miRTarBase - #MIRT628078 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KAT7   
Synonyms HBO1, HBOA, MYST2, ZC2HC7
Description lysine acetyltransferase 7
Transcript NM_007067   
Expression
Putative miRNA Targets on KAT7
3'UTR of KAT7
(miRNA target sites are highlighted)
>KAT7|NM_007067|3'UTR
   1 AGTGACCTGTCATTCCGAGCCAGCGAACCCCAGCAGTAGGAATCCGTACCCTAGGGATCTGTCTGTCATTTCTCTGTTGC
  81 TCTTGTGATTGGCAAGTACAGTATCCTTTGGGAAGGCCATCCCCCTCAGGACTGTCCTGGCTCCGACCTTTGTGTACACT
 161 GCAGACGCTGGTTCTGAGGAACTGTTGTTTCGGCCTCAGTGAGGTTGCCTGGATGGGATCTGTATTAGACTTGAGTGCAG
 241 GTCTCTCAGCACTGACCCAAGGAGTTCTGTTATGGTACTGTACCTGTCCAGTCACTGGTTCTCTCCTCATGTCCTCTCGC
 321 CCCATGAGGTTGTGTTGTGTCTTCTAAGCGTGGTACTAGTGCTTGCCACCTGGTCACCAGACCTCCAAATATGGCTGCCA
 401 CCACCAGGACCTTTCCAGTTACTCCTTATATGTGTGTTCTATGGAGGGGCAGGGAAAAGGTGGCACTTGTGAGTGTGTGT
 481 GGATTGGCAGGGGGTCCATTCACTTTGGGTTCCATCTTGCTTTAAATTTCTTCATTTTGATTAAGAGACCTCTTTTTGAT
 561 CTGTATTGGGCTAACCAGAGCCAAATACTTTTGAAGAGTTTCCCAGGGACTAGTCATGGTAATAGCATATAATTGATCTG
 641 AATGAGATGGAGAGAAGAATGAAGGGGTGGTGGTTCTGGGTTTGATTTGAGTTCACCTGTGGGCAGTGGGCAGTGGGCAG
 721 TGTCTTGGTGAAAGGGAACGGATACTACTTTTTGCCTCACCGTAAAGTACTCACTAGTAAATATTTCCTTCTCTCTTTAC
 801 TCCCACTTTTTACGTTTGCAGGTGCCAAAGTAATGTCCACTTTTCCCTTTCATGCTGCATATTAACTGGTTAATTATACT
 881 GCAGAAACCTTTTCACCTCCACTAGTCTGATACAGTACATCTGTACTTCCATATACCTTGCACTGATTTTGTCTGAGTGC
 961 CCTGGGAGAAGTAGAAAATGATTGAAAGTGACTTCCGTATCTCAGCCCATGACTCAGCAAGGCAGAATGGCCACCCCTGC
1041 CAAAGTTTGCTTCTCTTTTCAACAGTGCCTCACCCTCCCTCTAGGATTAAAGTGCTTCTGCCCTTCCACGAACTCCTCCT
1121 CCATTTCCTTTTTGGGATTTGTCACCATCCTTCTATTCTCTGGTCTTCTATTTTTGGTGTTGTTCAAGTGAAGGAAGAGA
1201 TGTTCCCTCTAATTTCTCTCTAGCCCATTATAACCTGCTATCTTGGGGCAACTTTTGATGTATGACATGTCACCCTTCCC
1281 AACTTGGTCTCCTCCAACATGCTGTCTTCATGTGGAGCCCTCACCACAATCCCTGACTCCGGTCATTTGTGCCTTTCTCT
1361 TGTCATCTCTGTACACTACTTATATTCACTGTGGGTTGGGGGAGCTAATTTTAAGCATGTTCAGTGGCAGCTCCCCTCCA
1441 GTTTCAGTGTCACTGTTAAAATTTATCAAAAAGCAACTTCACTAGGGGTTTTCTTAAGGGATAAAGGCCTTTTACAGAAG
1521 CTAAACCCTTCCCCACATGTGGTAGAATGTGCTCTTCTATATCTACTCCTCAATAAAGCATGTTCTCTGCTCAAAAAAAA
1601 AAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuugUGGUAACA-GUGUGAGGu 5'
               ||| |||| :||||| | 
Target 5' ctccgACCTTTGTGTACACTGCa 3'
141 - 163 133.00 -15.00
2
miRNA  3' guuuGUGGUAAC--AGUGUGAGGu 5'
              || || ||  |||| |||| 
Target 5' ttttCAACAGTGCCTCACCCTCCc 3'
1056 - 1079 132.00 -11.60
3
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||:|  ||| ||||| | 
Target 5' ttgtCATCTCTGT-ACACTACt 3'
1360 - 1380 125.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30504741 18 COSMIC
COSN31490063 26 COSMIC
COSN31546254 32 COSMIC
COSN20078959 99 COSMIC
COSN6105462 314 COSMIC
COSN21157087 621 COSMIC
COSN31487908 975 COSMIC
COSN31514873 997 COSMIC
COSN6105463 1005 COSMIC
COSN16992123 1140 COSMIC
COSN31592140 1255 COSMIC
COSN24996688 1450 COSMIC
COSN31487408 1456 COSMIC
COSN23540923 1644 COSMIC
COSN25904697 1843 COSMIC
COSN21579501 1921 COSMIC
COSN7437353 2044 COSMIC
COSN9670115 2257 COSMIC
COSN18966521 2448 COSMIC
COSN25071051 2627 COSMIC
COSN29631889 3128 COSMIC
COSN7437354 3302 COSMIC
COSN1721060 3527 COSMIC
COSN198167 3702 COSMIC
COSN29371124 4123 COSMIC
COSN20702922 4263 COSMIC
COSN25893142 4315 COSMIC
COSN28523864 4446 COSMIC
COSN16160466 4508 COSMIC
COSN25803244 4702 COSMIC
COSN32153725 4909 COSMIC
COSN5179327 5019 COSMIC
COSN1721061 5190 COSMIC
COSN1721062 5499 COSMIC
COSN1721063 5504 COSMIC
COSN1198062 5775 COSMIC
COSN25012315 5937 COSMIC
COSN9670116 6251 COSMIC
COSN25518127 6677 COSMIC
COSN21162522 6739 COSMIC
COSN27941646 6914 COSMIC
COSN1721064 7115 COSMIC
COSN5179328 7221 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs187109773 2 dbSNP
rs1185678748 3 dbSNP
rs1269579059 8 dbSNP
rs750579143 16 dbSNP
rs758612934 17 dbSNP
rs1199543978 18 dbSNP
rs370023916 19 dbSNP
rs1401298905 25 dbSNP
rs755312313 26 dbSNP
rs1189170473 28 dbSNP
rs781613017 29 dbSNP
rs1453560457 30 dbSNP
rs1467431888 31 dbSNP
rs748689670 32 dbSNP
rs1348008256 39 dbSNP
rs1251545607 43 dbSNP
rs1403646227 44 dbSNP
rs756711723 46 dbSNP
rs374545148 47 dbSNP
rs745412621 52 dbSNP
rs146789324 57 dbSNP
rs1221168357 58 dbSNP
rs1003206256 62 dbSNP
rs1052131841 63 dbSNP
rs781187169 64 dbSNP
rs1262077111 73 dbSNP
rs1323863672 75 dbSNP
rs1201363130 100 dbSNP
rs892205278 101 dbSNP
rs1209365914 102 dbSNP
rs1281237405 104 dbSNP
rs1345026955 110 dbSNP
rs763148552 113 dbSNP
rs1227585875 122 dbSNP
rs1325458002 123 dbSNP
rs1193013271 124 dbSNP
rs1397549371 127 dbSNP
rs745643178 133 dbSNP
rs1478813621 140 dbSNP
rs1412891641 141 dbSNP
rs1348008235 145 dbSNP
rs191144457 146 dbSNP
rs549386115 148 dbSNP
rs953303535 149 dbSNP
rs555048519 155 dbSNP
rs539534598 157 dbSNP
rs1475704166 163 dbSNP
rs751495262 163 dbSNP
rs1428826030 167 dbSNP
rs1007400203 168 dbSNP
rs1478508972 169 dbSNP
rs1484312479 171 dbSNP
rs1174099084 176 dbSNP
rs1195872886 186 dbSNP
rs1338250836 191 dbSNP
rs1249203068 192 dbSNP
rs1019239557 193 dbSNP
rs1382600476 198 dbSNP
rs1335193019 200 dbSNP
rs1399900722 204 dbSNP
rs1298673605 208 dbSNP
rs1362402594 214 dbSNP
rs1337428227 215 dbSNP
rs142114632 225 dbSNP
rs976713043 230 dbSNP
rs1394434695 231 dbSNP
rs918616770 234 dbSNP
rs1282141249 238 dbSNP
rs1462189992 244 dbSNP
rs1331311420 247 dbSNP
rs1163191409 253 dbSNP
rs1473816193 258 dbSNP
rs1364869337 261 dbSNP
rs951451067 274 dbSNP
rs1235043569 285 dbSNP
rs1247842935 289 dbSNP
rs1277410696 302 dbSNP
