miRTarBase - #MIRT628276 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CYB5D1   
Synonyms -
Description cytochrome b5 domain containing 1
Transcript NM_144607   
Expression
Putative miRNA Targets on CYB5D1
3'UTR of CYB5D1
(miRNA target sites are highlighted)
>CYB5D1|NM_144607|3'UTR
   1 GCAAGGAGATGTACACTCGTGTAGACTCAAGACGTATTTCGAGTTTGGCTTTTTCTGTGCCTTGAGGAAAAGTGGTGGGG
  81 CCGAGGGGTGCCTGGACCCAGATCTCCACTCCTCTCCAGGAGCTAGCCTGTGCCCTTCTGAAGTGTAAAGGCCCTATTCC
 161 CTGCCTTCATTACAGTTTGCTCTGAGAAAATTAGTGAATTAATCTTTGGGAATGATACAAGAAGATCAAGTACCTTGGTT
 241 TAGGGAGATGTAGAAGAGGATAGTCAGAGTTCAGGCAGAACTGTTTGATAGTTAAGAGAGAGTAGTTCTACAGGGGTGAG
 321 GGATGGAAGGACTTTTTTGGCAATGATGGAAATGAGATGTCTGCAGGAAGATGGGATTTACAAAGAAATAGGAAATGTTT
 401 ATCATTGACCATACAAAGCTGGCTTATCTTACTTGTAGAAGAGTGTTTGGCAGCTGAAACCCAAGGGAAAGAAAGGAAGT
 481 GCGTCATTATAGGCAATTCAGGCTAGATATTATACTAGGTACTTCATATACCCTCTTTTTTTTTTTTGCCCCCAACAAAG
 561 AGAAGGGGTCTTGCTCTGTCACCCAGTCTGGAGTGCAGTGGCAAAATCATGGCTCACTGCAGCCTGGAGCTCCTGGGCAC
 641 AAGTGATCCTCCCATCTCTGCCTTGAGTAGCTGGGACTTCAGGTGCACGCCACAATGCCTAATTTTTTAATTTTTTGTAG
 721 ACACAGGGTCTCGCTGTGTTGCCCAGGCTGGTTTCAACCTCCTGGCCTCAAGTGATCCTCTTGCCTCAGCCTCCCAAATA
 801 GCCTCTTCAAGACAACTACCCCATAAGGTGGATTACCATTACTATGTTACAGATAAGTCCTTCGAAACTTTGGAAAGTTT
 881 AATAGCTCAAAGCCACACTAGGTAGTAACCACTAGAGCCAGAATGCAAATTCAAGTCTGCCCAACTCCAAAGTCCATGTT
 961 CTCTCAATATAAAGGGACCATCTCAATGTCTAATCTCATGTTAACATTTGTAGCCACTGCTCTCAGCAAGTATTTGGGAT
1041 GTGGCTTTGTCCTAGGATCCCTGCACAATAGGAAATTGTGGTCCTATTGTATAGTTTGCAGTTATTGTCTCTGGAAGGGA
1121 GTTTGCAGAGTTCTCCTGTGGCGAAGAGGAGGCAAGGAAGGCTAAGTGTCAGTTAAGCAATAGCTATTGGGGCTACTTCT
1201 TTGTTAATCCCATACCCCAGATTTCTCTCCTGACCTTTTGGGGCAAAGAGGTGGGTATTTACTAACTTGAAGGAAAACTA
1281 GAGTGGGGAAAAGGCCGGCAAATTAGTGACACTTTGGCGAGGGAGAAAAAGGAGGCAGTTTGCCACTTGGAGAAGATGAG
1361 GAAGACAGGGTTGCAAGACGGTGACTCCAAAAGAGGGAGCTCGACAGGGGTAATGTAAACAGAGATGCTAACTAAGTCAG
1441 AAAACTCTCCTGGTGACCAAAAGAGAACCACTATTGGGGGTAATGGCTAGATTTGGTCTCCTTTAACTTAAGGAGGGGAG
1521 ATTTGAGAATGACAGACAGTTGAACTTCCTGGCAGCAGCAAGCAAAAAACAAATCAGGAAGAGTTTAGTGTGTCTTCTGG
1601 CAGGGGACACCAGGGCCCAGCACAGGAGAAGGTGGCCCCTGTGAGATACTGGTGGGCTATATAGGCATTTTCTGAGGGGC
1681 TTTGGGAGGCATGAACAAAGGTGGAAACATTGCTGTTGGCTTCGGCAGTATCTGAATTTACTGTGAGATGGAGGGTTTAA
1761 ATCTAACCCCATGGAATGCAGGAGTCCATGAATTATCTAAATCGATCATTTTGATCTTTAATCAACTCTGCAATTATGTG
1841 TACCTTGTTTGCTCAATTAAACCCTGAACTATTTGAGAATGAAAGCTATGCTGTTCCTCTAGTGCAAGCCTCAGGGCCTG
1921 TCCTGTGCCTACAGGATGTCCCCATTCTGCCAAAACCTGTCCCTCTTCCAGAGACTCCTACTTCAATGTCTCTTGCTAGA
2001 AACACATCCCTTTCCTCACACATCCAGTCACTCATCAAGTGTAATCTGTCTCCTAAATATCTCTGGAACCTATCTTCTTT
