miRTarBase - #MIRT630155 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZBTB8A   
Synonyms BOZF1, ZBTB8, ZNF916A
Description zinc finger and BTB domain containing 8A
Transcript NM_001040441   
Putative miRNA Targets on ZBTB8A
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
             ||||||||   :|||||| 
Target 5' atcACACCATT---GCACTCCa 3'
1007 - 1025 152.00 -22.40
             :|:|||||   :|||||| 
Target 5' gttGCGCCATT---GCACTCCa 3'
1861 - 1879 144.00 -21.40
             :||||| |   :|||||| 
Target 5' atcGCACCACT---GCACTCCa 3'
4683 - 4701 140.00 -17.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN1103094 7 COSMIC
COSN31548376 64 COSMIC
COSN1103096 80 COSMIC
COSN19735344 94 COSMIC
COSN30543913 152 COSMIC
COSN26586068 187 COSMIC
COSN32057543 280 COSMIC
COSN27215314 649 COSMIC
COSN15732823 746 COSMIC
COSN21519508 816 COSMIC
COSN31960212 1005 COSMIC
COSN25251770 1064 COSMIC
COSN25254922 1066 COSMIC
COSN20094646 1930 COSMIC
COSN8457090 2417 COSMIC
COSN29976934 2624 COSMIC
COSN26657715 3023 COSMIC
COSN31576217 3134 COSMIC
COSN30540893 3221 COSMIC
COSN31516874 3348 COSMIC
COSN28757919 3391 COSMIC
COSN6033982 3395 COSMIC
COSN24786642 3590 COSMIC
COSN4902186 4004 COSMIC
COSN6033983 4219 COSMIC
COSN23419388 4288 COSMIC
COSN31960213 4600 COSMIC
COSN16948150 4657 COSMIC
COSN1443495 5331 COSMIC
COSN1443497 5443 COSMIC
COSN8457091 5475 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772798386 2 dbSNP
rs1311548192 5 dbSNP
rs1351111709 14 dbSNP
rs762488175 17 dbSNP
rs189151485 20 dbSNP
rs1269202672 22 dbSNP
rs755630083 25 dbSNP
rs572069010 26 dbSNP
rs751344865 27 dbSNP
rs371036633 28 dbSNP
rs1252701260 43 dbSNP
rs767308338 45 dbSNP
rs1180378211 51 dbSNP
rs752594891 53 dbSNP
rs1201224203 55 dbSNP
rs1281039881 56 dbSNP
rs1460253171 62 dbSNP
rs777194608 64 dbSNP
rs1430454192 66 dbSNP
rs138403158 70 dbSNP
rs948180540 73 dbSNP
rs979394729 75 dbSNP
rs925253368 76 dbSNP
rs1191695511 88 dbSNP
rs770631648 100 dbSNP
rs1181991103 101 dbSNP
rs1383139389 115 dbSNP
rs778410034 120 dbSNP
rs990465070 124 dbSNP
rs560785039 133 dbSNP
rs1052758529 151 dbSNP
rs1371980193 152 dbSNP
rs967796867 160 dbSNP
rs1316967817 162 dbSNP
rs746287387 165 dbSNP
rs377634378 168 dbSNP
rs531383570 173 dbSNP
rs891057889 186 dbSNP
rs1436758599 187 dbSNP
rs182402666 192 dbSNP
rs776089355 197 dbSNP
rs1382496697 201 dbSNP
rs761206915 211 dbSNP
rs956567369 219 dbSNP
rs986636745 231 dbSNP
rs1039580927 241 dbSNP
rs1268783883 243 dbSNP
rs187008509 244 dbSNP
rs1331381296 245 dbSNP
rs942626115 247 dbSNP
rs1441604789 248 dbSNP
rs532392103 248 dbSNP
rs921951336 264 dbSNP
rs930716706 270 dbSNP
rs2294815 280 dbSNP
rs1390601487 285 dbSNP
rs376036133 286 dbSNP
rs1158356272 295 dbSNP
rs1412052272 296 dbSNP
rs886607190 297 dbSNP
rs1458423598 304 dbSNP
rs34729090 326 dbSNP
rs1026741017 327 dbSNP
rs554597787 338 dbSNP
rs1357328448 342 dbSNP
rs1380405712 343 dbSNP
rs28361946 347 dbSNP
rs1396273251 361 dbSNP
rs1336514292 365 dbSNP
rs1334360068 371 dbSNP
rs1225583365 372 dbSNP
rs1003897670 376 dbSNP
rs896704779 385 dbSNP
rs1012929627 386 dbSNP
rs1262614433 387 dbSNP
rs534195976 392 dbSNP
rs1325896105 396 dbSNP
rs554358275 398 dbSNP
rs1435925072 404 dbSNP
rs1285412274 405 dbSNP
rs1321595996 430 dbSNP
rs992735186 432 dbSNP
rs190696413 439 dbSNP
rs969536697 445 dbSNP
rs765595354 447 dbSNP
rs979447064 450 dbSNP
rs925389128 452 dbSNP
rs1376608961 467 dbSNP
rs935300294 470 dbSNP
rs1466570697 475 dbSNP
rs1203869391 476 dbSNP
rs181512355 479 dbSNP
rs1309142725 482 dbSNP
rs1352815698 489 dbSNP
rs1403671199 492 dbSNP
rs1451663402 496 dbSNP
rs1200303480 497 dbSNP
rs988187055 498 dbSNP
rs371851960 509 dbSNP
rs1337169134 527 dbSNP
rs1204239812 529 dbSNP
rs1275122220 538 dbSNP
rs559155890 544 dbSNP
rs577615487 545 dbSNP
rs1433332099 546 dbSNP
rs1039548650 548 dbSNP
rs956453404 552 dbSNP
rs1451405588 553 dbSNP
rs1157922976 556 dbSNP
rs1169577049 568 dbSNP
rs1372801015 569 dbSNP
rs1423225452 570 dbSNP
rs704885 572 dbSNP
rs1391542812 576 dbSNP
rs1388638265 577 dbSNP
rs1388457961 581 dbSNP
rs931134140 597 dbSNP
rs1240098547 601 dbSNP
rs1048146152 603 dbSNP
rs886893022 606 dbSNP
rs1243673686 616 dbSNP
rs963975900 626 dbSNP
rs1488506964 630 dbSNP
