miRTarBase - #MIRT620483 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol XKR6   
Synonyms C8orf21, C8orf5, C8orf7, XRG6
Description XK related 6
Transcript NM_173683   
Expression
Putative miRNA Targets on XKR6
3'UTR of XKR6
(miRNA target sites are highlighted)
>XKR6|NM_173683|3'UTR
   1 GAGCATCTTGACCAAGTTGAGAAGGGGACCTTAAGTTTGGTTTGCGGCAAACAGCACTTGCAAGAAATATAACCCTCCCT
  81 TCCCCCAATACACAGAACCACCGCCACCACCACCAACACCGCCACACCAACACCACCACTACAAAAAAAAAAGAATTAAT
 161 AAGTCACAACCCCTTCAAATAAGCTTTCTTTCCAGTCGCTGTATGTATACAAAGATATTCTCTATGTTTTGTAAGTAAAA
 241 ACAAAAAGAAAACCTTTCTTTTGTTTTTTACACATAAGAAACAGTATTGAAAAATCCCACGCTATGGTTCATAGGGTGGA
 321 GAAGGAGGAGTTATCTCCACTCCAAAAGAAAAAAAAAAAGTTTTTTACCTTACACCAAGTGTAGATCATTTATGGGATTG
 401 GTGCTGATTGAAAGAACAAAACAAAACAAAACAAACACAAACAAACAAAAAACCTTCAACTGCCTTATGCCCTTAGGTGC
 481 TGAGTTTCATTAAGTACTGTCACGTTTTCTCATGCAAAACTCTCTGGTGATTTTTGCACCAGAAGAGGGAAAATTAAACA
 561 ATTAAATGAAACAAATCTAAAAGTGAAACAAAAACCAACCAACAAATACAACACAAAGCAATTATTCTTCCTATCTGATT
 641 ATTTGTATTGAAGAAAACAAATTTACCAAAAGCAAAAGCATAAACCCCTCCCTCTTTTCAGTTTCTCCCCCTCCTCTCCT
 721 GACCTTCTCCCCACTTTGCAGAGCCTTCTAGGAGCTCAAGGGCTGTTTGAAACTCAAATGGCTGGAGAAGCTACTTGAAG
 801 GCTGATTATGTGCCATTTTAGCATTTGCCTAGCAAGAATCACATTCGTTTCCCAGTGAAAAGCAAACCAGAACAAAACAA
 881 AAAGCCACCGCAATAATTCGGTAAGGACAGGATATTCTAAAGCAAATTAAAGGAGATTTCTGTACACATAGTCAGTAATA
 961 ATAAAACTCAGCATAGTAGCAAAAAGAACGACATCAGTTTAAAGGCACAATACTTAATCAGTGACTGGCAACAACGATTA
1041 GTTCCATCATTTTAAGGCTGTGAATGGTAGACATTTATCACATGTGATATTGTGTAAAGCCTCTTCTGTTTCCATTTGGT
1121 GGGAAGCCTTAAATTGATCTGGAAAGAATTCTTCATTTTTCATTTGTGCTTTTTTAAAAAAAAAAATAACACAAAGAGGA
1201 AAACTAGAATATATATATATATATACATATATATAAAAAGTCAAAATTGTAATAACTGACCCATTTCAAAGACTGTTTGG
1281 TGCTTCTGTCTTTCACCATTGTGGTTGGCTGAAAATCATTCAGCTCACCTGGTGCATCTGGGTTGAATGGGAAATTTTGT
1361 GTGTGTAGTATGTGTGTGTTTGTGTGTGTATGTGTGTGTGTGCCCATAGCACACGTATATATGTGTGTGTCCCTGCTGCA
1441 AAGTCTTGCCAGAGATATACAAAACTGATGTAAGACGAACTTGGATCACGGCTTGGTTCAGCAGAGCATGGGGGCGGGGG
1521 CTCTGGAGTGGTGGGGAAGTGATGCTGCCTGCCCACGAGCCCTGGTTTGGGTGGCAAGACTCACACCAGCAGCGGACTGC
1601 AGGCCTTAGAGGCCATGCCATTTGGGTGAGGATTTGATTCCACTGTTTATTTTCTCATTGTATCAAGTTGAATTTCTGCA
1681 GGTGTTGCAAGTATGTTCAACGATTTAAATTTTTTTTTATTTTTCAAAGTATTGTTCCTTTAAAGAATATTTCTGTTCTA
1761 GGGCATCGTTTCAATCGCATCGTATCTCTACTTGGGCACAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGU-AAC---------AGUGUGAGGu 5'
            |||| || |||         | || |||| 
Target 5' caAACAGCACTTGCAAGAAATATAACCCTCCc 3'
48 - 79 120.00 -10.72
2
miRNA  3' guuugugguaacaguGUGAGGu 5'
                         |||||| 
Target 5' aggaggagttatctcCACTCCa 3'
323 - 344 120.00 -13.50
3
miRNA  3' guUUGUGGUAACAGUGUGAGgu 5'
            |:||  |   |||||:||  
Target 5' ctAGCA--AGAATCACATTCgt 3'