2081 TCTCCAAGTTACCATCACCTCTTGTCTAAACTGCTACGGAAACTTCCTAACCTGTTCTCCCATTTCCACTTCTGACTTCC
2161 ATGCTGCAATGAGAGTCAGCTATGAAAAACAAACCTAAACATCGAACTTTCCTTAGCTTCTTCAGTGGCTTCCAACTGCT
2241 TTTGGAATAAAGTCCTAAATTCAAAGATCTTGTATAAATCAGGCTCATCTCGCAACACCCCTCTTTGTTCTCTATGGCCT
2321 AGACACACTGGCTTTCAGTTCATTACATGTCTTGCCTCAGACCCTCACACACTGTCCTCTCTGCCTGCAACACTCTTCCT
2401 TTCACTTTCCACCTAGCTGATCCTAAATGTTCCTTCCTCAGGGAGGTCTTTTCTGATTTCTTGGTGGGTCAAGACTTTCT
2481 GATAAATCAGTTAGCACCATGCATTTTCCAGAGTTTTTATTACAATTGTAAAATTATGGCTGTAATAGGCTGGCTGCGCT
2561 GCTAGATTGTAAGCTCACGAGGGCAGAGATCTTGTTCACATCTTGCTCACTGCTATATTCTCATTGCTGAGCACACAGTT
2641 GCAGCTCAATAAATTTTGAATGAACTCCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUA------ACAG----UGUGAGGu 5'
             ||||::|      || |    ||||||: 
Target 5' cacACACTGTCCTCTCTGCCTGCAACACTCTt 3'
2366 - 2397 131.00 -12.51
2
miRNA  3' guUUGU----GGUAA-CAGUGUG-AGGu 5'
            ||||    || ||  |||||| ||| 
Target 5' gaAACACATCCCTTTCCTCACACATCCa 3'
1999 - 2026 130.00 -15.36
3
miRNA  3' guuugugguaACAGUGUGAGgu 5'
                    ||| ||||||  
Target 5' -gcaaggagaTGT-ACACTCgt 3'
1 - 20 127.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30455500 19 COSMIC
COSN26972562 20 COSMIC
COSN30521205 35 COSMIC
COSN30516124 40 COSMIC
COSN30487767 86 COSMIC
COSN1202125 116 COSMIC
COSN31599058 153 COSMIC
COSN20113485 548 COSMIC
COSN15300169 672 COSMIC
COSN2493662 1135 COSMIC
COSN22245525 2196 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773081847 1 dbSNP
rs1413810956 5 dbSNP
rs762618282 9 dbSNP
rs752190170 12 dbSNP
rs1231913144 17 dbSNP
rs751437652 19 dbSNP
rs1348392605 20 dbSNP
rs778606811 27 dbSNP
rs551386324 29 dbSNP
rs745548841 29 dbSNP
rs760902103 33 dbSNP
rs1391652632 34 dbSNP
rs764272834 34 dbSNP
rs753910540 35 dbSNP
rs769061560 36 dbSNP
rs757572263 38 dbSNP
rs371586358 41 dbSNP
rs376697360 42 dbSNP
rs747512422 44 dbSNP
rs1455012146 50 dbSNP
rs1164248868 54 dbSNP
rs1466397580 58 dbSNP
rs533902225 62 dbSNP
rs919525654 76 dbSNP
rs879015952 81 dbSNP
rs1004682620 83 dbSNP
rs1035524748 84 dbSNP
rs1451778570 88 dbSNP
rs952437755 95 dbSNP
rs1419973936 96 dbSNP
rs1250247686 101 dbSNP
rs985041784 103 dbSNP
rs1342245566 114 dbSNP
rs960857018 117 dbSNP
rs1012743710 136 dbSNP
rs2131809 139 dbSNP
rs1224928931 143 dbSNP
rs1023661071 145 dbSNP
rs555901982 148 dbSNP
rs1339647205 168 dbSNP
rs1353605459 176 dbSNP
rs979692808 180 dbSNP
rs146325540 182 dbSNP
rs1315981843 184 dbSNP
rs1260633727 187 dbSNP
rs1460508732 194 dbSNP
rs1203531731 220 dbSNP
rs1225145077 221 dbSNP
rs1257448351 226 dbSNP
rs1444670513 233 dbSNP
rs1346013667 244 dbSNP