rs1215126368 317 dbSNP
rs984591400 319 dbSNP
rs1216369003 320 dbSNP
rs1352644527 324 dbSNP
rs909982275 333 dbSNP
rs1287324647 345 dbSNP
rs1489581153 348 dbSNP
rs35458240 349 dbSNP
rs948187669 350 dbSNP
rs182659062 351 dbSNP
rs1268349195 352 dbSNP
rs1394025606 357 dbSNP
rs1452402245 358 dbSNP
rs1201189283 359 dbSNP
rs1362296614 367 dbSNP
rs1386143356 369 dbSNP
rs928192113 375 dbSNP
rs1469394455 384 dbSNP
rs1159067425 387 dbSNP
rs1194926867 389 dbSNP
rs1454385819 390 dbSNP
rs145845633 394 dbSNP
rs1211451787 396 dbSNP
rs1448445363 396 dbSNP
rs1052082449 408 dbSNP
rs537627221 411 dbSNP
rs892113546 417 dbSNP
rs946414999 419 dbSNP
rs1235100940 420 dbSNP
rs187741276 425 dbSNP
rs1390737045 426 dbSNP
rs577609388 427 dbSNP
rs1433193664 431 dbSNP
rs1388018885 437 dbSNP
rs1327343541 440 dbSNP
rs546560454 442 dbSNP
rs1377791676 457 dbSNP
rs1174881543 471 dbSNP
rs1434733574 485 dbSNP
rs1007804112 486 dbSNP
rs193110946 509 dbSNP
rs552657452 511 dbSNP
rs776371295 513 dbSNP
rs1476200719 526 dbSNP
rs572802312 527 dbSNP
rs1239841316 544 dbSNP
rs1192199335 550 dbSNP
rs1310516869 554 dbSNP
rs901755154 562 dbSNP
rs1211515138 566 dbSNP
rs993401693 567 dbSNP
rs1356455208 568 dbSNP
rs1026209321 574 dbSNP
rs1244510701 589 dbSNP
rs1340278974 592 dbSNP
rs1269897638 595 dbSNP
rs60606425 606 dbSNP
rs55798908 609 dbSNP
rs1357773040 629 dbSNP
rs1313948205 630 dbSNP
rs1488815093 648 dbSNP
rs984148801 656 dbSNP
rs1017430010 667 dbSNP
rs969532192 688 dbSNP
rs1206927898 695 dbSNP
rs769772058 696 dbSNP
rs928139475 697 dbSNP
rs561838809 698 dbSNP
rs1166981265 699 dbSNP
rs1259393212 699 dbSNP
rs939517994 699 dbSNP
rs867969296 704 dbSNP
rs988362917 705 dbSNP
rs530551891 707 dbSNP
rs914163742 708 dbSNP
rs946335520 710 dbSNP
rs1272489278 713 dbSNP
rs543978954 718 dbSNP
rs1337351730 740 dbSNP
rs1239849767 741 dbSNP
rs888855679 743 dbSNP
rs1442548585 751 dbSNP
rs1354112131 756 dbSNP
rs1300483065 762 dbSNP
rs1443675591 763 dbSNP
rs1354622030 768 dbSNP
rs1327721116 773 dbSNP
rs1162783617 775 dbSNP
rs572982202 776 dbSNP
rs1463755630 777 dbSNP
rs943162000 781 dbSNP
rs563983955 782 dbSNP
rs1040165525 789 dbSNP
rs1474795403 794 dbSNP
rs1411514464 801 dbSNP
rs1458955945 806 dbSNP
rs1480961995 814 dbSNP
rs1232401859 815 dbSNP
rs761978465 834 dbSNP
rs533047263 835 dbSNP
rs1196925596 836 dbSNP
rs1165695029 842 dbSNP
rs1395296817 844 dbSNP
rs901663387 855 dbSNP
rs993306775 856 dbSNP
rs1309708557 860 dbSNP
rs1447145652 871 dbSNP
rs1373366731 878 dbSNP
rs1278423584 880 dbSNP
rs1443989397 890 dbSNP
rs772009658 899 dbSNP
rs1379491347 902 dbSNP
rs1460673378 912 dbSNP
rs1450931679 917 dbSNP
rs1347906141 919 dbSNP
rs1161148063 920 dbSNP
rs1419619715 922 dbSNP
rs376826882 930 dbSNP
rs759501691 932 dbSNP
rs546881442 937 dbSNP
rs1247055822 950 dbSNP
rs1455684197 954 dbSNP
rs1249747214 957 dbSNP
rs1253804378 960 dbSNP
rs1213307875 964 dbSNP
rs1487688955 991 dbSNP
rs887706227 993 dbSNP
rs1217017185 995 dbSNP
rs1005955348 997 dbSNP
rs1016962233 998 dbSNP
rs1237306458 1000 dbSNP
rs1199431837 1011 dbSNP
rs796398807 1012 dbSNP
rs61305662 1018 dbSNP
rs1459771590 1019 dbSNP
rs1439746243 1023 dbSNP
rs980827603 1031 dbSNP
rs1256730159 1037 dbSNP
rs1035114958 1054 dbSNP
rs1344526071 1058 dbSNP
rs1156794613 1059 dbSNP
rs1436589462 1064 dbSNP
rs1395807041 1065 dbSNP
rs1193193567 1070 dbSNP
rs1431633719 1072 dbSNP
rs1425540679 1073 dbSNP
rs773249607 1074 dbSNP
rs988310519 1085 dbSNP
rs1465697408 1093 dbSNP
rs1349365431 1102 dbSNP
rs1280447294 1105 dbSNP
rs1231946841 1107 dbSNP
rs914155495 1110 dbSNP
rs565886660 1111 dbSNP
rs538116065 1113 dbSNP
rs528507695 1115 dbSNP
rs548328669 1116 dbSNP
rs1416573859 1117 dbSNP
rs968363905 1119 dbSNP
rs1173052569 1123 dbSNP
rs376889586 1129 dbSNP
rs1464668215 1135 dbSNP
rs1374992112 1137 dbSNP
rs979495808 1142 dbSNP
rs1294066170 1152 dbSNP
rs1428219517 1156 dbSNP
rs1190636655 1159 dbSNP
rs1339860369 1163 dbSNP
rs1486269892 1167 dbSNP
rs568521072 1168 dbSNP
rs910242837 1169 dbSNP
rs1260188561 1181 dbSNP
rs1321720535 1189 dbSNP
rs1252636235 1193 dbSNP
rs1227752101 1195 dbSNP
rs1317024411 1205 dbSNP
rs1209134670 1215 dbSNP
rs1234950520 1219 dbSNP
rs1356006022 1225 dbSNP
rs1256431338 1228 dbSNP
rs16963127 1235 dbSNP
rs1394307446 1244 dbSNP
rs1040073207 1249 dbSNP
rs1262404817 1253 dbSNP
rs1461691311 1257 dbSNP
rs1167506218 1262 dbSNP
rs1477834170 1265 dbSNP
rs923034906 1270 dbSNP
rs1426734693 1271 dbSNP
rs1432293918 1273 dbSNP
rs929105225 1275 dbSNP
rs1047586100 1276 dbSNP
rs557579297 1283 dbSNP
rs1360043714 1286 dbSNP
rs1457016216 1287 dbSNP
rs1006159367 1288 dbSNP
rs56017497 1289 dbSNP
rs1044722640 1290 dbSNP
rs1215320185 1291 dbSNP
rs905163147 1295 dbSNP
rs1283457341 1296 dbSNP
rs1360479914 1297 dbSNP
rs1400655846 1300 dbSNP
rs1002211393 1313 dbSNP
rs1035063921 1314 dbSNP
rs1398367516 1315 dbSNP
rs185514093 1317 dbSNP
rs1009731137 1321 dbSNP
rs1021151660 1324 dbSNP
rs1161928557 1333 dbSNP
rs1455788406 1334 dbSNP
rs764362296 1341 dbSNP
rs968687524 1363 dbSNP
rs1438603334 1366 dbSNP
rs1302255816 1368 dbSNP
rs540094243 1379 dbSNP
rs759356836 1382 dbSNP
rs1195117209 1384 dbSNP
rs1468717956 1420 dbSNP
rs553653457 1431 dbSNP
rs910810603 1433 dbSNP
rs1261305045 1439 dbSNP
rs572718341 1449 dbSNP
rs964377676 1454 dbSNP
rs975726268 1466 dbSNP
rs766574821 1471 dbSNP
rs1330795386 1478 dbSNP
rs1321958549 1482 dbSNP
rs1402875724 1487 dbSNP
rs1386298199 1489 dbSNP