829 - 848 116.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30463001 7 COSMIC
COSN30496610 8 COSMIC
COSN30159953 21 COSMIC
COSN14317349 45 COSMIC
COSN30492266 46 COSMIC
COSN30186363 51 COSMIC
COSN30104879 89 COSMIC
COSN31535633 117 COSMIC
COSN30474811 120 COSMIC
COSN29516371 142 COSMIC
COSN15664122 143 COSMIC
COSN30115422 188 COSMIC
COSN14975861 269 COSMIC
COSN24945425 274 COSMIC
COSN31600711 284 COSMIC
COSN31523123 289 COSMIC
COSN19659011 348 COSMIC
COSN31519897 362 COSMIC
COSN31482929 414 COSMIC
COSN30538245 428 COSMIC
COSN31550539 545 COSMIC
COSN31536043 590 COSMIC
COSN31584419 705 COSMIC
COSN229207 762 COSMIC
COSN30542658 763 COSMIC
COSN31606916 899 COSMIC
COSN31575824 910 COSMIC
COSN25227993 974 COSMIC
COSN30542879 1136 COSMIC
COSN20184879 1175 COSMIC
COSN27303797 1175 COSMIC
COSN20105126 1176 COSMIC
COSN17798939 1177 COSMIC
COSN29765277 1209 COSMIC
COSN31557226 1224 COSMIC
COSN30542972 1309 COSMIC
COSN31585248 1354 COSMIC
COSN31551297 1390 COSMIC
COSN32055972 1390 COSMIC
COSN31579781 1391 COSMIC
COSN9521699 1409 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1336142431 1 dbSNP
rs1220481598 2 dbSNP
rs765994926 3 dbSNP
rs760331050 4 dbSNP
rs772775080 5 dbSNP
rs1186657104 6 dbSNP
rs767278856 7 dbSNP
rs757524627 16 dbSNP
rs761529505 16 dbSNP
rs941687148 21 dbSNP
rs774423970 24 dbSNP
rs768751769 26 dbSNP
rs371755859 27 dbSNP
rs1470681200 28 dbSNP
rs199618911 29 dbSNP
rs376832519 31 dbSNP
rs893258003 41 dbSNP
rs572401029 45 dbSNP
rs748797269 46 dbSNP
rs371990504 48 dbSNP
rs747442393 49 dbSNP
rs1270962178 52 dbSNP
rs1285463046 56 dbSNP
rs923510731 63 dbSNP
rs148614417 71 dbSNP
rs764440272 74 dbSNP
rs1331006617 75 dbSNP
rs535615118 80 dbSNP
rs1206705801 84 dbSNP
rs970205606 88 dbSNP
rs570179855 91 dbSNP
rs1011603528 102 dbSNP
rs779981651 103 dbSNP
rs1032266483 106 dbSNP
rs1263481367 111 dbSNP
rs1413134730 116 dbSNP
rs201680452 118 dbSNP
rs1205195407 120 dbSNP
rs150761342 121 dbSNP
rs999411572 121 dbSNP
rs902425699 122 dbSNP
rs1051644583 125 dbSNP
rs919375902 127 dbSNP
rs146543123 132 dbSNP
rs1335616414 134 dbSNP
rs118007354 137 dbSNP
rs1214641198 138 dbSNP
rs1446805119 145 dbSNP
rs1363342299 148 dbSNP
rs1351979271 151 dbSNP
rs1287501223 153 dbSNP
rs961222705 153 dbSNP
rs1272408775 156 dbSNP
rs1035551735 157 dbSNP
rs1280815144 161 dbSNP
rs1039166228 167 dbSNP
rs1429112733 171 dbSNP
rs1210403903 173 dbSNP
rs941718197 175 dbSNP
rs1252761857 181 dbSNP
rs1484172509 192 dbSNP
rs775617222 193 dbSNP
rs867445679 194 dbSNP
rs200966191 197 dbSNP
rs200039583 198 dbSNP
rs191462433 201 dbSNP
rs1308129160 218 dbSNP
rs981655005 221 dbSNP
rs1371958203 224 dbSNP
rs551049322 225 dbSNP
rs1307180119 226 dbSNP
rs1053315664 231 dbSNP
rs1410596755 234 dbSNP
rs1438499252 256 dbSNP
rs1421631909 257 dbSNP