rs1211053517 631 dbSNP
rs1392398866 635 dbSNP
rs1473385270 635 dbSNP
rs200940947 635 dbSNP
rs369401249 635 dbSNP
rs1443244075 636 dbSNP
rs1164654856 641 dbSNP
rs1369598728 645 dbSNP
rs1343750471 650 dbSNP
rs1004269470 656 dbSNP
rs921947712 678 dbSNP
rs930684115 693 dbSNP
rs1322876665 702 dbSNP
rs1049052707 720 dbSNP
rs1450241254 723 dbSNP
rs1056840174 737 dbSNP
rs545963459 738 dbSNP
rs553506412 748 dbSNP
rs1056610264 755 dbSNP
rs1258372348 757 dbSNP
rs896667943 772 dbSNP
rs1023845317 783 dbSNP
rs1249553714 784 dbSNP
rs1237413432 790 dbSNP
rs1012485228 792 dbSNP
rs756657445 792 dbSNP
rs1181590729 795 dbSNP
rs969505422 798 dbSNP
rs1426009367 809 dbSNP
rs759395403 815 dbSNP
rs1411316334 820 dbSNP
rs1457870992 821 dbSNP
rs571994937 823 dbSNP
rs1032375375 824 dbSNP
rs1447609437 829 dbSNP
rs767154814 832 dbSNP
rs186033017 833 dbSNP
rs1397699380 840 dbSNP
rs1253608563 843 dbSNP
rs912596855 848 dbSNP
rs965764973 850 dbSNP
rs1000501148 852 dbSNP
rs1180749132 856 dbSNP
rs975286063 858 dbSNP
rs143896510 866 dbSNP
rs562688164 872 dbSNP
rs1048283366 874 dbSNP
rs908289049 879 dbSNP
rs1175987291 880 dbSNP
rs956421112 882 dbSNP
rs1424171537 883 dbSNP
rs939821568 884 dbSNP
rs147251895 885 dbSNP
rs1184382438 895 dbSNP
rs1427290782 899 dbSNP
rs1019431192 902 dbSNP
rs1242200837 902 dbSNP
rs1467426431 903 dbSNP
rs895444271 904 dbSNP
rs1442228852 906 dbSNP
rs1369823402 909 dbSNP
rs1410390599 912 dbSNP
rs1012555321 913 dbSNP
rs1045261419 917 dbSNP
rs964256225 919 dbSNP
rs190408492 920 dbSNP
rs905481132 924 dbSNP
rs763398386 925 dbSNP
rs1306686504 933 dbSNP
rs1032549616 934 dbSNP
rs1274406064 936 dbSNP
rs1266847314 941 dbSNP
rs1341464779 941 dbSNP
rs564688670 948 dbSNP
rs1313604687 949 dbSNP
rs1427589224 954 dbSNP
rs1426987714 956 dbSNP
rs532324761 965 dbSNP
rs975354089 966 dbSNP
rs1369724815 968 dbSNP
rs182673262 970 dbSNP
rs559521683 971 dbSNP
rs965381512 975 dbSNP
rs1293624484 978 dbSNP
rs984726869 979 dbSNP
rs975442893 980 dbSNP
rs1479413985 987 dbSNP
rs1297246216 991 dbSNP
rs921165839 995 dbSNP
rs907898486 997 dbSNP
rs1288394077 999 dbSNP
rs187883667 1004 dbSNP
rs992678986 1005 dbSNP
rs1248562793 1010 dbSNP
rs1384596824 1012 dbSNP
rs1484977929 1013 dbSNP
rs764453693 1014 dbSNP
rs908337949 1015 dbSNP
rs1389309478 1016 dbSNP
rs1449924960 1042 dbSNP
rs1169230204 1043 dbSNP
rs1356386619 1044 dbSNP
rs190629428 1051 dbSNP
rs745464130 1052 dbSNP
rs1432427205 1056 dbSNP
rs904078960 1056 dbSNP
rs570174170 1061 dbSNP
rs936925557 1063 dbSNP
rs1052082688 1066 dbSNP
rs1282815889 1069 dbSNP
rs530981123 1071 dbSNP
rs1313535014 1074 dbSNP
rs1356217516 1085 dbSNP
rs1229398398 1087 dbSNP
rs892166193 1090 dbSNP
rs1382609404 1091 dbSNP
rs1208344700 1095 dbSNP
rs1229791111 1096 dbSNP
rs1465166484 1099 dbSNP
rs1195009094 1103 dbSNP
rs916998694 1106 dbSNP
rs948377211 1112 dbSNP
rs114525653 1113 dbSNP
rs1182430529 1114 dbSNP
rs1415325283 1119 dbSNP
rs546700061 1122 dbSNP
rs1455225064 1138 dbSNP
rs1157925635 1144 dbSNP
rs1388853202 1162 dbSNP
rs1458519792 1162 dbSNP
rs1332533663 1165 dbSNP
rs1340263150 1166 dbSNP
rs140745159 1169 dbSNP
rs1286537892 1171 dbSNP
rs747364043 1174 dbSNP
rs1348678775 1178 dbSNP
rs936957382 1183 dbSNP
rs1054452007 1184 dbSNP
rs1331402118 1209 dbSNP
rs1198957684 1211 dbSNP
rs1276223159 1212 dbSNP
rs1256296552 1215 dbSNP
rs1441697285 1216 dbSNP
rs1188128419 1218 dbSNP
rs1259588460 1229 dbSNP
rs576118733 1233 dbSNP
rs1201478300 1237 dbSNP
rs982685341 1242 dbSNP
rs1465261512 1246 dbSNP
rs1188229916 1252 dbSNP
rs553611006 1261 dbSNP
rs1170507718 1271 dbSNP
rs777244788 1272 dbSNP
rs748267714 1273 dbSNP
rs1378482044 1287 dbSNP
rs1471084006 1290 dbSNP
rs1336698283 1291 dbSNP
rs769710652 1293 dbSNP
rs996849754 1299 dbSNP
rs1288999903 1301 dbSNP
rs1028363937 1302 dbSNP
rs1231327108 1308 dbSNP
rs142266461 1310 dbSNP
rs1344000247 1317 dbSNP
rs983999814 1321 dbSNP
rs75096968 1324 dbSNP
rs1405845501 1326 dbSNP
rs925466331 1327 dbSNP
rs370372332 1328 dbSNP
rs1052723337 1330 dbSNP
rs778713298 1333 dbSNP
rs1439116573 1342 dbSNP
rs773494912 1367 dbSNP
rs1359254839 1370 dbSNP
rs1381222124 1380 dbSNP
rs536232655 1381 dbSNP
rs993099451 1390 dbSNP
rs1429655854 1406 dbSNP
rs1309235828 1408 dbSNP