rs1218140843 1498 dbSNP
rs757339081 1499 dbSNP
rs1377979400 1501 dbSNP
rs1487875269 1503 dbSNP
rs1175073719 1509 dbSNP
rs755489186 1522 dbSNP
rs1426854501 1523 dbSNP
rs1435232985 1527 dbSNP
rs1454429182 1529 dbSNP
rs1245810411 1530 dbSNP
rs1196471681 1531 dbSNP
rs370727808 1534 dbSNP
rs1448574700 1535 dbSNP
rs1157267887 1538 dbSNP
rs1380199483 1542 dbSNP
rs1262268988 1558 dbSNP
rs1215811199 1560 dbSNP
rs1351540504 1564 dbSNP
rs1047533721 1566 dbSNP
rs541792206 1566 dbSNP
rs909021014 1569 dbSNP
rs1273358981 1582 dbSNP
rs1433259555 1598 dbSNP
rs555094683 1600 dbSNP
rs941869439 1601 dbSNP
rs1031196768 1604 dbSNP
rs574989713 1611 dbSNP
rs187535172 1612 dbSNP
rs905777312 1618 dbSNP
rs1370043536 1628 dbSNP
rs1002201517 1634 dbSNP
rs1056513937 1638 dbSNP
rs1010993399 1639 dbSNP
rs896560194 1643 dbSNP
rs1009680554 1653 dbSNP
rs1373460927 1653 dbSNP
rs1487250685 1656 dbSNP
rs1022420322 1660 dbSNP
rs1211675240 1665 dbSNP
rs1441935328 1667 dbSNP
rs1276688334 1668 dbSNP
rs1477917612 1674 dbSNP
rs1340433560 1676 dbSNP
rs1021476380 1678 dbSNP
rs968413912 1703 dbSNP
rs1217224712 1713 dbSNP
rs1354320122 1721 dbSNP
rs1242147130 1724 dbSNP
rs968217862 1734 dbSNP
rs768082728 1742 dbSNP
rs1001450169 1744 dbSNP
rs1448049718 1744 dbSNP
rs1017818370 1745 dbSNP
rs985238687 1751 dbSNP
rs1400630025 1755 dbSNP
rs964972566 1761 dbSNP
rs1476752216 1762 dbSNP
rs1419874145 1763 dbSNP
rs752337413 1764 dbSNP
rs1472487597 1768 dbSNP
rs1018468295 1787 dbSNP
rs1438575212 1792 dbSNP
rs965054863 1792 dbSNP
rs1257736398 1801 dbSNP
rs1197122871 1804 dbSNP
rs538031444 1805 dbSNP
rs1294370640 1811 dbSNP
rs1228282959 1815 dbSNP
rs976862665 1817 dbSNP
rs950403996 1818 dbSNP
rs1443829676 1820 dbSNP
rs563897332 1828 dbSNP
rs754269613 1833 dbSNP
rs1377168384 1839 dbSNP
rs374081123 1843 dbSNP
rs918500192 1844 dbSNP
rs1396454831 1848 dbSNP
rs929886803 1850 dbSNP
rs908961830 1858 dbSNP
rs1404672762 1860 dbSNP
rs1411583074 1870 dbSNP
rs1238026227 1873 dbSNP
rs983916621 1873 dbSNP
rs1440456381 1886 dbSNP
rs909736284 1887 dbSNP
rs980381736 1888 dbSNP
rs1470073901 1892 dbSNP
rs927225049 1895 dbSNP
rs948107813 1908 dbSNP
rs1221348774 1910 dbSNP
rs192066774 1913 dbSNP
rs759755125 1916 dbSNP
rs1045143990 1917 dbSNP
rs150289240 1929 dbSNP
rs753104578 1931 dbSNP
rs1052392534 1932 dbSNP
rs896465614 1938 dbSNP
rs1377005289 1954 dbSNP
rs529203323 1955 dbSNP
rs1308031614 1964 dbSNP
rs1404798385 1965 dbSNP
rs755695212 1970 dbSNP
rs1165622638 1971 dbSNP
rs1293862963 1973 dbSNP
rs1435576565 1976 dbSNP
rs548561452 1980 dbSNP
rs1161213035 1983 dbSNP
rs892678758 1989 dbSNP
rs1379796849 1991 dbSNP
rs562105658 1995 dbSNP
rs1377287669 1999 dbSNP
rs1042442254 2014 dbSNP
rs1268404477 2014 dbSNP
rs1011130498 2017 dbSNP
rs1487718291 2018 dbSNP
rs530986963 2025 dbSNP
rs753295610 2026 dbSNP
rs1244270775 2028 dbSNP
rs1172065762 2033 dbSNP
rs1218031511 2036 dbSNP
rs1022389606 2041 dbSNP
rs1284662286 2042 dbSNP
rs867169987 2043 dbSNP
rs1291473098 2058 dbSNP
rs138950540 2060 dbSNP
rs900742791 2060 dbSNP
rs997697487 2078 dbSNP
rs1030553059 2081 dbSNP
rs1018021011 2084 dbSNP
rs1290516226 2084 dbSNP
rs950351904 2085 dbSNP
rs965537250 2091 dbSNP
rs1359876051 2093 dbSNP
rs983525018 2102 dbSNP
rs1378365767 2103 dbSNP
rs577710797 2110 dbSNP
rs1431767468 2111 dbSNP
rs1422127879 2117 dbSNP
rs1197547795 2120 dbSNP
rs1194911629 2127 dbSNP
rs1025317434 2132 dbSNP
rs571032582 2133 dbSNP
rs1213805843 2155 dbSNP
rs1483952089 2157 dbSNP
rs1256150984 2159 dbSNP
rs1232116290 2161 dbSNP
rs1310168781 2162 dbSNP
rs984052095 2163 dbSNP
rs540056802 2171 dbSNP
rs1236199145 2172 dbSNP
rs1276244298 2181 dbSNP
rs1416626393 2182 dbSNP
rs1403042435 2193 dbSNP
rs938514458 2196 dbSNP
rs1464716959 2213 dbSNP
rs969232400 2215 dbSNP
rs1472787163 2218 dbSNP
rs992715926 2220 dbSNP
rs981055476 2232 dbSNP
rs928034542 2233 dbSNP
rs1415965932 2236 dbSNP
rs1422031186 2238 dbSNP
rs1464143179 2249 dbSNP
rs1190698993 2250 dbSNP
rs546914520 2251 dbSNP
rs1170176399 2255 dbSNP
rs939432221 2257 dbSNP
rs1256270530 2268 dbSNP
rs1466958787 2270 dbSNP
rs1052360512 2271 dbSNP
rs544223700 2287 dbSNP
rs913916195 2290 dbSNP
rs1331998797 2296 dbSNP
rs1482052642 2297 dbSNP
rs946746999 2303 dbSNP
rs1198981352 2306 dbSNP
rs1043938074 2308 dbSNP
rs903931354 2309 dbSNP
rs889405241 2314 dbSNP
rs1007718095 2315 dbSNP
rs936772484 2316 dbSNP
rs149428964 2318 dbSNP
rs900881179 2320 dbSNP
rs1217510519 2324 dbSNP
rs1278397235 2326 dbSNP
rs1319607382 2330 dbSNP
rs1039134570 2332 dbSNP
rs1332310619 2332 dbSNP
rs1398592639 2341 dbSNP
rs1200887790 2347 dbSNP
rs535818062 2353 dbSNP
rs1167669089 2354 dbSNP
rs1458846017 2358 dbSNP
rs1368435353 2363 dbSNP
rs900649348 2368 dbSNP
rs751097167 2372 dbSNP
rs1030500776 2373 dbSNP
rs1277021933 2374 dbSNP
rs997954960 2381 dbSNP
rs1025287184 2383 dbSNP
rs1236115760 2384 dbSNP
rs1355947151 2384 dbSNP
rs544682665 2384 dbSNP
rs61436973 2384 dbSNP
rs1442347913 2385 dbSNP
rs1211367737 2397 dbSNP
rs1307972004 2398 dbSNP
rs1476858681 2399 dbSNP
rs1193091153 2405 dbSNP
rs1424574235 2407 dbSNP
rs555330283 2408 dbSNP
rs1387774553 2414 dbSNP
rs1390574207 2416 dbSNP
rs1478956378 2422 dbSNP
rs951016153 2423 dbSNP
rs1455899297 2424 dbSNP
rs1005247943 2425 dbSNP
rs1438665947 2428 dbSNP
rs886730078 2440 dbSNP
rs1004544279 2445 dbSNP
rs1016371740 2454 dbSNP
rs1266502255 2455 dbSNP
rs1016851448 2461 dbSNP
rs562702528 2469 dbSNP