rs1344262319 258 dbSNP
rs970615590 262 dbSNP
rs371693455 270 dbSNP
rs999012804 270 dbSNP
rs528092641 272 dbSNP
rs916008058 275 dbSNP
rs990196081 276 dbSNP
rs1203352654 277 dbSNP
rs1250229214 283 dbSNP
rs957368346 284 dbSNP
rs1031713428 287 dbSNP
rs1040626820 293 dbSNP
rs1245435718 300 dbSNP
rs998855603 301 dbSNP
rs1168593831 307 dbSNP
rs1391557530 311 dbSNP
rs1185127746 315 dbSNP
rs910521635 319 dbSNP
rs1167016912 320 dbSNP
rs1391148984 329 dbSNP
rs1388256684 330 dbSNP
rs10095140 331 dbSNP
rs930672838 335 dbSNP
rs1204664051 342 dbSNP
rs1308717938 343 dbSNP
rs919335622 345 dbSNP
rs1213351056 348 dbSNP
rs1226416937 355 dbSNP
rs966641699 357 dbSNP
rs972581127 358 dbSNP
rs928482384 360 dbSNP
rs961170736 360 dbSNP
rs1342004350 361 dbSNP
rs549055580 362 dbSNP
rs1189845926 364 dbSNP
rs1316179889 367 dbSNP
rs1030650769 368 dbSNP
rs1249325471 370 dbSNP
rs1447182633 372 dbSNP
rs1191887304 386 dbSNP
rs997373389 387 dbSNP
rs1380935310 393 dbSNP
rs1302465579 394 dbSNP
rs1459134761 397 dbSNP
rs1161175782 398 dbSNP
rs1443149443 399 dbSNP
rs1393530075 401 dbSNP
rs1356372633 403 dbSNP
rs1326866363 404 dbSNP
rs1429029850 405 dbSNP
rs1385780101 407 dbSNP
rs900309441 408 dbSNP
rs1165300019 410 dbSNP
rs1442522305 414 dbSNP
rs199926078 417 dbSNP
rs1457682464 431 dbSNP
rs1384266689 436 dbSNP
rs1386398118 436 dbSNP
rs760075660 438 dbSNP
rs1038784504 442 dbSNP
rs1455591963 448 dbSNP
rs1432923897 450 dbSNP
rs777019279 452 dbSNP
rs1177458601 453 dbSNP
rs529015433 469 dbSNP
rs1481382925 472 dbSNP
rs1230694448 484 dbSNP
rs1005892189 496 dbSNP
rs1203127809 497 dbSNP
rs1251289758 503 dbSNP
rs887519797 503 dbSNP
rs771220191 504 dbSNP
rs1293125108 512 dbSNP
rs563454396 513 dbSNP
rs928954503 522 dbSNP
rs1023345102 523 dbSNP
rs1270537506 525 dbSNP
rs1011235705 527 dbSNP
rs957294325 531 dbSNP
rs928930236 532 dbSNP
rs1357708308 537 dbSNP
rs1046374209 545 dbSNP
rs998625048 554 dbSNP
rs1425171858 555 dbSNP
rs1185022966 556 dbSNP
rs948931397 561 dbSNP
rs1416856830 565 dbSNP
rs1224551356 572 dbSNP
rs916032888 577 dbSNP
rs143848510 578 dbSNP
rs1386287060 583 dbSNP
rs577966688 586 dbSNP
rs1288355609 594 dbSNP
rs1007775411 596 dbSNP
rs564373716 598 dbSNP
rs1366165119 600 dbSNP
rs1355103800 603 dbSNP
rs1229342562 605 dbSNP
rs1304844455 609 dbSNP
rs1290613212 614 dbSNP
rs76002467 619 dbSNP
rs1349113706 620 dbSNP
rs1239046779 621 dbSNP
rs1159494404 641 dbSNP
rs368413761 642 dbSNP
rs572394139 645 dbSNP
rs1256305051 652 dbSNP
rs1483184603 656 dbSNP
rs1183991536 661 dbSNP
rs1420508523 667 dbSNP
rs1030266745 672 dbSNP
rs976365361 683 dbSNP
rs1176771662 685 dbSNP
rs185885245 686 dbSNP
rs1467616877 688 dbSNP
rs1171877013 690 dbSNP
rs1375015221 694 dbSNP
rs1410672044 700 dbSNP
rs1310237163 701 dbSNP