rs1372450785 1409 dbSNP
rs763014158 1419 dbSNP
rs1380924965 1426 dbSNP
rs1331858519 1439 dbSNP
rs1235703832 1441 dbSNP
rs943662718 1449 dbSNP
rs948510473 1451 dbSNP
rs1040722501 1454 dbSNP
rs979729918 1455 dbSNP
rs771059228 1462 dbSNP
rs1275316849 1463 dbSNP
rs184118680 1466 dbSNP
rs935670411 1467 dbSNP
rs1266095925 1471 dbSNP
rs1484925928 1474 dbSNP
rs12567940 1483 dbSNP
rs892720824 1493 dbSNP
rs1246567631 1494 dbSNP
rs150916415 1495 dbSNP
rs1481517432 1499 dbSNP
rs1004076287 1506 dbSNP
rs1041650690 1516 dbSNP
rs1162667590 1523 dbSNP
rs901251642 1530 dbSNP
rs959994086 1537 dbSNP
rs775326376 1550 dbSNP
rs996901714 1556 dbSNP
rs558344780 1569 dbSNP
rs1298095359 1572 dbSNP
rs1309147594 1576 dbSNP
rs767695191 1587 dbSNP
rs368489337 1596 dbSNP
rs1467311018 1598 dbSNP
rs1356515436 1602 dbSNP
rs1215140975 1603 dbSNP
rs1161902963 1610 dbSNP
rs760445180 1620 dbSNP
rs188675615 1624 dbSNP
rs925435379 1625 dbSNP
rs35290235 1628 dbSNP
rs35613286 1628 dbSNP
rs1430648491 1630 dbSNP
rs1005979683 1640 dbSNP
rs1264302360 1649 dbSNP
rs753737548 1650 dbSNP
rs1346874097 1654 dbSNP
rs1187533439 1657 dbSNP
rs961614574 1666 dbSNP
rs988310426 1666 dbSNP
rs914121809 1668 dbSNP
rs1157194024 1670 dbSNP
rs1457998779 1673 dbSNP
rs1282286002 1676 dbSNP
rs1363879131 1683 dbSNP
rs1014086431 1684 dbSNP
rs1311970423 1693 dbSNP
rs530025403 1694 dbSNP
rs1234534739 1695 dbSNP
rs1265728386 1696 dbSNP
rs969871355 1700 dbSNP
rs1208979459 1710 dbSNP
rs1262851099 1714 dbSNP
rs540993313 1718 dbSNP
rs979780772 1721 dbSNP
rs1482519829 1725 dbSNP
rs1200356412 1727 dbSNP
rs1281897636 1732 dbSNP
rs1476488044 1735 dbSNP
rs1180059985 1738 dbSNP
rs139407329 1739 dbSNP
rs957004779 1742 dbSNP
rs1473010630 1745 dbSNP
rs1161635339 1748 dbSNP
rs988909408 1749 dbSNP
rs1464397533 1753 dbSNP
rs1302069235 1755 dbSNP
rs374191233 1764 dbSNP
rs1292524725 1765 dbSNP
rs945656194 1766 dbSNP
rs1285843754 1767 dbSNP
rs1223988724 1770 dbSNP
rs932377459 1770 dbSNP
rs1041309829 1771 dbSNP
rs1310786652 1773 dbSNP
rs1232931606 1776 dbSNP
rs1470644975 1779 dbSNP
rs1486903898 1789 dbSNP
rs1048164804 1790 dbSNP
rs1483444276 1795 dbSNP
rs922728817 1796 dbSNP
rs1179143755 1799 dbSNP
rs932825141 1800 dbSNP
rs1432850499 1803 dbSNP
rs1049813487 1805 dbSNP
rs1395471269 1812 dbSNP
rs1436489394 1814 dbSNP
rs1306177848 1816 dbSNP
rs888560476 1821 dbSNP
rs1442366620 1824 dbSNP
rs1400587503 1835 dbSNP
rs1164831271 1837 dbSNP
rs1005534142 1838 dbSNP
rs1003969889 1839 dbSNP
rs369799494 1842 dbSNP
rs1366859903 1846 dbSNP
rs766641296 1851 dbSNP
rs1302132911 1859 dbSNP
rs1354694659 1866 dbSNP
rs867857428 1867 dbSNP
rs1206664364 1870 dbSNP
rs897062252 1875 dbSNP
rs1245058050 1881 dbSNP
rs1014553817 1883 dbSNP
rs79398913 1888 dbSNP
rs1166618112 1893 dbSNP
rs1372368819 1897 dbSNP
rs371778670 1898 dbSNP
rs895701196 1898 dbSNP
rs1317159767 1905 dbSNP
rs367858630 1906 dbSNP
rs1433282975 1909 dbSNP
rs1214520583 1910 dbSNP
rs1275337063 1910 dbSNP
rs1321267275 1910 dbSNP
rs1331081152 1910 dbSNP
rs1363186222 1910 dbSNP
rs1220280187 1913 dbSNP
rs563647531 1915 dbSNP
rs1001334004 1917 dbSNP
rs1247190498 1917 dbSNP
rs1475669315 1922 dbSNP
rs1025383883 1923 dbSNP
rs1032708164 1924 dbSNP
rs1231511672 1925 dbSNP
rs531044218 1926 dbSNP
rs988489729 1927 dbSNP
rs1184746675 1928 dbSNP
rs1346219580 1929 dbSNP
rs1433499366 1929 dbSNP
rs1282985379 1930 dbSNP
rs1295235495 1930 dbSNP
rs1327261471 1930 dbSNP
rs1378503483 1930 dbSNP
rs1002288015 1931 dbSNP
rs912856953 1931 dbSNP
rs1447437800 1934 dbSNP
rs1217829525 1936 dbSNP
rs1235613223 1937 dbSNP
rs1474855902 1941 dbSNP
rs1187963551 1942 dbSNP
rs1032389034 1943 dbSNP
rs958116423 1953 dbSNP
rs1386091174 1955 dbSNP
rs1402858037 1956 dbSNP
rs965744865 1960 dbSNP
rs1332636681 1962 dbSNP
rs867067540 1964 dbSNP
rs988278330 1965 dbSNP
rs1415944214 1967 dbSNP
rs1314766983 1980 dbSNP
rs1348774995 1985 dbSNP
rs914091740 1988 dbSNP
rs1162300142 1989 dbSNP
rs976979656 1990 dbSNP
rs922863287 1994 dbSNP
rs77491194 1996 dbSNP
rs1280403911 2005 dbSNP
rs570986787 2006 dbSNP
rs1049946294 2009 dbSNP
rs1225215923 2012 dbSNP
rs977058800 2021 dbSNP
rs920918744 2022 dbSNP
rs1453181791 2027 dbSNP
rs1211579982 2029 dbSNP
rs909965431 2030 dbSNP
rs941476945 2031 dbSNP