rs1302443857 245 dbSNP
rs1191480057 246 dbSNP
rs1040498183 248 dbSNP
rs1478237120 251 dbSNP
rs773062995 253 dbSNP
rs538326001 254 dbSNP
rs778171286 259 dbSNP
rs1427232122 262 dbSNP
rs1157348796 274 dbSNP
rs556822568 286 dbSNP
rs934654547 288 dbSNP
rs1199320588 294 dbSNP
rs1205206306 295 dbSNP
rs545250303 295 dbSNP
rs187006286 298 dbSNP
rs944509613 308 dbSNP
rs190154749 309 dbSNP
rs1317307373 323 dbSNP
rs1323955432 334 dbSNP
rs139520724 349 dbSNP
rs1230964595 352 dbSNP
rs1328147093 356 dbSNP
rs930289939 359 dbSNP
rs1297729650 371 dbSNP
rs1048970690 373 dbSNP
rs886326082 390 dbSNP
rs1388124021 393 dbSNP
rs149552503 394 dbSNP
rs1056339090 404 dbSNP
rs1280999204 404 dbSNP
rs1035404556 406 dbSNP
rs1233295901 409 dbSNP
rs896292037 411 dbSNP
rs780156161 413 dbSNP
rs1257315286 416 dbSNP
rs530577159 419 dbSNP
rs1477287728 428 dbSNP
rs1203910846 431 dbSNP
rs993929217 443 dbSNP
rs1193207275 449 dbSNP
rs1427382971 451 dbSNP
rs548267025 465 dbSNP
rs1023695869 466 dbSNP
rs747191319 467 dbSNP
rs1488835678 477 dbSNP
rs539812572 483 dbSNP
rs74578237 484 dbSNP
rs528990443 485 dbSNP
rs1226666845 491 dbSNP
rs374139708 493 dbSNP
rs1364541885 495 dbSNP
rs1295566590 502 dbSNP
rs1267000992 503 dbSNP
rs1454728379 504 dbSNP
rs1000828452 509 dbSNP
rs1031266757 511 dbSNP
rs1480271153 516 dbSNP
rs1176867279 521 dbSNP
rs543884352 523 dbSNP
rs562752765 532 dbSNP
rs1333871587 536 dbSNP
rs1429748574 536 dbSNP
rs1453029706 536 dbSNP
rs57736014 536 dbSNP
rs796585222 536 dbSNP
rs80139737 537 dbSNP
rs1184919674 548 dbSNP
rs199816379 548 dbSNP
rs551663824 549 dbSNP
rs1360874284 550 dbSNP
rs1421261634 551 dbSNP
rs1301102605 552 dbSNP
rs1344465631 553 dbSNP
rs1439319158 557 dbSNP
rs566602604 564 dbSNP
rs1195140586 567 dbSNP
rs1339987738 569 dbSNP
rs1272484882 584 dbSNP
rs1248301440 597 dbSNP
rs988895355 598 dbSNP
rs1333480229 610 dbSNP
rs964545215 613 dbSNP
rs974539732 618 dbSNP
rs947381654 634 dbSNP
rs1044724476 635 dbSNP
rs1409693625 639 dbSNP
rs1369253415 645 dbSNP
rs181872284 649 dbSNP
rs1424771609 684 dbSNP
rs1412508131 687 dbSNP
rs527709190 689 dbSNP
rs112820404 690 dbSNP
rs1181193187 696 dbSNP
rs1355097631 698 dbSNP
rs984458506 701 dbSNP
rs185806388 702 dbSNP
rs55869181 709 dbSNP
rs567641697 709 dbSNP
rs1290115189 721 dbSNP
rs538387683 725 dbSNP
rs1490524504 731 dbSNP
rs994351191 733 dbSNP
rs940642725 734 dbSNP
rs888127986 737 dbSNP
rs1056773020 756 dbSNP
rs1280440564 772 dbSNP
rs1228202254 778 dbSNP
rs1349120692 785 dbSNP
rs1192002629 790 dbSNP
rs1305468006 796 dbSNP
rs1006517065 804 dbSNP
rs1017876412 817 dbSNP
rs964990960 819 dbSNP