rs757493262 707 dbSNP
rs761060626 708 dbSNP
rs1180903771 710 dbSNP
rs542286162 713 dbSNP
rs1480467795 729 dbSNP
rs562084019 730 dbSNP
rs939444624 734 dbSNP
rs1231358885 736 dbSNP
rs550152212 751 dbSNP
rs576149597 753 dbSNP
rs1278993181 754 dbSNP
rs1342424549 755 dbSNP
rs1249325808 765 dbSNP
rs374930145 774 dbSNP
rs1480211863 775 dbSNP
rs1006006280 777 dbSNP
rs1269320085 795 dbSNP
rs887549391 801 dbSNP
rs928430008 802 dbSNP
rs1394627710 805 dbSNP
rs1026004460 806 dbSNP
rs1170758346 807 dbSNP
rs1353007763 808 dbSNP
rs535490996 810 dbSNP
rs1461755714 815 dbSNP
rs1294502430 816 dbSNP
rs993134388 821 dbSNP
rs556303930 831 dbSNP
rs981240845 832 dbSNP
rs948591744 833 dbSNP
rs114452342 835 dbSNP
rs1319012262 843 dbSNP
rs1230125460 847 dbSNP
rs1305102779 874 dbSNP
rs1270402764 878 dbSNP
rs1045991488 880 dbSNP
rs949022922 881 dbSNP
rs1221960711 884 dbSNP
rs1266997722 889 dbSNP
rs1346264045 890 dbSNP
rs181759015 900 dbSNP
rs1252430374 903 dbSNP
rs1450120050 910 dbSNP
rs957038476 912 dbSNP
rs1417564727 914 dbSNP
rs894726364 925 dbSNP
rs1054653878 934 dbSNP
rs936142516 935 dbSNP
rs1366742898 937 dbSNP
rs977136130 944 dbSNP
rs1455142621 946 dbSNP
rs1352038015 949 dbSNP
rs7014968 951 dbSNP
rs1157923294 958 dbSNP
rs1325876406 974 dbSNP
rs1469963952 976 dbSNP
rs977479952 985 dbSNP
rs139314628 989 dbSNP
rs565656604 990 dbSNP
rs975431154 993 dbSNP
rs1228600123 1024 dbSNP
rs1314595696 1033 dbSNP
rs528736238 1035 dbSNP
rs548733994 1036 dbSNP
rs1027881881 1044 dbSNP
rs995509299 1045 dbSNP
rs1466208688 1046 dbSNP
rs1217958757 1048 dbSNP
rs1240494504 1059 dbSNP
rs1267253782 1066 dbSNP
rs1187519611 1072 dbSNP
rs897790482 1079 dbSNP
rs1416366504 1082 dbSNP
rs1259290521 1083 dbSNP
rs771694280 1090 dbSNP
rs1413273168 1094 dbSNP
rs1017456496 1099 dbSNP
rs1459292674 1101 dbSNP
rs1036321059 1103 dbSNP
rs1315606660 1103 dbSNP
rs368034346 1106 dbSNP
rs528972664 1110 dbSNP
rs1324467125 1114 dbSNP
rs1232389467 1118 dbSNP
rs35247663 1118 dbSNP
rs1288752937 1123 dbSNP
rs1265086987 1127 dbSNP
rs1282213985 1134 dbSNP
rs951851823 1143 dbSNP
rs906621717 1155 dbSNP
rs764244168 1168 dbSNP
rs1311594716 1169 dbSNP
rs1484823837 1173 dbSNP
rs191058961 1175 dbSNP
rs1253071992 1176 dbSNP
rs35888807 1176 dbSNP
rs368169390 1177 dbSNP
rs990056376 1185 dbSNP
rs1414491758 1186 dbSNP
rs1177618967 1187 dbSNP
rs1308392139 1187 dbSNP
rs1352146175 1187 dbSNP
rs1373170654 1187 dbSNP
rs61470890 1187 dbSNP
rs796684278 1187 dbSNP
rs1319572651 1188 dbSNP
rs1213333303 1189 dbSNP
rs533156327 1191 dbSNP
rs1407837133 1196 dbSNP
rs1219830970 1204 dbSNP
rs1173705416 1209 dbSNP
rs1024432601 1210 dbSNP
rs1282574468 1211 dbSNP
rs1012567483 1221 dbSNP
rs1465087952 1222 dbSNP
rs894750188 1224 dbSNP
rs1316138777 1226 dbSNP
rs140342437 1226 dbSNP
