dbSNP
rs1383568035 1302 dbSNP
rs926167084 1305 dbSNP
rs1165800891 1310 dbSNP
rs575997799 1321 dbSNP
rs556143268 1325 dbSNP
rs1297537396 1338 dbSNP
rs1373978223 1338 dbSNP
rs1448639929 1338 dbSNP
rs1457802054 1341 dbSNP
rs1312671373 1346 dbSNP
rs1381532689 1353 dbSNP
rs925740079 1355 dbSNP
rs1291639905 1374 dbSNP
rs1194540404 1375 dbSNP
rs1203288110 1379 dbSNP
rs541800949 1384 dbSNP
rs1251188650 1386 dbSNP
rs1042926626 1394 dbSNP
rs1458623942 1399 dbSNP
rs943246016 1402 dbSNP
rs1347602876 1412 dbSNP
rs1241653247 1415 dbSNP
rs913275361 1417 dbSNP
rs1233858218 1418 dbSNP
rs910497097 1432 dbSNP
rs1416318974 1436 dbSNP
rs985447390 1437 dbSNP
rs1311728615 1453 dbSNP
rs1400875662 1456 dbSNP
rs1467147738 1467 dbSNP
rs1334654410 1477 dbSNP
rs572806318 1484 dbSNP
rs955593848 1485 dbSNP
rs370401028 1494 dbSNP
rs1448554703 1495 dbSNP
rs748614868 1514 dbSNP
rs938663363 1523 dbSNP
rs376798288 1525 dbSNP
rs1213428265 1544 dbSNP
rs776620571 1546 dbSNP
rs980009549 1547 dbSNP
rs952625450 1548 dbSNP
rs1376215643 1554 dbSNP
rs1328136869 1559 dbSNP
rs867563933 1560 dbSNP
rs748894581 1571 dbSNP
rs1404091177 1572 dbSNP
rs1173010700 1573 dbSNP
rs961493043 1580 dbSNP
rs1017033859 1590 dbSNP
rs1233363280 1596 dbSNP
rs1005698557 1599 dbSNP
rs1392931399 1608 dbSNP
rs1239377495 1611 dbSNP
rs1485026992 1611 dbSNP
rs1185960596 1612 dbSNP
rs1160050117 1614 dbSNP
rs1424382044 1619 dbSNP
rs1478870893 1622 dbSNP
rs972942042 1624 dbSNP
rs970270573 1627 dbSNP
rs751316415 1628 dbSNP
rs1013918264 1629 dbSNP
rs961155082 1630 dbSNP
rs1429557520 1631 dbSNP
rs895429856 1637 dbSNP
rs1341823557 1638 dbSNP
rs552759798 1641 dbSNP
rs1031341107 1643 dbSNP
rs1444574241 1644 dbSNP
rs1019757337 1647 dbSNP
rs1257478577 1650 dbSNP
rs1220125637 1657 dbSNP
rs998979066 1664 dbSNP
rs904293508 1678 dbSNP
rs1042895885 1682 dbSNP
rs1484883671 1683 dbSNP
rs1007910929 1684 dbSNP
rs1264240521 1687 dbSNP
rs1489308777 1688 dbSNP
rs1288478558 1701 dbSNP
rs1197367389 1702 dbSNP
rs1268022384 1705 dbSNP
rs1478333724 1705 dbSNP
rs1174288454 1714 dbSNP
rs1405495897 1715 dbSNP
rs1399955894 1716 dbSNP
rs1158873418 1720 dbSNP
rs539544095 1722 dbSNP
rs943213537 1723 dbSNP
rs1350074604 1725 dbSNP
rs866873938 1729 dbSNP
rs1302016720 1733 dbSNP
rs1330986128 1735 dbSNP
rs764022194 1745 dbSNP
rs1247078566 1747 dbSNP
rs1371611579 1754 dbSNP
rs1239961437 1760 dbSNP
rs1052156456 1761 dbSNP
rs996470089 1764 dbSNP
rs1220299279 1766 dbSNP
rs1291094247 1767 dbSNP
rs570483829 1770 dbSNP
rs1413981159 1776 dbSNP
rs933255186 1785 dbSNP
rs1231174771 1792 dbSNP
rs1469380415 1795 dbSNP
rs1179042200 1796 dbSNP
rs557105103 1797 dbSNP
rs1373347127 1800 dbSNP
rs922561655 1805 dbSNP
rs1162577099 1811 dbSNP
rs1299674118 1812 dbSNP
rs972772278 1818 dbSNP
rs762739223 1833 dbSNP
rs184269779 1850 dbSNP
rs904766548 1860 dbSNP
rs909998057 1863 dbSNP
rs754006863 1871 dbSNP
rs1473487369 1873 dbSNP
rs1446431105 1879 dbSNP
rs1043238577 1880 dbSNP
rs984245682 1884 dbSNP
rs3009878 1889 dbSNP
rs1023090563 1891 dbSNP
rs993451834 1898 dbSNP
rs1265734677 1908 dbSNP
rs548085380 1911 dbSNP
rs535422448 1912 dbSNP
rs866219002 1917 dbSNP
rs1057117635 1919 dbSNP
rs938756611 1920 dbSNP
rs1442595298 1924 dbSNP
rs1182579566 1927 dbSNP
rs1368747996 1931 dbSNP
rs1473454667 1939 dbSNP
rs1165664113 1953 dbSNP
rs960330448 1962 dbSNP
rs766364178 1966 dbSNP
rs1332687990 1974 dbSNP
rs1282405929 1976 dbSNP
rs927334058 1977 dbSNP
rs980062123 1978 dbSNP
rs931253276 1979 dbSNP
rs1211761730 1991 dbSNP
rs566880181 1992 dbSNP
rs35272527 2002 dbSNP
rs1317411869 2008 dbSNP
rs904262219 2015 dbSNP
rs546706033 2016 dbSNP
rs961472451 2028 dbSNP
rs1021419665 2030 dbSNP
rs1007397786 2036 dbSNP
rs1443807598 2046 dbSNP
rs558082800 2046 dbSNP
rs953774089 2046 dbSNP
rs1431198684 2048 dbSNP
rs1344302404 2053 dbSNP
rs1315765519 2058 dbSNP
rs1371976585 2059 dbSNP
rs888913291 2062 dbSNP
rs1172008471 2068 dbSNP
rs1051612453 2072 dbSNP
rs533449566 2079 dbSNP
rs1000500974 2080 dbSNP
rs1403136408 2082 dbSNP
rs933205404 2083 dbSNP
rs768752988 2092 dbSNP
rs1022272661 2093 dbSNP
rs1037426801 2094 dbSNP
rs940057953 2101 dbSNP
rs1460286190 2103 dbSNP
rs1400763541 2108 dbSNP
rs1279945397 2110 dbSNP
rs1426404148 2115 dbSNP
rs139348603 2116 dbSNP
rs1194917447 2117 dbSNP
rs1321349235 2119 dbSNP
rs909966819 2126 dbSNP
rs1232197215 2130 dbSNP
rs1475278345 2132 dbSNP
rs1346921523 2139 dbSNP
rs984129688 2158 dbSNP
rs1262105242 2174 dbSNP
rs557330763 2186 dbSNP
rs11813471 2193 dbSNP
rs1488292376 2195 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGCGACAGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGCGACAGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000369093.2 | 3UTR | AUGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000369093.2 | 3UTR | AAAAUGCGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*