rs976331324 820 dbSNP
rs896333882 839 dbSNP
rs1380804538 844 dbSNP
rs1421506054 845 dbSNP
rs947855193 858 dbSNP
rs1471472760 860 dbSNP
rs368357974 864 dbSNP
rs1030530782 865 dbSNP
rs1477689135 866 dbSNP
rs956221523 871 dbSNP
rs989316309 884 dbSNP
rs1448921495 896 dbSNP
rs1294956351 899 dbSNP
rs1393945187 902 dbSNP
rs1285251475 903 dbSNP
rs1208401064 904 dbSNP
rs1327486962 905 dbSNP
rs1390283138 910 dbSNP
rs914640062 913 dbSNP
rs144187554 918 dbSNP
rs1272531179 942 dbSNP
rs571821489 958 dbSNP
rs538807442 964 dbSNP
rs1345316682 976 dbSNP
rs1000940754 977 dbSNP
rs1319430133 979 dbSNP
rs1455374093 980 dbSNP
rs1408009133 981 dbSNP
rs1378279127 982 dbSNP
rs1413775080 1003 dbSNP
rs927289881 1006 dbSNP
rs1031045334 1013 dbSNP
rs892441663 1018 dbSNP
rs1248768606 1021 dbSNP
rs1188163710 1024 dbSNP
rs1463759960 1033 dbSNP
rs897005685 1043 dbSNP
rs1211300144 1048 dbSNP
rs554466865 1073 dbSNP
rs1321531460 1078 dbSNP
rs748212630 1086 dbSNP
rs1048619318 1087 dbSNP
rs1362030470 1094 dbSNP
rs572614412 1097 dbSNP
rs1222525160 1100 dbSNP
rs1296302905 1109 dbSNP
rs1432365201 1113 dbSNP
rs1384553324 1114 dbSNP
rs888167318 1116 dbSNP
rs1267430603 1124 dbSNP
rs1479802533 1128 dbSNP
rs1410529688 1131 dbSNP
rs769889984 1134 dbSNP
rs964248960 1137 dbSNP
rs1168053861 1143 dbSNP
rs1007040813 1144 dbSNP
rs975520767 1151 dbSNP
rs1017990778 1152 dbSNP
rs1027104591 1159 dbSNP
rs997799526 1162 dbSNP
rs1030561674 1164 dbSNP
rs1198078818 1172 dbSNP
rs1207225588 1179 dbSNP
rs1343512211 1180 dbSNP
rs1273201872 1184 dbSNP
rs1225592122 1188 dbSNP
rs1238927860 1197 dbSNP
rs1361097308 1198 dbSNP
rs1441402377 1212 dbSNP
rs148689920 1216 dbSNP
rs1395133942 1218 dbSNP
rs956424178 1228 dbSNP
rs3840058 1231 dbSNP
rs1022136903 1233 dbSNP
rs1369904711 1235 dbSNP
rs1307442173 1237 dbSNP
rs984487908 1239 dbSNP
rs1165745473 1240 dbSNP
rs1370982659 1253 dbSNP
rs1423517326 1267 dbSNP
rs1412000048 1279 dbSNP
rs1179321063 1284 dbSNP
rs554974594 1287 dbSNP
rs376895442 1289 dbSNP
rs561391932 1289 dbSNP
rs960001652 1292 dbSNP
rs762677551 1293 dbSNP
rs940322933 1297 dbSNP
rs770700127 1298 dbSNP
rs1265590290 1302 dbSNP
rs573301060 1306 dbSNP
rs543946147 1309 dbSNP
rs73977771 1319 dbSNP
rs947919804 1322 dbSNP
rs533155757 1336 dbSNP
rs1044953551 1337 dbSNP
rs925103092 1338 dbSNP
rs147820314 1341 dbSNP
rs1379145918 1357 dbSNP
rs1349696409 1372 dbSNP
rs1229213138 1374 dbSNP
rs1315350208 1380 dbSNP
rs936760259 1381 dbSNP
rs1294207711 1396 dbSNP
rs190178352 1403 dbSNP
rs1161673546 1406 dbSNP
rs182347731 1406 dbSNP
rs1258716920 1407 dbSNP
rs892479326 1408 dbSNP