rs1286797683 2471 dbSNP
rs963141983 2472 dbSNP
rs1351775442 2475 dbSNP
rs1414840407 2491 dbSNP
rs1001669116 2494 dbSNP
rs1330921872 2495 dbSNP
rs1034114182 2498 dbSNP
rs980589009 2501 dbSNP
rs1336041821 2502 dbSNP
rs574900790 2505 dbSNP
rs1298275187 2508 dbSNP
rs1418628286 2517 dbSNP
rs9898183 2520 dbSNP
rs960800459 2536 dbSNP
rs1398816274 2537 dbSNP
rs1478207933 2540 dbSNP
rs1298331528 2544 dbSNP
rs1341976229 2557 dbSNP
rs1376874958 2565 dbSNP
rs1196539119 2569 dbSNP
rs551171969 2573 dbSNP
rs374483581 2574 dbSNP
rs1487352726 2578 dbSNP
rs914017789 2579 dbSNP
rs557451509 2589 dbSNP
rs1344641174 2590 dbSNP
rs1273415742 2592 dbSNP
rs577381806 2596 dbSNP
rs184085417 2597 dbSNP
rs1398772314 2599 dbSNP
rs560137086 2603 dbSNP
rs978107490 2611 dbSNP
rs573870792 2619 dbSNP
rs1487620105 2620 dbSNP
rs1173981114 2624 dbSNP
rs1478713829 2636 dbSNP
rs925249554 2638 dbSNP
rs1239266075 2642 dbSNP
rs1476853856 2642 dbSNP
rs936696657 2643 dbSNP
rs1215965032 2647 dbSNP
rs368852025 2652 dbSNP
rs1264075642 2655 dbSNP
rs1276847688 2656 dbSNP
rs910765692 2657 dbSNP
rs1489313480 2664 dbSNP
rs1319045581 2665 dbSNP
rs188624200 2670 dbSNP
rs181137002 2672 dbSNP
rs1478211019 2673 dbSNP
rs1174147146 2677 dbSNP
rs1163899442 2678 dbSNP
rs1169761224 2678 dbSNP
rs1180775983 2678 dbSNP
rs1197184616 2678 dbSNP
rs1228336533 2678 dbSNP
rs1237929283 2678 dbSNP
rs1241452087 2678 dbSNP
rs1285416555 2678 dbSNP
rs1291294025 2678 dbSNP
rs1324024848 2678 dbSNP
rs1334298132 2678 dbSNP
rs1400793324 2678 dbSNP
rs1408111749 2678 dbSNP
rs1415961199 2678 dbSNP
rs1458453648 2678 dbSNP
rs1466956106 2678 dbSNP
rs1472519660 2678 dbSNP
rs1378385748 2681 dbSNP
rs1419088387 2683 dbSNP
rs943625338 2683 dbSNP
rs1040517671 2684 dbSNP
rs1377235552 2685 dbSNP
rs1158723208 2686 dbSNP
rs1216451775 2687 dbSNP
rs1361825299 2687 dbSNP
rs1384588476 2688 dbSNP
rs1322417596 2689 dbSNP
rs1330422002 2690 dbSNP
rs1331365133 2691 dbSNP
rs1165408376 2692 dbSNP
rs1351491155 2692 dbSNP
rs1404802659 2692 dbSNP
rs1437598194 2693 dbSNP
rs1306161778 2694 dbSNP
rs1160580134 2695 dbSNP
rs1440516669 2695 dbSNP
rs1175833309 2696 dbSNP
rs1352143082 2696 dbSNP
rs1239970495 2697 dbSNP
rs1247732240 2697 dbSNP
rs1221508590 2698 dbSNP
rs1450444266 2698 dbSNP
rs1288922597 2699 dbSNP
rs1241772914 2700 dbSNP
rs1353958845 2701 dbSNP
rs1237350454 2705 dbSNP
rs59651145 2706 dbSNP
rs1191021460 2707 dbSNP
rs368154563 2707 dbSNP
rs7220957 2707 dbSNP
rs778263939 2707 dbSNP
rs3986564 2708 dbSNP
rs1321415971 2709 dbSNP
rs868638374 2709 dbSNP
rs1218097180 2711 dbSNP
rs1488336186 2712 dbSNP
rs1352871182 2715 dbSNP
rs1213245625 2718 dbSNP
rs902026280 2721 dbSNP
rs1218494827 2727 dbSNP
rs1343549433 2727 dbSNP
rs530952560 2729 dbSNP
rs993689136 2730 dbSNP
rs933486292 2731 dbSNP
rs1051914628 2732 dbSNP
rs1046834124 2735 dbSNP
rs780923033 2739 dbSNP
rs551062408 2740 dbSNP
rs1017021606 2741 dbSNP
rs61457410 2748 dbSNP
rs36009698 2750 dbSNP
rs1175783824 2755 dbSNP
rs1037975856 2757 dbSNP
rs1426332082 2758 dbSNP
rs898799081 2761 dbSNP
rs1477836637 2770 dbSNP
rs1260401520 2771 dbSNP
rs376453104 2775 dbSNP
rs7221118 2778 dbSNP
rs1034063143 2783 dbSNP
rs1034969259 2785 dbSNP
rs1202732161 2794 dbSNP
rs1321154477 2799 dbSNP
rs960516240 2803 dbSNP
rs1259866330 2804 dbSNP
rs1219196316 2819 dbSNP
rs201080867 2828 dbSNP
rs386797560 2828 dbSNP
rs1293519975 2830 dbSNP
rs202080459 2830 dbSNP
rs200405172 2832 dbSNP
rs1397921719 2835 dbSNP
rs35443093 2837 dbSNP
rs987970444 2838 dbSNP
rs1380089789 2842 dbSNP
rs959818958 2847 dbSNP
rs1390986691 2854 dbSNP
rs1450863305 2854 dbSNP
rs1406802773 2856 dbSNP
rs1020993197 2859 dbSNP
rs1402939957 2862 dbSNP
rs1171896866 2869 dbSNP
rs71379382 2872 dbSNP
rs1465530622 2874 dbSNP
rs968107066 2892 dbSNP
rs1167683610 2897 dbSNP
rs1214394726 2899 dbSNP
rs1256340538 2914 dbSNP
rs949287611 2917 dbSNP
rs780075006 2918 dbSNP
rs1459774868 2923 dbSNP
rs981918862 2930 dbSNP
rs910555624 2933 dbSNP
rs1020161232 2934 dbSNP
rs943608644 2938 dbSNP
rs1338090627 2941 dbSNP
rs1247003022 2956 dbSNP
rs979055318 2963 dbSNP
rs1314576402 2966 dbSNP
rs184378053 2967 dbSNP
rs566991592 2980 dbSNP
rs768558548 2981 dbSNP
rs868686781 2982 dbSNP
rs1446583491 2983 dbSNP
rs1047962656 2987 dbSNP
rs886815968 2990 dbSNP
rs1215717756 2992 dbSNP
rs1256416967 2996 dbSNP
rs1458957191 2998 dbSNP
rs189269151 3002 dbSNP
rs75079461 3007 dbSNP
rs933435411 3010 dbSNP
rs147814762 3013 dbSNP
rs549269041 3016 dbSNP
rs1178959670 3017 dbSNP
rs1051862062 3022 dbSNP
rs1248280619 3023 dbSNP
rs1001907319 3025 dbSNP
rs746531211 3026 dbSNP
rs1035342170 3030 dbSNP
rs1422041464 3041 dbSNP
rs71379383 3042 dbSNP
rs1488796824 3045 dbSNP
rs1291098023 3047 dbSNP
rs1243951795 3053 dbSNP
rs568484611 3066 dbSNP
rs1368472805 3068 dbSNP
rs1310277054 3077 dbSNP
rs1009316684 3089 dbSNP
rs537462505 3091 dbSNP
rs1303989483 3093 dbSNP
rs182321618 3094 dbSNP
rs1387836351 3096 dbSNP
rs1473500665 3098 dbSNP
rs1168031708 3113 dbSNP
rs1301976422 3133 dbSNP
rs1422229643 3135 dbSNP
rs1361992921 3143 dbSNP
rs1399134240 3147 dbSNP
rs549335858 3152 dbSNP
rs979942071 3163 dbSNP
rs1332523010 3164 dbSNP
rs1433694071 3169 dbSNP
rs1268160592 3175 dbSNP
rs1001200424 3180 dbSNP
rs1399243695 3182 dbSNP
rs1017710852 3183 dbSNP
rs895557773 3187 dbSNP
rs1014038443 3197 dbSNP
rs1348869398 3214 dbSNP
rs186404277 3226 dbSNP
rs1234496274 3228 dbSNP
rs1345371270 3234 dbSNP
rs965057420 3235 dbSNP