rs1037126520 2053 dbSNP
rs1338476865 2058 dbSNP
rs1258999255 2065 dbSNP
rs1481809668 2069 dbSNP
rs897108234 2072 dbSNP
rs1014273423 2077 dbSNP
rs1363969588 2081 dbSNP
rs1470977289 2097 dbSNP
rs1171143163 2110 dbSNP
rs72709927 2114 dbSNP
rs1245191195 2118 dbSNP
rs905813773 2119 dbSNP
rs1435857682 2123 dbSNP
rs909609306 2124 dbSNP
rs577338326 2133 dbSNP
rs1176118739 2138 dbSNP
rs1409227763 2140 dbSNP
rs939794479 2140 dbSNP
rs1329633008 2144 dbSNP
rs1001302897 2148 dbSNP
rs1346935491 2149 dbSNP
rs557251217 2149 dbSNP
rs895679762 2149 dbSNP
rs892980756 2151 dbSNP
rs1010363685 2155 dbSNP
rs1020052321 2156 dbSNP
rs1204643309 2159 dbSNP
rs966071023 2161 dbSNP
rs905778758 2163 dbSNP
rs1033553762 2164 dbSNP
rs975776227 2168 dbSNP
rs1032356001 2171 dbSNP
rs1460337408 2172 dbSNP
rs1029901432 2174 dbSNP
rs893872344 2183 dbSNP
rs1009677648 2184 dbSNP
rs1252725189 2185 dbSNP
rs954317306 2187 dbSNP
rs985619090 2192 dbSNP
rs192398069 2197 dbSNP
rs576520393 2199 dbSNP
rs1176059098 2202 dbSNP
rs568742563 2206 dbSNP
rs1476130050 2209 dbSNP
rs1021525447 2211 dbSNP
rs1168522173 2215 dbSNP
rs184447366 2219 dbSNP
rs941539097 2221 dbSNP
rs973203219 2224 dbSNP
rs1323221009 2225 dbSNP
rs150035899 2226 dbSNP
rs1441289371 2228 dbSNP
rs1470002983 2230 dbSNP
rs146594389 2232 dbSNP
rs1251359354 2233 dbSNP
rs954309518 2233 dbSNP
rs983730408 2237 dbSNP
rs1207691334 2242 dbSNP
rs909578364 2254 dbSNP
rs1045731054 2257 dbSNP
rs939763233 2258 dbSNP
rs1246601923 2262 dbSNP
rs1428422462 2265 dbSNP
rs905782498 2267 dbSNP
rs1374863006 2268 dbSNP
rs1268505615 2270 dbSNP
rs536784256 2271 dbSNP
rs1317452271 2272 dbSNP
rs1164320496 2273 dbSNP
rs1395409523 2278 dbSNP
rs937227355 2279 dbSNP
rs1054304984 2280 dbSNP
rs892938298 2283 dbSNP
rs1381545660 2285 dbSNP
rs1321912430 2291 dbSNP
rs1203552583 2295 dbSNP
rs1263121828 2300 dbSNP
rs1010085253 2306 dbSNP
rs755353349 2309 dbSNP
rs1449249956 2316 dbSNP
rs558207572 2317 dbSNP
rs1215233987 2322 dbSNP
rs1241053831 2323 dbSNP
rs577010093 2334 dbSNP
rs1480532341 2335 dbSNP
rs1485785231 2337 dbSNP
rs1206228335 2340 dbSNP
rs1178205886 2347 dbSNP
rs187325640 2355 dbSNP
rs1187260220 2357 dbSNP
rs1044630048 2365 dbSNP
rs1476296032 2368 dbSNP
rs1157265025 2369 dbSNP
rs1469209704 2375 dbSNP
rs1289240941 2376 dbSNP
rs140295961 2376 dbSNP
rs574698558 2380 dbSNP
rs542111866 2381 dbSNP
rs563708920 2382 dbSNP
rs1053768926 2383 dbSNP
rs1234746054 2383 dbSNP
rs775798909 2384 dbSNP
rs985669886 2384 dbSNP
rs575689880 2385 dbSNP
rs1482534540 2388 dbSNP
rs1398885518 2391 dbSNP
rs1210856661 2393 dbSNP
rs1258275063 2394 dbSNP
rs1486731810 2396 dbSNP
rs1180267894 2398 dbSNP
rs191864224 2402 dbSNP
rs1419896377 2403 dbSNP
rs1021076224 2411 dbSNP
rs972953691 2412 dbSNP
rs1339963970 2413 dbSNP
rs773228264 2417 dbSNP
rs918645709 2422 dbSNP
rs1416030210 2423 dbSNP
rs998328727 2424 dbSNP
rs564597442 2425 dbSNP
rs1391635698 2428 dbSNP
rs954278724 2429 dbSNP
rs749377424 2432 dbSNP
rs950173830 2457 dbSNP
rs1281736093 2462 dbSNP
rs1344017411 2468 dbSNP
rs528533988 2472 dbSNP
rs1179215094 2478 dbSNP
rs771112123 2478 dbSNP
rs1252404454 2479 dbSNP
rs1452408472 2489 dbSNP
rs184556108 2492 dbSNP
rs144026634 2497 dbSNP
rs961068609 2505 dbSNP
rs1282915459 2512 dbSNP
rs1167642893 2514 dbSNP
rs529556804 2516 dbSNP
rs1054753059 2521 dbSNP
rs1299593610 2528 dbSNP
rs1369216577 2540 dbSNP
rs774527067 2541 dbSNP
rs1440550250 2550 dbSNP
rs1304627028 2553 dbSNP
rs1373773897 2556 dbSNP
rs533764613 2561 dbSNP
rs1272342538 2568 dbSNP
rs949852193 2571 dbSNP
rs1206878225 2576 dbSNP
rs796078845 2588 dbSNP
rs901582728 2590 dbSNP
rs997232843 2599 dbSNP
rs1253418986 2601 dbSNP
rs935889887 2605 dbSNP
rs760496551 2608 dbSNP
rs1054405695 2614 dbSNP
rs1365354124 2624 dbSNP
rs1050175169 2632 dbSNP
rs763829818 2641 dbSNP
rs893807004 2642 dbSNP
rs1005903191 2646 dbSNP
rs1017590288 2648 dbSNP
rs1042789173 2663 dbSNP
rs573532770 2667 dbSNP
rs1359943910 2668 dbSNP
rs1397199134 2675 dbSNP
rs550845415 2681 dbSNP
rs569338027 2682 dbSNP
rs1049911754 2689 dbSNP
rs1363287657 2694 dbSNP
rs61740954 2701 dbSNP
rs536646591 2709 dbSNP
rs112444464 2719 dbSNP
rs889988882 2723 dbSNP
rs1334380040 2732 dbSNP
rs422215 2735 dbSNP
rs1273546629 2736 dbSNP