rs112327778 1411 dbSNP
rs1180648604 1420 dbSNP
rs900852981 1423 dbSNP
rs1041309965 1426 dbSNP
rs900119228 1427 dbSNP
rs997829327 1428 dbSNP
rs1487271504 1435 dbSNP
rs1201636288 1439 dbSNP
rs527610167 1443 dbSNP
rs1209005044 1445 dbSNP
rs1027133881 1464 dbSNP
rs528140995 1474 dbSNP
rs139633609 1475 dbSNP
rs1225205484 1476 dbSNP
rs59836308 1482 dbSNP
rs1331614203 1485 dbSNP
rs1005940779 1491 dbSNP
rs1010898682 1493 dbSNP
rs1386307521 1514 dbSNP
rs1365645565 1517 dbSNP
rs1015065685 1518 dbSNP
rs796581556 1519 dbSNP
rs961738464 1527 dbSNP
rs1388351362 1531 dbSNP
rs1157424311 1535 dbSNP
rs1417146509 1540 dbSNP
rs1477255328 1551 dbSNP
rs561305538 1571 dbSNP
rs1378753568 1578 dbSNP
rs1425092565 1579 dbSNP
rs116421338 1581 dbSNP
rs1001585524 1589 dbSNP
rs1188788253 1592 dbSNP
rs917581216 1593 dbSNP
rs752245139 1595 dbSNP
rs1449473434 1596 dbSNP
rs760138792 1614 dbSNP
rs376235961 1616 dbSNP
rs936459607 1618 dbSNP
rs918572083 1620 dbSNP
rs1231030980 1625 dbSNP
rs1052525510 1626 dbSNP
rs185199932 1632 dbSNP
rs1299992417 1635 dbSNP
rs1436020818 1638 dbSNP
rs984424534 1646 dbSNP
rs1399588548 1660 dbSNP
rs1279100873 1661 dbSNP
rs371397589 1663 dbSNP
rs1221761281 1667 dbSNP
rs8080692 1668 dbSNP
rs1312643997 1678 dbSNP
rs1039493629 1697 dbSNP
rs374524731 1699 dbSNP
rs899816621 1701 dbSNP
rs933653055 1705 dbSNP
rs997086016 1715 dbSNP
rs564316769 1717 dbSNP
rs892124073 1724 dbSNP
rs368717326 1725 dbSNP
rs888635371 1726 dbSNP
rs191037211 1732 dbSNP
rs758697132 1739 dbSNP
rs565915413 1752 dbSNP
rs549151230 1755 dbSNP
rs1341409170 1767 dbSNP
rs1276784370 1769 dbSNP
rs962134407 1773 dbSNP
rs1341665158 1786 dbSNP
rs1295636180 1791 dbSNP
rs1479288834 1792 dbSNP
rs1013332216 1793 dbSNP
rs1247340276 1794 dbSNP
rs1025085276 1797 dbSNP
rs372344502 1798 dbSNP
rs564950677 1798 dbSNP
rs763860159 1798 dbSNP
rs774180971 1800 dbSNP
rs562689072 1802 dbSNP
rs1034404283 1804 dbSNP
rs1178909272 1805 dbSNP
rs969029674 1807 dbSNP
rs1014287376 1808 dbSNP
rs1343751109 1810 dbSNP
rs1387827469 1820 dbSNP
rs1164633472 1834 dbSNP
rs1472955516 1838 dbSNP
rs1367620804 1839 dbSNP
rs1025666432 1840 dbSNP
rs1439452870 1848 dbSNP
rs1252485349 1852 dbSNP
rs980696139 1853 dbSNP
rs1482765922 1860 dbSNP
rs1272639075 1863 dbSNP
rs951444109 1870 dbSNP
rs761670695 1872 dbSNP
rs1032235644 1878 dbSNP
rs1357325233 1884 dbSNP
rs957866309 1886 dbSNP
rs988414763 1894 dbSNP
rs984070346 1898 dbSNP
rs1017243566 1903 dbSNP
rs963877367 1910 dbSNP
rs536597874 1915 dbSNP
rs554835999 1916 dbSNP
rs1274263496 1923 dbSNP
rs1324971218 1926 dbSNP
rs1405524264 1928 dbSNP
rs1389611687 1929 dbSNP