rs771148590 3242 dbSNP
rs372222590 3246 dbSNP
rs553892088 3251 dbSNP
rs573758289 3256 dbSNP
rs923512405 3259 dbSNP
rs1399729891 3260 dbSNP
rs1033338892 3273 dbSNP
rs964026738 3276 dbSNP
rs542881417 3280 dbSNP
rs1199019778 3284 dbSNP
rs1197231160 3285 dbSNP
rs983592428 3286 dbSNP
rs1478816760 3288 dbSNP
rs562788965 3289 dbSNP
rs142889111 3290 dbSNP
rs755666855 3296 dbSNP
rs1445482324 3301 dbSNP
rs544597668 3303 dbSNP
rs987488444 3309 dbSNP
rs1482155819 3324 dbSNP
rs386797561 3324 dbSNP
rs1199747834 3325 dbSNP
rs907961024 3325 dbSNP
rs973638071 3326 dbSNP
rs920838634 3327 dbSNP
rs937607353 3343 dbSNP
rs1429492960 3347 dbSNP
rs1256804751 3349 dbSNP
rs1335789084 3363 dbSNP
rs1475880351 3364 dbSNP
rs1055452320 3376 dbSNP
rs1405113382 3376 dbSNP
rs1174060794 3381 dbSNP
rs564516865 3394 dbSNP
rs1420222746 3411 dbSNP
rs1167347599 3416 dbSNP
rs942201416 3425 dbSNP
rs371303194 3427 dbSNP
rs1239389913 3428 dbSNP
rs949705465 3434 dbSNP
rs1461075212 3435 dbSNP
rs533455621 3437 dbSNP
rs139601666 3440 dbSNP
rs1038517526 3446 dbSNP
rs1458592447 3449 dbSNP
rs1171831735 3452 dbSNP
rs904976851 3469 dbSNP
rs1336919990 3481 dbSNP
rs540376933 3505 dbSNP
rs560686166 3506 dbSNP
rs1381643419 3507 dbSNP
rs1032872803 3508 dbSNP
rs1056136232 3529 dbSNP
rs996694762 3530 dbSNP
rs1328135154 3536 dbSNP
rs1408227708 3538 dbSNP
rs190776693 3541 dbSNP
rs181534357 3551 dbSNP
rs561152388 3560 dbSNP
rs1340111808 3563 dbSNP
rs569191534 3570 dbSNP
rs776667211 3571 dbSNP
rs373242940 3573 dbSNP
rs962187834 3578 dbSNP
rs1187834682 3579 dbSNP
rs567586079 3588 dbSNP
rs765560237 3590 dbSNP
rs1222672878 3593 dbSNP
rs1358269946 3594 dbSNP
rs117187029 3596 dbSNP
rs111263083 3600 dbSNP
rs983687624 3611 dbSNP
rs1278787071 3615 dbSNP
rs1439892813 3617 dbSNP
rs764689656 3617 dbSNP
rs909495623 3621 dbSNP
rs963873543 3625 dbSNP
rs1261923959 3629 dbSNP
rs980336988 3633 dbSNP
rs1303820087 3637 dbSNP
rs917506046 3641 dbSNP
rs949695728 3646 dbSNP
rs926327596 3648 dbSNP
rs1407691870 3649 dbSNP
rs902917470 3652 dbSNP
rs1479288378 3655 dbSNP
rs1270312028 3657 dbSNP
rs1199436810 3660 dbSNP
rs1187852680 3663 dbSNP
rs1289077319 3665 dbSNP
rs533838069 3665 dbSNP
rs1264857764 3666 dbSNP
rs1218311353 3672 dbSNP
rs1317182772 3682 dbSNP
rs937784261 3683 dbSNP
rs1197247818 3689 dbSNP
rs1431770306 3691 dbSNP
rs1175852279 3692 dbSNP
rs935787608 3695 dbSNP
rs1404371689 3696 dbSNP
rs1343749322 3700 dbSNP
rs1437191207 3704 dbSNP
rs553610542 3715 dbSNP
rs567423896 3717 dbSNP
rs1400712592 3718 dbSNP
rs1416531791 3724 dbSNP
rs945067102 3736 dbSNP
rs1290811640 3743 dbSNP
rs1430560756 3746 dbSNP
rs367553749 3751 dbSNP
rs1050930556 3761 dbSNP
rs903813792 3774 dbSNP
rs1187829452 3776 dbSNP
rs1001102927 3780 dbSNP
rs891082402 3789 dbSNP
rs1325468075 3796 dbSNP
rs1038867432 3798 dbSNP
rs1385991909 3800 dbSNP
rs900549187 3801 dbSNP
rs1222803910 3802 dbSNP
rs1321383812 3818 dbSNP
rs1280167831 3820 dbSNP
rs1250818633 3828 dbSNP
rs536045986 3830 dbSNP
rs747518853 3834 dbSNP
rs371674568 3856 dbSNP
rs1349960194 3864 dbSNP
rs1450573028 3865 dbSNP
rs1237788154 3866 dbSNP
rs576399305 3870 dbSNP
rs1176210490 3874 dbSNP
rs1468693403 3877 dbSNP
rs962421985 3894 dbSNP
rs1030445764 3895 dbSNP
rs1353745196 3904 dbSNP
rs545360284 3907 dbSNP
rs1418307213 3908 dbSNP
rs1217354979 3914 dbSNP
rs1184433693 3921 dbSNP
rs1462417293 3923 dbSNP
rs1028159057 3928 dbSNP
rs958820373 3935 dbSNP
rs1202873984 3948 dbSNP
rs1244596730 3952 dbSNP
rs745830923 3953 dbSNP
rs950685175 3961 dbSNP
rs991693488 3962 dbSNP
rs1004922466 3971 dbSNP
rs558139912 3972 dbSNP
rs917496231 3976 dbSNP
rs971667766 3979 dbSNP
rs1016524413 3982 dbSNP
rs1190969733 3993 dbSNP
rs1253945363 3994 dbSNP
rs185984220 3999 dbSNP
rs1177260952 4004 dbSNP
rs1248405484 4007 dbSNP
rs1383884654 4009 dbSNP
rs1380257302 4010 dbSNP
rs1450927171 4013 dbSNP
rs1402997510 4016 dbSNP
rs1299269080 4018 dbSNP
rs980643400 4036 dbSNP
rs1371981644 4046 dbSNP
rs1161438536 4047 dbSNP
rs1167756793 4055 dbSNP
rs927498178 4066 dbSNP
rs1385543141 4070 dbSNP
rs1182691178 4074 dbSNP
rs1442549717 4075 dbSNP
rs540693283 4081 dbSNP
rs1457654694 4086 dbSNP
rs991851547 4093 dbSNP
rs1294346742 4096 dbSNP
rs1372839995 4101 dbSNP
rs1249682679 4108 dbSNP
rs751115473 4109 dbSNP
rs1360364930 4114 dbSNP
rs879412716 4118 dbSNP
rs1244184127 4123 dbSNP
rs1337927796 4127 dbSNP
rs540371262 4135 dbSNP
rs1054177491 4139 dbSNP
rs932484597 4158 dbSNP
rs1295935502 4162 dbSNP
rs1050920309 4165 dbSNP
rs1004159444 4166 dbSNP
rs1042075241 4166 dbSNP
rs891022790 4166 dbSNP
rs1422414394 4168 dbSNP
rs1365293145 4169 dbSNP
rs1182337849 4175 dbSNP
rs1418417909 4178 dbSNP
rs1248341329 4181 dbSNP
rs1201599575 4182 dbSNP
rs756767291 4183 dbSNP
rs925150459 4185 dbSNP
rs560397526 4190 dbSNP
rs7225180 4191 dbSNP
rs1261676240 4192 dbSNP
rs1238861554 4206 dbSNP
rs1274687224 4210 dbSNP
rs1470073393 4220 dbSNP
rs900316770 4222 dbSNP
rs1238081288 4228 dbSNP
rs1406204631 4232 dbSNP
rs933181004 4234 dbSNP
rs1051843001 4239 dbSNP
rs886564035 4243 dbSNP
rs562783615 4248 dbSNP
rs769061731 4249 dbSNP
rs531846533 4250 dbSNP
rs1016281977 4252 dbSNP
rs958818781 4252 dbSNP
rs899384506 4253 dbSNP
rs1480753207 4264 dbSNP
rs1013073103 4267 dbSNP
rs1197446533 4279 dbSNP
rs1001812520 4280 dbSNP
rs1035036904 4284 dbSNP
rs750006539 4285 dbSNP
rs1024508560 4290 dbSNP
rs1361778981 4297 dbSNP
rs755763637 4302 dbSNP
rs1463841102 4314 dbSNP
rs1282073273 4315 dbSNP