rs1308101945 2740 dbSNP
rs570531359 2743 dbSNP
rs981470501 2744 dbSNP
rs1017102115 2747 dbSNP
rs1486154919 2758 dbSNP
rs534392971 2772 dbSNP
rs553149391 2773 dbSNP
rs961615032 2774 dbSNP
rs913675613 2775 dbSNP
rs993821292 2776 dbSNP
rs562395293 2781 dbSNP
rs990190696 2782 dbSNP
rs914472531 2789 dbSNP
rs1318081465 2790 dbSNP
rs946019647 2791 dbSNP
rs1433528805 2793 dbSNP
rs1311123226 2794 dbSNP
rs1042033107 2802 dbSNP
rs577460270 2803 dbSNP
rs933159172 2804 dbSNP
rs1050142220 2805 dbSNP
rs966407370 2806 dbSNP
rs1348823243 2811 dbSNP
rs1221787019 2812 dbSNP
rs765216576 2814 dbSNP
rs749949258 2815 dbSNP
rs1037409663 2831 dbSNP
rs898733587 2832 dbSNP
rs1218760274 2834 dbSNP
rs1252378717 2837 dbSNP
rs1417123008 2839 dbSNP
rs1254775785 2841 dbSNP
rs1238780778 2844 dbSNP
rs1485093208 2844 dbSNP
rs539685355 2844 dbSNP
rs994393109 2850 dbSNP
rs1158303820 2851 dbSNP
rs1409238928 2855 dbSNP
rs1402919077 2866 dbSNP
rs1026336383 2875 dbSNP
rs1172390840 2877 dbSNP
rs989983576 2878 dbSNP
rs1415412744 2882 dbSNP
rs535779663 2884 dbSNP
rs551349818 2886 dbSNP
rs1180993763 2891 dbSNP
rs1278709922 2891 dbSNP
rs757892302 2892 dbSNP
rs1385848461 2893 dbSNP
rs1278030871 2895 dbSNP
rs1347070740 2901 dbSNP
rs1003026785 2904 dbSNP
rs1034379729 2909 dbSNP
rs556297710 2912 dbSNP
rs372981219 2914 dbSNP
rs1441992463 2915 dbSNP
rs1457575213 2919 dbSNP
rs1299004857 2931 dbSNP
rs990549752 2938 dbSNP
rs914545485 2940 dbSNP
rs575752272 2946 dbSNP
rs1409608026 2949 dbSNP
rs1331113307 2953 dbSNP
rs546231293 2956 dbSNP
rs751207391 2957 dbSNP
rs1448639688 2962 dbSNP
rs1301022179 2964 dbSNP
rs1370097841 2967 dbSNP
rs1234993052 2972 dbSNP
rs146446742 2974 dbSNP
rs112722111 2976 dbSNP
rs1050272616 2989 dbSNP
rs781631931 2990 dbSNP
rs1273199582 2997 dbSNP
rs910300158 2998 dbSNP
rs1252769689 3001 dbSNP
rs1479527565 3002 dbSNP
rs1455065874 3004 dbSNP
rs941822564 3005 dbSNP
rs189489283 3006 dbSNP
rs1038516218 3008 dbSNP
rs1402681993 3012 dbSNP
rs897380460 3014 dbSNP
rs1393511601 3027 dbSNP
rs562339915 3027 dbSNP
rs897467276 3029 dbSNP
rs544799825 3030 dbSNP
rs1462559423 3031 dbSNP
rs1325508508 3039 dbSNP
rs1324630124 3043 dbSNP
rs756633860 3044 dbSNP
rs928979803 3046 dbSNP
rs180735830 3058 dbSNP
rs1319494279 3059 dbSNP
rs1231124649 3063 dbSNP
rs907489235 3076 dbSNP
rs1254138048 3080 dbSNP
rs1423390588 3081 dbSNP
rs1469238398 3082 dbSNP
rs1212021843 3091 dbSNP
rs1171384559 3096 dbSNP
rs1001286823 3097 dbSNP
rs1374946372 3098 dbSNP
rs376163459 3105 dbSNP
rs138241673 3114 dbSNP
rs1034058485 3116 dbSNP
rs1460661727 3117 dbSNP
rs185772685 3117 dbSNP
rs562833086 3118 dbSNP
rs1193931470 3130 dbSNP
rs1425933357 3134 dbSNP
rs1474332316 3148 dbSNP
rs1170359758 3169 dbSNP
rs957115546 3172 dbSNP
rs1407322961 3178 dbSNP
rs1455027827 3191 dbSNP
rs1335367152 3200 dbSNP
rs1002994413 3204 dbSNP
rs189601386 3207 dbSNP
rs1034515497 3220 dbSNP
rs913095018 3237 dbSNP
rs1382642845 3239 dbSNP
rs143022082 3251 dbSNP
rs1298246882 3253 dbSNP
rs564642716 3254 dbSNP
rs1305361453 3260 dbSNP
rs1217662289 3267 dbSNP
rs1263504659 3268 dbSNP
rs922627685 3275 dbSNP
rs79035688 3291 dbSNP
rs967376216 3292 dbSNP
rs749369848 3295 dbSNP
rs977853628 3297 dbSNP
rs1206282542 3300 dbSNP
rs572384091 3311 dbSNP
rs1030233087 3315 dbSNP
rs1265424243 3331 dbSNP
rs1484765992 3337 dbSNP
rs1187325430 3338 dbSNP
rs1255403571 3349 dbSNP
rs1258406769 3365 dbSNP
rs541394709 3366 dbSNP
rs941469185 3371 dbSNP
rs1166588776 3385 dbSNP
rs1361894389 3391 dbSNP
rs954647672 3410 dbSNP
rs1038483245 3416 dbSNP
rs897343492 3417 dbSNP
rs1362395104 3425 dbSNP
rs1432255139 3438 dbSNP
rs1311783822 3442 dbSNP
rs1263979942 3447 dbSNP
rs1379387136 3456 dbSNP
rs1397467871 3461 dbSNP
rs1305269694 3466 dbSNP
rs1335612422 3480 dbSNP
rs1240373855 3485 dbSNP
rs985952878 3493 dbSNP
rs1346346924 3496 dbSNP
rs181900806 3501 dbSNP
rs910351182 3510 dbSNP
rs560238145 3511 dbSNP
rs1046441872 3512 dbSNP
rs907452061 3515 dbSNP
rs973149966 3522 dbSNP
rs1248141608 3533 dbSNP
rs546356799 3536 dbSNP
rs1382056691 3541 dbSNP
rs892866883 3541 dbSNP
rs1432813763 3545 dbSNP
rs1011361415 3547 dbSNP
rs1020123692 3549 dbSNP
rs967658067 3552 dbSNP
rs1471198594 3557 dbSNP
rs779132057 3570 dbSNP
rs1447892872 3574 dbSNP