rs1368441915 1940 dbSNP
rs1473439346 1957 dbSNP
rs1412518636 1970 dbSNP
rs751860151 1972 dbSNP
rs1471574403 1976 dbSNP
rs573313512 1979 dbSNP
rs1231176231 1980 dbSNP
rs933769104 1987 dbSNP
rs1452352189 2002 dbSNP
rs1282041215 2004 dbSNP
rs1352951684 2006 dbSNP
rs1331659511 2018 dbSNP
rs537401954 2020 dbSNP
rs1462946300 2022 dbSNP
rs76080656 2025 dbSNP
rs1287964293 2029 dbSNP
rs1349185567 2032 dbSNP
rs1276071172 2035 dbSNP
rs1436603473 2036 dbSNP
rs1330056786 2042 dbSNP
rs1321167407 2043 dbSNP
rs944143182 2051 dbSNP
rs913580239 2053 dbSNP
rs1158150952 2055 dbSNP
rs1191009142 2062 dbSNP
rs1455539590 2066 dbSNP
rs976852268 2071 dbSNP
rs1191746570 2073 dbSNP
rs921279818 2087 dbSNP
rs1197725497 2094 dbSNP
rs577632170 2095 dbSNP
rs937585325 2102 dbSNP
rs1055926269 2103 dbSNP
rs895968258 2107 dbSNP
rs1014368269 2117 dbSNP
rs1026122319 2118 dbSNP
rs1175021224 2119 dbSNP
rs887135980 2135 dbSNP
rs755296263 2141 dbSNP
rs1343654084 2144 dbSNP
rs1272583709 2152 dbSNP
rs932632585 2160 dbSNP
rs145133723 2174 dbSNP
rs1319587934 2177 dbSNP
rs888663302 2181 dbSNP
rs1432605990 2184 dbSNP
rs1378970753 2188 dbSNP
rs940267092 2195 dbSNP
rs749967212 2197 dbSNP
rs79533239 2202 dbSNP
rs572259977 2204 dbSNP
rs1029526974 2205 dbSNP
rs1171854237 2207 dbSNP
rs542951884 2211 dbSNP
rs147577981 2214 dbSNP
rs1024697179 2218 dbSNP
rs567648960 2233 dbSNP
rs1188224237 2237 dbSNP
rs531757414 2269 dbSNP
rs755572976 2271 dbSNP
rs1323170676 2274 dbSNP
rs1350741470 2287 dbSNP
rs552096803 2292 dbSNP
rs748265762 2293 dbSNP
rs1277515647 2301 dbSNP
rs979541840 2301 dbSNP
rs1376039614 2309 dbSNP
rs1225807473 2314 dbSNP
rs765857511 2316 dbSNP
rs753478621 2318 dbSNP
rs754657945 2319 dbSNP
rs1303226579 2323 dbSNP
rs538175628 2323 dbSNP
rs1311092222 2325 dbSNP
rs375912932 2342 dbSNP
rs1357391404 2345 dbSNP
rs1311096784 2346 dbSNP
rs926287544 2349 dbSNP
rs1390911629 2361 dbSNP
rs769943168 2369 dbSNP
rs957980708 2372 dbSNP
rs1290116986 2380 dbSNP
rs778060423 2395 dbSNP
rs1416321277 2406 dbSNP
rs1453011097 2407 dbSNP
rs549870669 2409 dbSNP
rs1472727200 2411 dbSNP
rs570230524 2424 dbSNP
rs1255997726 2426 dbSNP
rs1055957185 2433 dbSNP
rs777864242 2439 dbSNP
rs988057693 2442 dbSNP
rs1021237991 2456 dbSNP
rs965214890 2467 dbSNP
rs565265100 2475 dbSNP
rs921310830 2482 dbSNP
rs1227558469 2483 dbSNP
rs1376769645 2493 dbSNP
rs950241378 2496 dbSNP
rs1047147972 2501 dbSNP
rs887158809 2503 dbSNP
rs1307502351 2511 dbSNP
rs183667011 2512 dbSNP
rs1472003360 2513 dbSNP
rs747328570 2526 dbSNP
rs1005627589 2529 dbSNP
rs1016986064 2538 dbSNP
rs1423566356 2550 dbSNP