rs1432969927 4315 dbSNP
rs148736852 4317 dbSNP
rs1355031424 4320 dbSNP
rs1444206762 4321 dbSNP
rs1282365062 4326 dbSNP
rs769888285 4326 dbSNP
rs1381389265 4331 dbSNP
rs1386151464 4336 dbSNP
rs1377747870 4347 dbSNP
rs1470252752 4348 dbSNP
rs571195149 4357 dbSNP
rs373540546 4359 dbSNP
rs966433610 4360 dbSNP
rs1315731458 4365 dbSNP
rs1192778537 4368 dbSNP
rs1197132320 4375 dbSNP
rs370096576 4379 dbSNP
rs924982982 4380 dbSNP
rs779766600 4383 dbSNP
rs974677613 4390 dbSNP
rs749096778 4392 dbSNP
rs1236260302 4393 dbSNP
rs142275701 4394 dbSNP
rs932425510 4397 dbSNP
rs1050870956 4400 dbSNP
rs386797562 4400 dbSNP
rs1188801430 4404 dbSNP
rs1051600559 4405 dbSNP
rs1270315299 4419 dbSNP
rs912364544 4421 dbSNP
rs886490385 4436 dbSNP
rs1477001117 4437 dbSNP
rs1170237712 4438 dbSNP
rs1419888925 4439 dbSNP
rs1411473454 4446 dbSNP
rs899189619 4450 dbSNP
rs567229851 4455 dbSNP
rs762794961 4456 dbSNP
rs1414840853 4457 dbSNP
rs1332151610 4458 dbSNP
rs754906646 4458 dbSNP
rs939864660 4458 dbSNP
rs1314237841 4459 dbSNP
rs1337961786 4462 dbSNP
rs1397275851 4472 dbSNP
rs1167474577 4473 dbSNP
rs1387327243 4474 dbSNP
rs1217566913 4477 dbSNP
rs1270424088 4478 dbSNP
rs1241780225 4479 dbSNP
rs536400422 4480 dbSNP
rs191248972 4481 dbSNP
rs1273094744 4486 dbSNP
rs1194793945 4497 dbSNP
rs899146460 4501 dbSNP
rs1277087586 4503 dbSNP
rs569874567 4515 dbSNP
rs538885915 4516 dbSNP
rs558597218 4523 dbSNP
rs370912540 4525 dbSNP
rs1336335707 4530 dbSNP
rs150813353 4533 dbSNP
rs1487355066 4537 dbSNP
rs1020415979 4542 dbSNP
rs966402307 4546 dbSNP
rs778756914 4547 dbSNP
rs540249353 4548 dbSNP
rs1242946037 4550 dbSNP
rs747107085 4554 dbSNP
rs1470792447 4555 dbSNP
rs770956423 4557 dbSNP
rs1180748193 4569 dbSNP
rs1481805404 4573 dbSNP
rs1476252981 4578 dbSNP
rs1222745260 4580 dbSNP
rs554164219 4581 dbSNP
rs1287450575 4582 dbSNP
rs139220653 4590 dbSNP
rs1278918808 4591 dbSNP
rs1408018776 4595 dbSNP
rs1347440266 4601 dbSNP
rs1435340713 4601 dbSNP
rs1404561485 4611 dbSNP
rs921834455 4612 dbSNP
rs1175447706 4614 dbSNP
rs1401659956 4620 dbSNP
rs933233029 4622 dbSNP
rs1157619242 4629 dbSNP
rs1481734412 4629 dbSNP
rs1270379263 4635 dbSNP
rs1199600666 4645 dbSNP
rs1487920580 4646 dbSNP
rs957896416 4652 dbSNP
rs1027973163 4661 dbSNP
rs987275349 4666 dbSNP
rs953724755 4670 dbSNP
rs1318529123 4681 dbSNP
rs1283352612 4686 dbSNP
rs907727743 4702 dbSNP
rs986487284 4709 dbSNP
rs145293874 4715 dbSNP
rs373077556 4717 dbSNP
rs1365679784 4718 dbSNP
rs562697120 4721 dbSNP
rs1431871913 4724 dbSNP
rs1344952603 4725 dbSNP
rs1037777075 4728 dbSNP
rs1347611760 4737 dbSNP
rs1471240983 4744 dbSNP
rs1235577454 4746 dbSNP
rs576252001 4747 dbSNP
rs920710550 4750 dbSNP
rs1351547287 4752 dbSNP
rs1422558945 4761 dbSNP
rs527771860 4761 dbSNP
rs1055061479 4764 dbSNP
rs1285191366 4767 dbSNP
rs1247176168 4774 dbSNP
rs894457401 4775 dbSNP
rs948704444 4776 dbSNP
rs545265002 4781 dbSNP
rs1209463066 4788 dbSNP
rs1056201926 4802 dbSNP
rs1196478966 4822 dbSNP
rs1245847883 4827 dbSNP
rs896036668 4829 dbSNP
rs565426561 4830 dbSNP
rs1041842535 4838 dbSNP
rs528018642 4842 dbSNP
rs547076189 4843 dbSNP
rs1378443384 4845 dbSNP
rs1000808603 4846 dbSNP
rs1032279024 4848 dbSNP
rs560977630 4851 dbSNP
rs770039863 4852 dbSNP
rs1465026259 4867 dbSNP
rs1356896358 4871 dbSNP
rs78815365 4879 dbSNP
rs1029089913 4880 dbSNP
rs775781361 4891 dbSNP
rs1186370478 4894 dbSNP
rs1446261332 4895 dbSNP
rs953672988 4902 dbSNP
rs987368480 4908 dbSNP
rs907820311 4909 dbSNP
rs1199784371 4917 dbSNP
rs961865321 4920 dbSNP
rs1253145650 4922 dbSNP
rs1205385943 4924 dbSNP
rs549902454 4927 dbSNP
rs1341637954 4943 dbSNP
rs763340008 4944 dbSNP
rs986465963 4945 dbSNP
rs1019359534 4953 dbSNP
rs569837303 4956 dbSNP
rs937428180 4962 dbSNP
rs372742166 4969 dbSNP
rs919727233 4982 dbSNP
rs1306226953 4997 dbSNP
rs1055768874 5012 dbSNP
rs917264117 5014 dbSNP
rs538851903 5016 dbSNP
rs916508647 5022 dbSNP
rs764709797 5029 dbSNP
rs1385600220 5030 dbSNP
rs552383158 5032 dbSNP
rs948693029 5033 dbSNP
rs1045801012 5040 dbSNP
rs903486837 5050 dbSNP
rs1000331392 5055 dbSNP
rs1249774202 5059 dbSNP
rs1224967265 5064 dbSNP
rs1360515943 5065 dbSNP
rs867593513 5070 dbSNP
rs1208227690 5075 dbSNP
rs565812551 5078 dbSNP
rs1055042229 5082 dbSNP
rs1438186758 5084 dbSNP
rs1308379695 5085 dbSNP
rs774953308 5087 dbSNP
rs1349318156 5091 dbSNP
rs376038893 5095 dbSNP
rs1272813727 5105 dbSNP
rs1468720002 5106 dbSNP
rs1365874927 5108 dbSNP
rs761442815 5111 dbSNP
rs1456225565 5114 dbSNP
rs893528409 5123 dbSNP
rs996348865 5124 dbSNP
rs1159714169 5128 dbSNP
rs1053220209 5131 dbSNP
rs893269483 5137 dbSNP
rs1028770736 5142 dbSNP
rs147621665 5156 dbSNP
rs1008601480 5159 dbSNP
rs1014846848 5160 dbSNP
rs961957382 5161 dbSNP
rs973225921 5164 dbSNP
rs553840876 5165 dbSNP
rs370010793 5174 dbSNP
rs749931644 5196 dbSNP
rs373758790 5200 dbSNP
rs1049931588 5202 dbSNP
rs571909146 5204 dbSNP
rs1462272523 5209 dbSNP
rs890078213 5210 dbSNP
rs1328412265 5213 dbSNP
rs1327782029 5216 dbSNP
rs1285895599 5223 dbSNP
rs991962366 5227 dbSNP
rs1322498481 5233 dbSNP
rs1398731983 5233 dbSNP
rs1391255146 5237 dbSNP
rs1321055876 5238 dbSNP
rs78292855 5239 dbSNP
rs556254785 5244 dbSNP
rs994300672 5245 dbSNP
rs1026738284 5253 dbSNP
rs952490985 5254 dbSNP
rs576166228 5259 dbSNP
rs977398267 5264 dbSNP
rs924833781 5268 dbSNP
rs1292875916 5274 dbSNP
rs1262861885 5276 dbSNP
rs1335792503 5281 dbSNP