rs373483709 1226 dbSNP
rs1171768198 1228 dbSNP
rs1430762181 1230 dbSNP
rs1232749986 1236 dbSNP
rs1246590114 1236 dbSNP
rs1478644850 1238 dbSNP
rs180984721 1239 dbSNP
rs1392779169 1242 dbSNP
rs1433686596 1248 dbSNP
rs1054684796 1249 dbSNP
rs936173672 1254 dbSNP
rs1327956937 1261 dbSNP
rs903312570 1262 dbSNP
rs1041831962 1271 dbSNP
rs985895699 1275 dbSNP
rs1305703795 1280 dbSNP
rs747800298 1280 dbSNP
rs1368934333 1294 dbSNP
rs953542930 1294 dbSNP
rs1344364882 1298 dbSNP
rs1194369472 1302 dbSNP
rs922708355 1305 dbSNP
rs1229553842 1309 dbSNP
rs1040132388 1310 dbSNP
rs147322305 1312 dbSNP
rs1216145843 1314 dbSNP
rs1296680694 1318 dbSNP
rs1246419287 1321 dbSNP
rs910481126 1326 dbSNP
rs527617975 1328 dbSNP
rs1384604629 1334 dbSNP
rs984646715 1335 dbSNP
rs1395048280 1342 dbSNP
rs1374381790 1352 dbSNP
rs1474226955 1360 dbSNP
rs1015166331 1367 dbSNP
rs1396619880 1371 dbSNP
rs1299328722 1372 dbSNP
rs77219280 1373 dbSNP
rs1462929995 1374 dbSNP
rs541873253 1375 dbSNP
rs971922379 1382 dbSNP
rs971579222 1384 dbSNP
rs1168414868 1388 dbSNP
rs1045106761 1390 dbSNP
rs1328418281 1390 dbSNP
rs1012760055 1392 dbSNP
rs576087603 1392 dbSNP
rs1235563300 1394 dbSNP
rs1271766734 1394 dbSNP
rs1024047625 1396 dbSNP
rs1208736842 1400 dbSNP
rs894276554 1403 dbSNP
rs759765645 1404 dbSNP
rs1192094184 1407 dbSNP
rs958338086 1414 dbSNP
rs1033265375 1417 dbSNP
rs1162557763 1430 dbSNP
rs577286156 1431 dbSNP
rs1251336094 1432 dbSNP
rs1197621164 1438 dbSNP
rs1000416165 1440 dbSNP
rs556242485 1442 dbSNP
rs545940720 1448 dbSNP
rs577015001 1452 dbSNP
rs924509672 1455 dbSNP
rs1223000487 1456 dbSNP
rs1041679774 1458 dbSNP
rs903427191 1459 dbSNP
rs1341319813 1462 dbSNP
rs1235460426 1464 dbSNP
rs944329907 1465 dbSNP
rs1334763891 1468 dbSNP
rs911572425 1470 dbSNP
rs554107775 1471 dbSNP
rs534487044 1472 dbSNP
rs1335912511 1473 dbSNP
rs189785753 1476 dbSNP
rs1039759591 1477 dbSNP
rs1185522744 1482 dbSNP
rs942712653 1484 dbSNP
rs962267822 1487 dbSNP
rs1369300083 1489 dbSNP
rs1161248507 1491 dbSNP
rs1362022727 1496 dbSNP
rs555311807 1502 dbSNP
rs1451659351 1504 dbSNP
rs909845027 1508 dbSNP
rs1376222341 1509 dbSNP
rs75799342 1511 dbSNP
rs1311430480 1514 dbSNP
rs569712782 1515 dbSNP
rs930603702 1516 dbSNP
rs1334537735 1518 dbSNP
rs1367878636 1519 dbSNP
rs1161769602 1520 dbSNP
rs1472628231 1523 dbSNP
rs1256143499 1524 dbSNP
rs1349579274 1529 dbSNP
rs1208336868 1533 dbSNP
rs751165927 1535 dbSNP
rs919159021 1536 dbSNP
rs1483237151 1537 dbSNP
rs972338135 1538 dbSNP
rs971228473 1539 dbSNP
rs1181171839 1544 dbSNP
rs543655470 1554 dbSNP
rs991216366 1556 dbSNP
rs1023601288 1557 dbSNP
rs1012295425 1565 dbSNP
rs958367692 1569 dbSNP
rs1300283798 1574 dbSNP
rs1371729703 1584 dbSNP
rs893879898 1586 dbSNP