rs899817507 2554 dbSNP
rs996795727 2558 dbSNP
rs537484308 2559 dbSNP
rs984118324 2562 dbSNP
rs1009780574 2568 dbSNP
rs1265644608 2569 dbSNP
rs1220428782 2576 dbSNP
rs1332413550 2577 dbSNP
rs547868224 2579 dbSNP
rs968239943 2589 dbSNP
rs10112 2595 dbSNP
rs1329326860 2616 dbSNP
rs1389718833 2625 dbSNP
rs774260070 2640 dbSNP
rs759222194 2657 dbSNP
rs1457645583 2658 dbSNP
rs926318785 2671 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000571846.1 | 3UTR | GAUAGUGCCAUUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000571846.1 | 3UTR | UAGUGCCAUUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000571846.1 | 3UTR | AGAUAGUGCCAUUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000571846.1 | 3UTR | UAGUGCCAUUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.534 3.6e-3 -0.663 2.1e-4 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.485 9.5e-3 -0.449 1.6e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.344 2.7e-2 0.558 4.5e-4 32 Click to see details
GSE14794 Lymphoblastoid cells -0.17 5.5e-2 -0.082 2.2e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.347 6.7e-2 0.465 1.9e-2 20 Click to see details
GSE28260 Renal cortex and medulla 0.347 1.2e-1 0.209 2.5e-1 13 Click to see details
GSE19350 CNS germ cell tumors -0.353 1.3e-1 -0.234 2.3e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.201 1.7e-1 0.207 1.6e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.096 2.3e-1 0.089 2.4e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.335 2.6e-1 -0.429 2.0e-1 6 Click to see details
GSE26953 Aortic valvular endothelial cells -0.119 2.9e-1 -0.164 2.2e-1 24 Click to see details
GSE17306 Multiple myeloma -0.049 3.7e-1 0.042 3.9e-1 49 Click to see details
GSE38226 Liver fibrosis 0.064 3.9e-1 0.273 1.2e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.051 4.0e-1 0.246 1.2e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.027 4.6e-1 -0.106 3.5e-1 16 Click to see details
GSE21849 B cell lymphoma 0.002 5.0e-1 0.078 3.4e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.642 0.04 -0.524 0.09 8 Click to see details
STAD -0.625 0.05 -0.595 0.06 8 Click to see details
ESCA -0.683 0.1 -0.500 0.2 5 Click to see details
LIHC -0.142 0.17 -0.108 0.23 49 Click to see details
KIRC -0.182 0.17 -0.137 0.24 29 Click to see details
HNSC -0.721 0.24 -0.500 0.33 3 Click to see details
CHOL 0.235 0.27 0.300 0.22 9 Click to see details
THCA 0.154 0.4 -0.300 0.31 5 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
KIRP 0.043 0.46 0.133 0.37 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*