rs1208559934 5285 dbSNP
rs1463889937 5291 dbSNP
rs755780353 5298 dbSNP
rs1054607240 5308 dbSNP
rs1255996638 5315 dbSNP
rs899981196 5316 dbSNP
rs1273772354 5319 dbSNP
rs1480193087 5321 dbSNP
rs932865499 5323 dbSNP
rs1297985509 5324 dbSNP
rs928596553 5324 dbSNP
rs1434095409 5329 dbSNP
rs934695272 5336 dbSNP
rs1050163753 5345 dbSNP
rs1415021439 5347 dbSNP
rs914664320 5348 dbSNP
rs947556698 5354 dbSNP
rs867562397 5355 dbSNP
rs890025660 5361 dbSNP
rs1188256158 5363 dbSNP
rs1008527743 5369 dbSNP
rs1008406483 5373 dbSNP
rs1014605837 5385 dbSNP
rs545253642 5389 dbSNP
rs1041319262 5390 dbSNP
rs766051743 5394 dbSNP
rs1277274284 5399 dbSNP
rs995178951 5420 dbSNP
rs1340957517 5423 dbSNP
rs1274946560 5427 dbSNP
rs748539327 5432 dbSNP
rs993857202 5433 dbSNP
rs1316949804 5441 dbSNP
rs367868029 5442 dbSNP
rs1448667056 5448 dbSNP
rs142153662 5450 dbSNP
rs1476021851 5453 dbSNP
rs1027142962 5456 dbSNP
rs1411739028 5457 dbSNP
rs572643240 5458 dbSNP
rs1168171962 5460 dbSNP
rs1012068861 5467 dbSNP
rs1387464333 5473 dbSNP
rs1461817084 5477 dbSNP
rs1023501297 5486 dbSNP
rs541718626 5488 dbSNP
rs560672943 5489 dbSNP
rs970561145 5494 dbSNP
rs982412584 5494 dbSNP
rs1399310095 5496 dbSNP
rs1394346430 5501 dbSNP
rs971465248 5503 dbSNP
rs977365802 5507 dbSNP
rs529732910 5510 dbSNP
rs956197965 5512 dbSNP
rs1356337495 5517 dbSNP
rs988859488 5520 dbSNP
rs1355476276 5521 dbSNP
rs1276564818 5523 dbSNP
rs1306659685 5525 dbSNP
rs924633764 5526 dbSNP
rs1444408738 5532 dbSNP
rs539192629 5537 dbSNP
rs1307567464 5543 dbSNP
rs947506108 5544 dbSNP
rs985524039 5552 dbSNP
rs1209521771 5556 dbSNP
rs549865574 5558 dbSNP
rs1412197930 5567 dbSNP
rs1486374943 5580 dbSNP
rs144373816 5581 dbSNP
rs1041660411 5594 dbSNP
rs532273463 5595 dbSNP
rs754711823 5600 dbSNP
rs932808587 5602 dbSNP
rs1048082149 5608 dbSNP
rs888184005 5613 dbSNP
rs552083083 5616 dbSNP
rs1051267280 5626 dbSNP
rs1011973861 5629 dbSNP
rs533984378 5632 dbSNP
rs906324114 5632 dbSNP
rs565877710 5642 dbSNP
rs534568356 5656 dbSNP
rs572944113 5657 dbSNP
rs1294362678 5659 dbSNP
rs1436689267 5669 dbSNP
rs1348470211 5672 dbSNP
rs897462809 5676 dbSNP
rs1320768749 5681 dbSNP
rs989208269 5686 dbSNP
rs1021554302 5702 dbSNP
rs994539960 5705 dbSNP
rs758309577 5711 dbSNP
rs781187573 5713 dbSNP
rs1426777106 5719 dbSNP
rs147803412 5720 dbSNP
rs968711120 5725 dbSNP
rs1173958326 5727 dbSNP
rs1210367371 5728 dbSNP
rs750509539 5729 dbSNP
rs371498007 5734 dbSNP
rs1206847532 5744 dbSNP
rs1024107602 5749 dbSNP
rs1329140891 5750 dbSNP
rs971431200 5752 dbSNP
rs911316239 5759 dbSNP
rs1233397629 5762 dbSNP
rs1365830422 5763 dbSNP
rs944196522 5766 dbSNP
rs976986631 5768 dbSNP
rs533911529 5769 dbSNP
rs1319160464 5770 dbSNP
rs1471272164 5775 dbSNP
rs1031785921 5783 dbSNP
rs567287876 5789 dbSNP
rs866179379 5794 dbSNP
rs745951793 5810 dbSNP
rs1176226097 5814 dbSNP
rs1422622470 5821 dbSNP
rs1190224901 5826 dbSNP
rs1449871868 5842 dbSNP
rs1247236706 5851 dbSNP
rs957594490 5862 dbSNP
rs1186560308 5866 dbSNP
rs1484234211 5868 dbSNP
rs1259760961 5869 dbSNP
rs1310596168 5872 dbSNP
rs1277080690 5875 dbSNP
rs1229540495 5884 dbSNP
rs1486025626 5889 dbSNP
rs532348386 5894 dbSNP
rs1187470091 5907 dbSNP
rs930271113 5912 dbSNP
rs1455036798 5915 dbSNP
rs1452984856 5923 dbSNP
rs990205413 5926 dbSNP
rs148837773 5930 dbSNP
rs1446686636 5933 dbSNP
rs1048689863 5937 dbSNP
rs1396248943 5938 dbSNP
rs1170071576 5943 dbSNP
rs954284749 5944 dbSNP
rs888089099 5945 dbSNP
rs1436634760 5951 dbSNP
rs1157081748 5952 dbSNP
rs947702212 5953 dbSNP
rs1344825741 5954 dbSNP
rs1454440347 5956 dbSNP
rs1425428167 5959 dbSNP
rs556168987 5966 dbSNP
rs1256784875 5974 dbSNP
rs1181313857 5975 dbSNP
rs1482332882 5975 dbSNP
rs763097149 5975 dbSNP
rs906314546 5977 dbSNP
rs1003782161 5982 dbSNP
rs769909445 5985 dbSNP
rs1272856676 5987 dbSNP
rs1247444068 5990 dbSNP
rs1322802751 5994 dbSNP
rs986937522 6003 dbSNP
rs1312661786 6006 dbSNP
rs1227154662 6007 dbSNP
rs1376304314 6015 dbSNP
rs79510689 6019 dbSNP
rs539165930 6021 dbSNP
rs1410043599 6022 dbSNP
rs573605888 6025 dbSNP
rs547133058 6026 dbSNP
rs1010801160 6027 dbSNP
rs1459279578 6029 dbSNP
rs770969240 6029 dbSNP
rs558841396 6044 dbSNP
rs1368938174 6049 dbSNP
rs1163967688 6051 dbSNP
rs1237312514 6057 dbSNP
rs1022172206 6060 dbSNP
rs968657289 6061 dbSNP
rs1006881161 6078 dbSNP
rs1249924164 6080 dbSNP
rs1036099993 6089 dbSNP
rs1217425723 6090 dbSNP
rs572600600 6091 dbSNP
rs541333740 6096 dbSNP
rs1213509796 6098 dbSNP
rs1331914651 6102 dbSNP
rs1048730032 6110 dbSNP
rs1289619319 6112 dbSNP
rs1254158913 6119 dbSNP
rs183118250 6127 dbSNP
rs1012806712 6130 dbSNP
rs1045648146 6132 dbSNP
rs1349452192 6132 dbSNP
rs907032647 6133 dbSNP
rs1391149246 6138 dbSNP
rs998680063 6141 dbSNP
rs575244058 6144 dbSNP
rs1407273704 6145 dbSNP
rs1456273434 6156 dbSNP
rs1390749809 6159 dbSNP
rs910141713 6159 dbSNP
rs1032170924 6165 dbSNP
rs1409911468 6166 dbSNP
rs1201239867 6167 dbSNP
rs544201541 6174 dbSNP
rs1460710403 6177 dbSNP
rs1267090665 6185 dbSNP
rs927692257 6192 dbSNP
rs939088987 6195 dbSNP
rs762462329 6202 dbSNP
rs1269355613 6203 dbSNP
rs892262018 6212 dbSNP
rs563319284 6219 dbSNP
rs1048488565 6221 dbSNP
rs187613113 6222 dbSNP
rs1331389764 6227 dbSNP
rs1444400605 6229 dbSNP
rs772623025 6230 dbSNP
rs1438477909 6233 dbSNP
rs1018258950 6237 dbSNP
rs1321112072 6241 dbSNP
rs1456676607 6252 dbSNP
rs1028337068 6259 dbSNP
rs1382874781 6270 dbSNP