rs1053910279 1587 dbSNP
rs1303469080 1590 dbSNP
rs1032712873 1592 dbSNP
rs533092259 1593 dbSNP
rs999859514 1594 dbSNP
rs570602198 1595 dbSNP
rs967646850 1605 dbSNP
rs1020520216 1611 dbSNP
rs1262101959 1613 dbSNP
rs944613618 1620 dbSNP
rs998772576 1625 dbSNP
rs1226087628 1626 dbSNP
rs1349374035 1630 dbSNP
rs1210410172 1631 dbSNP
rs1283317943 1632 dbSNP
rs901315842 1636 dbSNP
rs1050509750 1637 dbSNP
rs1347930213 1642 dbSNP
rs547294908 1643 dbSNP
rs527546273 1644 dbSNP
rs1405113908 1645 dbSNP
rs144025166 1646 dbSNP
rs1024160725 1658 dbSNP
rs541775411 1662 dbSNP
rs1411343548 1671 dbSNP
rs1327111893 1672 dbSNP
rs1200153023 1691 dbSNP
rs973203059 1701 dbSNP
rs1048407521 1702 dbSNP
rs929967415 1709 dbSNP
rs1362217880 1710 dbSNP
rs1244897865 1712 dbSNP
rs908065201 1718 dbSNP
rs1293151626 1719 dbSNP
rs982296566 1719 dbSNP
rs1233708996 1726 dbSNP
rs1274924327 1729 dbSNP
rs1467097050 1734 dbSNP
rs1211828409 1750 dbSNP
rs1447335830 1753 dbSNP
rs1486302197 1754 dbSNP
rs1188544440 1756 dbSNP
rs1263539783 1758 dbSNP
rs970957807 1761 dbSNP
rs1428235230 1763 dbSNP
rs1206465591 1767 dbSNP
rs531595595 1768 dbSNP
rs1324620359 1771 dbSNP
rs1432421085 1776 dbSNP
rs34964223 1777 dbSNP
rs562588904 1779 dbSNP
rs1415113642 1781 dbSNP
rs1347806423 1782 dbSNP
rs1332586329 1784 dbSNP
rs781183141 1790 dbSNP
rs1273548373 1796 dbSNP
rs1436336350 1797 dbSNP
rs902984119 1799 dbSNP
rs1322900452 1803 dbSNP
rs1488088693 1808 dbSNP
rs1020130396 1809 dbSNP
rs1260124127 1809 dbSNP
rs545869136 1810 dbSNP
rs897751602 1814 dbSNP
rs1388175525 1815 dbSNP
rs1008773243 1824 dbSNP
rs1050391493 1824 dbSNP
rs890368315 1824 dbSNP
rs1435023469 1825 dbSNP
rs1314478856 1834 dbSNP
rs1353370058 1837 dbSNP
rs1413972207 1840 dbSNP
rs1177317083 1843 dbSNP
rs1280012578 1845 dbSNP
rs1375455446 1846 dbSNP
rs1470985199 1846 dbSNP
rs1282328816 1847 dbSNP
rs1423027275 1847 dbSNP
rs1353239574 1848 dbSNP
rs1211924216 1849 dbSNP
rs1171959543 1851 dbSNP
rs931624969 1858 dbSNP
rs1036259560 1865 dbSNP
rs898851949 1865 dbSNP
rs142119781 1867 dbSNP
rs1491432562 1868 dbSNP
rs1233911568 1869 dbSNP
rs1471447096 1869 dbSNP
rs1491149499 1869 dbSNP
rs199813479 1869 dbSNP
rs35728440 1869 dbSNP
rs71203359 1869 dbSNP
rs1376305028 1871 dbSNP
rs917055980 1871 dbSNP
rs1235160688 1872 dbSNP
rs940454215 1875 dbSNP
rs1200173937 1895 dbSNP
rs1274235873 1897 dbSNP
rs908011855 1898 dbSNP
rs6651505 1904 dbSNP
rs1184716060 1907 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000304437.2 | 3UTR | AAAAGAAAAAAAAAAAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000304437.2 | 3UTR | AAAAGAAAAAAAAAAAGUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000304437.2 | 3UTR | AAAAGAAAAAAAAAAAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*