rs975945726 3584 dbSNP
rs1311956313 3591 dbSNP
rs746033778 3592 dbSNP
rs1234264389 3605 dbSNP
rs1302027144 3607 dbSNP
rs1314084008 3608 dbSNP
rs1202675201 3623 dbSNP
rs1250907351 3624 dbSNP
rs1481102034 3633 dbSNP
rs1174885227 3634 dbSNP
rs1030629413 3639 dbSNP
rs907457975 3643 dbSNP
rs1452467364 3644 dbSNP
rs202112517 3645 dbSNP
rs566393104 3645 dbSNP
rs953335628 3645 dbSNP
rs938903436 3660 dbSNP
rs1372101970 3661 dbSNP
rs1465836618 3663 dbSNP
rs1290067353 3665 dbSNP
rs1359316635 3671 dbSNP
rs532440686 3676 dbSNP
rs941435421 3695 dbSNP
rs1294686739 3697 dbSNP
rs1370377105 3708 dbSNP
rs1283605655 3719 dbSNP
rs568310675 3725 dbSNP
rs1294976835 3728 dbSNP
rs1318847316 3745 dbSNP
rs1220740495 3749 dbSNP
rs1259747274 3755 dbSNP
rs1467016225 3770 dbSNP
rs894618582 3772 dbSNP
rs1247147333 3774 dbSNP
rs1489440521 3780 dbSNP
rs1221405340 3794 dbSNP
rs552411504 3797 dbSNP
rs1021698508 3799 dbSNP
rs1477925693 3803 dbSNP
rs903290336 3811 dbSNP
rs1416121232 3814 dbSNP
rs1461197105 3819 dbSNP
rs998851038 3823 dbSNP
rs1165970002 3827 dbSNP
rs1030368775 3828 dbSNP
rs1429306630 3838 dbSNP
rs954699666 3839 dbSNP
rs986023561 3845 dbSNP
rs1017547124 3848 dbSNP
rs1216158921 3856 dbSNP
rs562628291 3857 dbSNP
rs1481548686 3864 dbSNP
rs148273936 3871 dbSNP
rs919011315 3876 dbSNP
rs929081979 3879 dbSNP
rs1323407839 3888 dbSNP
rs1213605300 3894 dbSNP
rs981835565 3896 dbSNP
rs186279748 3905 dbSNP
rs1182785857 3919 dbSNP
rs542216120 3921 dbSNP
rs371140576 3927 dbSNP
rs1159090762 3929 dbSNP
rs1161965432 3930 dbSNP
rs1020416727 3941 dbSNP
rs76890162 3946 dbSNP
rs1055942667 3956 dbSNP
rs916178282 3957 dbSNP
rs773159350 3959 dbSNP
rs1284538586 3976 dbSNP
rs1381159778 3988 dbSNP
rs1366981542 4004 dbSNP
rs1402749265 4008 dbSNP
rs1221987348 4011 dbSNP
rs1273974784 4017 dbSNP
rs1285142248 4018 dbSNP
rs1354329636 4024 dbSNP
rs1373842820 4029 dbSNP
rs1277639606 4036 dbSNP
rs947560757 4050 dbSNP
rs1304870159 4051 dbSNP
rs1351581922 4053 dbSNP
rs548012656 4054 dbSNP
rs1178417242 4056 dbSNP
rs1381431105 4062 dbSNP
rs190460920 4068 dbSNP
rs1292594336 4069 dbSNP
rs765929134 4076 dbSNP
rs761320690 4077 dbSNP
rs1490888497 4095 dbSNP
rs1219708550 4103 dbSNP
rs1336460771 4108 dbSNP
rs1352987834 4113 dbSNP
rs373388019 4128 dbSNP
rs1018221585 4136 dbSNP
rs962722832 4142 dbSNP
rs1377527851 4145 dbSNP
rs1481203038 4153 dbSNP
rs1242283768 4155 dbSNP
rs181409569 4156 dbSNP
rs540747549 4162 dbSNP
rs1179454332 4174 dbSNP
rs1200551926 4175 dbSNP
rs998904720 4180 dbSNP
rs555574673 4184 dbSNP
rs930089241 4190 dbSNP
rs1198355614 4206 dbSNP
rs1239219845 4212 dbSNP
rs533596911 4213 dbSNP
rs981993734 4241 dbSNP
rs186224268 4243 dbSNP
rs562715155 4244 dbSNP
rs937569647 4245 dbSNP
rs1417585687 4250 dbSNP
rs1409630961 4253 dbSNP
rs533461455 4255 dbSNP
rs1051850932 4262 dbSNP
rs1056099280 4274 dbSNP
rs759325389 4282 dbSNP
rs1386578641 4285 dbSNP
rs914830603 4286 dbSNP
rs890434117 4287 dbSNP
rs767262151 4305 dbSNP
rs1448889130 4309 dbSNP
rs1323747762 4310 dbSNP
rs947001966 4312 dbSNP
rs1041397657 4314 dbSNP
rs545362701 4314 dbSNP
rs1403219906 4322 dbSNP
rs1337015228 4330 dbSNP
rs1322516783 4332 dbSNP
rs1259100386 4335 dbSNP
rs902910707 4339 dbSNP
rs1354889662 4343 dbSNP
rs1212224631 4346 dbSNP
rs997300100 4347 dbSNP
rs1052019437 4367 dbSNP
rs1444186704 4369 dbSNP
rs564138210 4370 dbSNP
rs1477616873 4379 dbSNP
rs528073093 4379 dbSNP
rs1017506392 4383 dbSNP
rs546716955 4391 dbSNP
rs1016092813 4397 dbSNP
rs867962704 4401 dbSNP
rs994672674 4404 dbSNP
rs995883749 4406 dbSNP
rs1025661623 4409 dbSNP
rs1026532579 4417 dbSNP
rs1342638787 4418 dbSNP
rs1398991067 4424 dbSNP
rs753055598 4428 dbSNP
rs981584648 4430 dbSNP
rs1319560909 4441 dbSNP
rs1231799364 4443 dbSNP
rs568174102 4454 dbSNP
rs1357641640 4455 dbSNP
rs1289506387 4460 dbSNP
rs1282231609 4461 dbSNP
rs1487970736 4468 dbSNP
rs1194488250 4469 dbSNP
rs950583632 4470 dbSNP
rs1474363995 4475 dbSNP
rs1206987493 4485 dbSNP
rs1185117826 4498 dbSNP
rs981804406 4499 dbSNP
rs1164988450 4500 dbSNP
rs927729609 4503 dbSNP
rs432974 4504 dbSNP
rs1298312422 4505 dbSNP
rs990470246 4507 dbSNP
rs550815300 4520 dbSNP
rs916161820 4521 dbSNP
rs947658860 4525 dbSNP
rs191126647 4530 dbSNP
rs539753478 4531 dbSNP