rs1297556207 6281 dbSNP
rs965772788 6282 dbSNP
rs954253521 6287 dbSNP
rs1026151531 6300 dbSNP
rs1451743556 6306 dbSNP
rs1249089376 6313 dbSNP
rs1188454816 6314 dbSNP
rs545887763 6316 dbSNP
rs987030116 6322 dbSNP
rs1281512586 6323 dbSNP
rs984320824 6324 dbSNP
rs1274124190 6326 dbSNP
rs1470117354 6328 dbSNP
rs772664820 6342 dbSNP
rs1231682479 6350 dbSNP
rs1298149990 6352 dbSNP
rs746707182 6357 dbSNP
rs1202977114 6364 dbSNP
rs143467652 6374 dbSNP
rs961528165 6375 dbSNP
rs528306348 6388 dbSNP
rs969650037 6392 dbSNP
rs1401708070 6404 dbSNP
rs1179075471 6409 dbSNP
rs981035388 6423 dbSNP
rs972963633 6427 dbSNP
rs1391166859 6447 dbSNP
rs1168417117 6449 dbSNP
rs918969529 6454 dbSNP
rs939018748 6455 dbSNP
rs930424755 6459 dbSNP
rs1415940475 6463 dbSNP
rs1442471749 6468 dbSNP
rs1475043085 6471 dbSNP
rs1208272396 6472 dbSNP
rs1165934666 6473 dbSNP
rs1419691215 6477 dbSNP
rs1444296812 6478 dbSNP
rs548120388 6480 dbSNP
rs562601661 6484 dbSNP
rs948419323 6485 dbSNP
rs1339916033 6491 dbSNP
rs1311213976 6501 dbSNP
rs753441554 6506 dbSNP
rs1045617167 6512 dbSNP
rs1408591384 6517 dbSNP
rs1416470732 6518 dbSNP
rs907168706 6526 dbSNP
rs998606093 6527 dbSNP
rs1472796178 6531 dbSNP
rs1052964128 6537 dbSNP
rs1185178152 6539 dbSNP
rs1473329891 6544 dbSNP
rs1443720514 6546 dbSNP
rs1252130390 6550 dbSNP
rs893181314 6554 dbSNP
rs1204120005 6556 dbSNP
rs759155535 6565 dbSNP
rs1435845633 6588 dbSNP
rs1310613022 6590 dbSNP
rs1011680162 6598 dbSNP
rs765064207 6599 dbSNP
rs1210358015 6600 dbSNP
rs1355629221 6604 dbSNP
rs530762501 6613 dbSNP
rs1230312601 6621 dbSNP
rs889776163 6629 dbSNP
rs1287935828 6631 dbSNP
rs1440340355 6633 dbSNP
rs577532165 6645 dbSNP
rs1019873511 6646 dbSNP
rs368221918 6648 dbSNP
rs113835482 6657 dbSNP
rs973284942 6658 dbSNP
rs538708022 6665 dbSNP
rs1162123076 6670 dbSNP
rs1272897363 6670 dbSNP
rs746989326 6677 dbSNP
rs777695972 6678 dbSNP
rs1412129397 6690 dbSNP
rs1027175316 6695 dbSNP
rs953017662 6696 dbSNP
rs1248231372 6707 dbSNP
rs1199325070 6709 dbSNP
rs191022706 6710 dbSNP
rs915696450 6715 dbSNP
rs1210565779 6716 dbSNP
rs948388858 6719 dbSNP
rs1329895134 6725 dbSNP
rs1222266806 6728 dbSNP
rs566104312 6728 dbSNP
rs1370013783 6729 dbSNP
rs535202797 6731 dbSNP
rs928520106 6732 dbSNP
rs1275743196 6733 dbSNP
rs555228569 6738 dbSNP
rs1369362595 6742 dbSNP
rs1323113636 6751 dbSNP
rs1458267682 6760 dbSNP
rs1388727607 6763 dbSNP
rs750479624 6766 dbSNP
rs1053339303 6769 dbSNP
rs1185771297 6771 dbSNP
rs1172909612 6783 dbSNP
rs892951827 6785 dbSNP
rs575206346 6791 dbSNP
rs946498004 6792 dbSNP
rs1049826861 6795 dbSNP
rs1190424365 6797 dbSNP
rs1465332557 6798 dbSNP
rs889913084 6803 dbSNP
rs979163971 6804 dbSNP
rs1008190902 6807 dbSNP
rs140631091 6817 dbSNP
rs1314122342 6822 dbSNP
rs1279628542 6828 dbSNP
rs369635222 6836 dbSNP
rs943208805 6837 dbSNP
rs897389778 6844 dbSNP
rs994414443 6846 dbSNP
rs1027680682 6847 dbSNP
rs1314299088 6857 dbSNP
rs901790498 6858 dbSNP
rs145883586 6870 dbSNP
rs1393021597 6871 dbSNP
rs1170263942 6873 dbSNP
rs1449929270 6883 dbSNP
rs1418750961 6886 dbSNP
rs556955230 6888 dbSNP
rs1022630906 6895 dbSNP
rs1231187214 6896 dbSNP
rs1210435257 6897 dbSNP
rs538962838 6897 dbSNP
rs576795160 6901 dbSNP
rs1229610897 6903 dbSNP
rs981044423 6903 dbSNP
rs905329732 6904 dbSNP
rs1002821406 6907 dbSNP
rs1035276427 6910 dbSNP
rs1211743820 6912 dbSNP
rs1380697386 6914 dbSNP
rs1302977243 6925 dbSNP
rs1311081090 6926 dbSNP
rs756167171 6930 dbSNP
rs544778889 6931 dbSNP
rs934343410 6933 dbSNP
rs1020549790 6935 dbSNP
rs988730038 6937 dbSNP
rs1425555669 6942 dbSNP
rs769624730 6943 dbSNP
rs1476282457 6944 dbSNP
rs914506727 6945 dbSNP
rs780172534 6948 dbSNP
rs947236637 6949 dbSNP
rs1049590181 6951 dbSNP
rs979110110 6956 dbSNP
rs889847713 6957 dbSNP
rs775458103 6963 dbSNP
rs1175038107 6964 dbSNP
rs1382321979 6968 dbSNP
rs1232183023 6973 dbSNP
rs115037934 6974 dbSNP
rs559945380 6975 dbSNP
rs1346111530 6976 dbSNP
rs1437770249 6977 dbSNP
rs749564530 6979 dbSNP
rs1370978867 6980 dbSNP
rs768981005 6984 dbSNP
rs1041176228 6992 dbSNP
rs897148883 6994 dbSNP
rs1350406284 6995 dbSNP
rs923192332 6996 dbSNP
rs1459965378 7003 dbSNP
rs142981570 7008 dbSNP
rs527762967 7012 dbSNP
rs1047660142 7024 dbSNP
rs1348616059 7026 dbSNP
rs1248784616 7032 dbSNP
rs1048638409 7033 dbSNP
rs887070130 7034 dbSNP
rs888698690 7037 dbSNP
rs941352370 7039 dbSNP
rs1212421183 7043 dbSNP
rs779482829 7046 dbSNP
rs1012383724 7047 dbSNP
rs1204827269 7047 dbSNP
rs73987388 7052 dbSNP
rs969755115 7053 dbSNP
rs1002558972 7057 dbSNP
rs1035431870 7059 dbSNP
rs748519003 7062 dbSNP
rs1325117027 7066 dbSNP
rs1252312708 7067 dbSNP
rs988920654 7068 dbSNP
rs896665640 7070 dbSNP
rs1010209887 7072 dbSNP
rs1021164890 7076 dbSNP
rs1453239368 7093 dbSNP
rs1362310610 7094 dbSNP
rs1195418640 7100 dbSNP
rs1434098412 7101 dbSNP
rs967653836 7105 dbSNP
rs1192304063 7106 dbSNP
rs541623189 7107 dbSNP
rs1158824477 7114 dbSNP
rs138815874 7121 dbSNP
rs773711947 7125 dbSNP
rs1409648773 7128 dbSNP
rs1349457019 7129 dbSNP
rs1459172995 7140 dbSNP
rs1017303706 7142 dbSNP
rs149374132 7153 dbSNP
rs943883938 7156 dbSNP
rs1438546477 7161 dbSNP
rs144703034 7162 dbSNP
rs1041145580 7165 dbSNP
rs768621089 7166 dbSNP
rs918705821 7167 dbSNP
rs929955027 7168 dbSNP
rs114149516 7169 dbSNP
rs1394844777 7174 dbSNP
rs183432343 7175 dbSNP
rs1451809283 7186 dbSNP
rs1012471222 7188 dbSNP
rs1391362239 7204 dbSNP
rs1238372359 7210 dbSNP