rs868816494 4539 dbSNP
rs1353665507 4546 dbSNP
rs557744163 4549 dbSNP
rs1051838097 4552 dbSNP
rs566904125 4554 dbSNP
rs1484797581 4558 dbSNP
rs1007566026 4562 dbSNP
rs12047431 4564 dbSNP
rs12047432 4566 dbSNP
rs1039479624 4569 dbSNP
rs1168220095 4578 dbSNP
rs1399338073 4584 dbSNP
rs1189363687 4588 dbSNP
rs1197138434 4592 dbSNP
rs899172815 4593 dbSNP
rs182695491 4600 dbSNP
rs1338694590 4602 dbSNP
rs947638461 4603 dbSNP
rs1041759503 4614 dbSNP
rs555301227 4616 dbSNP
rs995125088 4617 dbSNP
rs1026250184 4620 dbSNP
rs1307565485 4623 dbSNP
rs1445844260 4624 dbSNP
rs547359152 4625 dbSNP
rs1003359390 4626 dbSNP
rs1345886456 4627 dbSNP
rs1034713224 4636 dbSNP
rs959154839 4640 dbSNP
rs990489845 4647 dbSNP
rs186592029 4648 dbSNP
rs967741011 4657 dbSNP
rs979399158 4658 dbSNP
rs1382112733 4659 dbSNP
rs1430885295 4660 dbSNP
rs1174784384 4669 dbSNP
rs993451285 4670 dbSNP
rs1026051398 4672 dbSNP
rs924919156 4680 dbSNP
rs556373809 4681 dbSNP
rs578094760 4686 dbSNP
rs1242223269 4687 dbSNP
rs1366112295 4690 dbSNP
rs570817749 4693 dbSNP
rs1386239802 4695 dbSNP
rs911973710 4699 dbSNP
rs1476161222 4704 dbSNP
rs191038192 4710 dbSNP
rs1217076397 4711 dbSNP
rs1039120301 4712 dbSNP
rs1317010999 4715 dbSNP
rs1199045376 4716 dbSNP
rs146988136 4718 dbSNP
rs1470178452 4719 dbSNP
rs1178340310 4727 dbSNP
rs420993 4727 dbSNP
rs1399898259 4728 dbSNP
rs1422485597 4728 dbSNP
rs1218964587 4729 dbSNP
rs1271674557 4729 dbSNP
rs1274920340 4729 dbSNP
rs1277731796 4729 dbSNP
rs1294155476 4729 dbSNP
rs1341397051 4729 dbSNP
rs1369904388 4729 dbSNP
rs1398247570 4729 dbSNP
rs1430645743 4729 dbSNP
rs1436459265 4729 dbSNP
rs1466402450 4729 dbSNP
rs441880 4730 dbSNP
rs1413874550 4736 dbSNP
rs1333536864 4741 dbSNP
rs899139039 4742 dbSNP
rs1402044428 4747 dbSNP
rs1489140381 4749 dbSNP
rs1276610511 4751 dbSNP
rs1340279460 4754 dbSNP
rs1224443029 4757 dbSNP
rs12136921 4759 dbSNP
rs1194114454 4766 dbSNP
rs1048091984 4768 dbSNP
rs886381448 4769 dbSNP
rs1405285238 4772 dbSNP
rs1003328175 4773 dbSNP
rs1034850882 4777 dbSNP
rs914770079 4779 dbSNP
rs1200407043 4786 dbSNP
rs894987854 4787 dbSNP
rs1352129038 4792 dbSNP
rs969364818 4800 dbSNP
rs1297684305 4805 dbSNP
rs1284312087 4817 dbSNP
rs1402129044 4819 dbSNP
rs1448296770 4827 dbSNP
rs35874488 4828 dbSNP
rs778897918 4847 dbSNP
rs1022061260 4850 dbSNP
rs1313253380 4853 dbSNP
rs1261946310 4855 dbSNP
rs773373277 4858 dbSNP
rs968088221 4859 dbSNP
rs1284747998 4869 dbSNP
rs932960496 4872 dbSNP
rs1201270502 4873 dbSNP
rs1472636506 4874 dbSNP
rs987548218 4879 dbSNP
rs1477645991 4880 dbSNP
rs1159112110 4893 dbSNP
rs1385754838 4903 dbSNP
rs977810370 4905 dbSNP
rs1438440300 4906 dbSNP
rs1158096117 4914 dbSNP
rs1361330131 4916 dbSNP
rs1332373568 4920 dbSNP
rs1421742365 4920 dbSNP
rs1031927554 4926 dbSNP
rs1358803110 4935 dbSNP
rs956312316 4947 dbSNP
rs1199361179 4948 dbSNP
rs879758144 4951 dbSNP
rs1446963886 4963 dbSNP
rs1303230194 4969 dbSNP
rs539853271 4974 dbSNP
rs1421654012 4982 dbSNP
rs561642612 4984 dbSNP
rs745945242 4989 dbSNP
rs1237920367 4990 dbSNP
rs1307892672 4996 dbSNP
rs1353867854 5008 dbSNP
rs529010275 5011 dbSNP
rs1224979433 5012 dbSNP
rs943140192 5013 dbSNP
rs1360061824 5017 dbSNP
rs912026109 5019 dbSNP
rs183218462 5020 dbSNP
rs1211237706 5024 dbSNP
rs899031132 5025 dbSNP
rs1456823714 5037 dbSNP
rs943569204 5041 dbSNP
rs929212901 5055 dbSNP
rs1381493123 5056 dbSNP
rs975204952 5057 dbSNP
rs1170923452 5062 dbSNP
rs1047601701 5071 dbSNP
rs1415303351 5073 dbSNP
rs1329760062 5075 dbSNP
rs1176480228 5077 dbSNP
rs772340186 5081 dbSNP
rs146958660 5094 dbSNP
rs535638244 5104 dbSNP
rs1330522786 5105 dbSNP
rs1377596680 5111 dbSNP
rs1035714745 5112 dbSNP
rs1343815735 5122 dbSNP
rs1047762600 5123 dbSNP
rs886350452 5124 dbSNP
rs1316390605 5125 dbSNP
rs1198420016 5128 dbSNP
rs1239273216 5129 dbSNP
rs1440077270 5131 dbSNP
rs1237243257 5132 dbSNP
rs1196815168 5140 dbSNP
rs1284729908 5146 dbSNP
rs780217706 5151 dbSNP
rs1224318993 5158 dbSNP
rs569098604 5159 dbSNP
rs1421775933 5166 dbSNP
rs1463803700 5172 dbSNP
rs1450885089 5174 dbSNP
rs1400916092 5179 dbSNP
rs894956712 5185 dbSNP
rs1411631915 5191 dbSNP
rs1321010045 5192 dbSNP
rs1330064954 5192 dbSNP
rs1013036220 5195 dbSNP
rs1284737897 5204 dbSNP
rs1338001925 5207 dbSNP
rs1021796089 5209 dbSNP
rs1218347611 5214 dbSNP
rs555609344 5216 dbSNP
rs532978904 5218 dbSNP
rs551692567 5219 dbSNP
rs999592374 5223 dbSNP
rs1452192853 5225 dbSNP
rs968952394 5227 dbSNP
rs566663529 5230 dbSNP
rs955027796 5234 dbSNP
rs1031887220 5242 dbSNP
rs987699152 5243 dbSNP
rs769582882 5244 dbSNP
rs534045718 5247 dbSNP
rs1161336934 5251 dbSNP
rs1379786086 5255 dbSNP
rs1389934971 5257 dbSNP
rs965231278 5259 dbSNP
rs1304449213 5263 dbSNP
rs974960944 5272 dbSNP
rs1295578613 5273 dbSNP
rs1164899527 5286 dbSNP
rs1185187291 5286 dbSNP
rs1240973556 5286 dbSNP
rs1248889290 5286 dbSNP
rs1279226206 5286 dbSNP
rs1289026987 5286 dbSNP
rs1307162707 5286 dbSNP
rs1333979675 5286 dbSNP
rs1341562212 5286 dbSNP
rs1367775418 5286 dbSNP
rs1378016384 5286 dbSNP
rs1386689917 5286 dbSNP
rs1394609756 5286 dbSNP
rs1418701124 5286 dbSNP
rs1424682404 5286 dbSNP
rs1445212985 5286 dbSNP
rs555736414 5286 dbSNP
rs746163278 5286 dbSNP
rs1389011498 5288 dbSNP
rs1386508131 5302 dbSNP
rs1482414159 5309 dbSNP
rs201425030 5313 dbSNP
rs1379715079 5316 dbSNP
rs1445251357 5317 dbSNP
rs1307873559 5318 dbSNP
rs1359587358 5321 dbSNP
rs1246523221 5323 dbSNP
rs555356522 5326 dbSNP
rs987074406 5327 dbSNP
rs1185401710 5335 dbSNP
rs1236300856 5335 dbSNP
rs952196869 5338 dbSNP
rs140345098 5342 dbSNP
rs1365131664 5344 dbSNP
rs1239808528 5349 dbSNP
rs1172355630 5350 dbSNP
rs1407376751 5353 dbSNP
rs1454931557 5356 dbSNP
rs1456346919 5357 dbSNP
rs1376855154 5361 dbSNP
rs983507965 5367 dbSNP
rs1309310469 5380 dbSNP
rs12085991 5383 dbSNP
rs1310628615 5384 dbSNP
rs907839751 5393 dbSNP
rs939371183 5397 dbSNP
rs943109007 5407 dbSNP
rs1445377547 5408 dbSNP
rs1323917365 5423 dbSNP
rs1205333585 5424 dbSNP
rs773036288 5425 dbSNP
rs1457278471 5427 dbSNP
rs1167018264 5428 dbSNP
rs1252133589 5436 dbSNP
rs572499899 5444 dbSNP
rs916525515 5459 dbSNP
rs1366871841 5461 dbSNP
rs947879891 5471 dbSNP
rs1431083915 5473 dbSNP
rs762878123 5474 dbSNP
rs562041646 5475 dbSNP
rs537977811 5491 dbSNP
rs1400188747 5495 dbSNP
rs1052202186 5498 dbSNP
rs920343023 5507 dbSNP
rs1331343817 5509 dbSNP
rs890766918 5510 dbSNP
rs1007927339 5512 dbSNP
rs1019188432 5515 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :|:|||||   :|||||  
Target 5' guuGCGCCAUU---GCACUC-- 3'
8 - 24
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1084076
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000316459.4 | 3UTR | GGCUGAGGUUGCGCCAUUGCACUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.782 7.9e-4 0.516 3.6e-2 13 Click to see details
GSE28544 Breast cancer 0.491 7.4e-3 0.570 1.8e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.48 1.0e-2 -0.548 3.4e-3 23 Click to see details
GSE19350 CNS germ cell tumors -0.642 1.2e-2 -0.308 1.7e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.202 1.7e-1 -0.098 3.2e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.112 1.9e-1 -0.066 3.0e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.191 2.1e-1 -0.011 4.8e-1 20 Click to see details
GSE14794 Lymphoblastoid cells -0.084 2.2e-1 0.001 5.0e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.334 2.6e-1 0.486 1.6e-1 6 Click to see details
GSE32688 Pancreatic cancer -0.113 2.7e-1 -0.097 3.0e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.094 3.3e-1 -0.062 3.9e-1 24 Click to see details
GSE17306 Multiple myeloma 0.053 3.6e-1 0.031 4.2e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.051 4.0e-1 -0.046 4.1e-1 25 Click to see details
GSE21849 B cell lymphoma 0.02 4.6e-1 0.302 5.6e-2 29 Click to see details
GSE38226 Liver fibrosis -0.021 4.6e-1 0.059 4.0e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.773 0.01 -0.762 0.01 8 Click to see details
KIRC -0.383 0.02 -0.285 0.07 29 Click to see details
KIRP 0.681 0.02 0.200 0.3 9 Click to see details
ESCA -0.871 0.03 -0.900 0.02 5 Click to see details
HNSC 0.959 0.09 0.500 0.33 3 Click to see details
CHOL -0.416 0.13 -0.483 0.09 9 Click to see details
THCA -0.503 0.19 -0.500 0.2 5 Click to see details
LIHC -0.093 0.26 0.046 0.38 49 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
KICH -0.068 0.44 -0.095 0.41 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 <