miRTarBase - #MIRT630347 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NKAP   
Synonyms -
Description NFKB activating protein
Transcript NM_024528   
Expression
Putative miRNA Targets on NKAP
3'UTR of NKAP
(miRNA target sites are highlighted)
>NKAP|NM_024528|3'UTR
   1 AGATTTTCTGATTGTCCAGAAGACATTTTTAACAACAAAAAAGAAAGTCTGGGTTCCACACATACATAGAAAAAGATTAT
  81 TATGTTCTGAGAAAGCTTTACAGTGCTACTGTGCCTTCTATTTAATTCTTTCAGTCCTTCAATAAAAAGCTGCTTATTGA
 161 TATAACTTTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuguggUAACAG------UGUGAGGu 5'
                  ||||||      |||:|:: 
Target 5' attttctgATTGTCCAGAAGACATTTTt 3'
3 - 30 104.00 -7.10
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || |  ||| |:|:::||: 
Target 5' agAAAAAGATTATTATGTTCTg 3'
68 - 89 100.00 -5.20
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |: : ||| |: || ||| 
Target 5' tctATTTAATTCTTTCAGTCCt 3'
117 - 138 95.00 -5.50
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1437768778 1 dbSNP
rs766431364 13 dbSNP
rs1288636925 14 dbSNP
rs1428934806 16 dbSNP
rs761226517 19 dbSNP
rs748401586 21 dbSNP
rs1424035413 24 dbSNP
rs1384565605 28 dbSNP
rs1161543197 36 dbSNP
rs375457528 48 dbSNP
rs370881475 51 dbSNP
rs899990936 53 dbSNP
rs1298808803 61 dbSNP
rs11550889 66 dbSNP
rs1225367879 68 dbSNP
rs1299161032 75 dbSNP
rs915317995 82 dbSNP
rs1311340808 83 dbSNP
rs1456320260 106 dbSNP
rs1234787385 114 dbSNP
rs1237431222 120 dbSNP
rs1199195971 135 dbSNP
rs781434983 146 dbSNP
rs755779924 150 dbSNP
rs1275230558 159 dbSNP
rs184335321 160 dbSNP
rs1232948681 164 dbSNP
rs944237472 172 dbSNP
rs1355874110 174 dbSNP
rs1285077255 178 dbSNP
rs1454929185 194 dbSNP
rs890809676 199 dbSNP
rs754777819 205 dbSNP
rs1388771714 211 dbSNP
rs1429348816 213 dbSNP
rs1309086626 214 dbSNP
rs1448209109 215 dbSNP
rs1356328197 216 dbSNP
rs1029772242 217 dbSNP
rs191905243 225 dbSNP
rs750269965 231 dbSNP
rs964263310 244 dbSNP
rs1320989703 248 dbSNP
rs1404313534 249 dbSNP
rs766273037 252 dbSNP
rs1390984967 254 dbSNP
rs373433916 255 dbSNP
rs1213593451 263 dbSNP
rs1273298429 269 dbSNP
rs1308707280 271 dbSNP
rs1218750660 274 dbSNP
rs1165099670 282 dbSNP
rs1437516772 283 dbSNP
rs1196130999 284 dbSNP
rs1246545491 285 dbSNP
rs1379486065 287 dbSNP
rs1187278226 288 dbSNP
rs1421949072 289 dbSNP
rs967478159 291 dbSNP
rs1179120936 299 dbSNP
rs1441440673 305 dbSNP
rs1395384927 313 dbSNP
rs1275102310 314 dbSNP
rs945685829 315 dbSNP
rs887413705 317 dbSNP
rs1429807518 332 dbSNP
rs1027834044 333 dbSNP
rs1226319540 337 dbSNP
rs993216279 341 dbSNP
rs1334966625 346 dbSNP
rs897688653 348 dbSNP
rs1219462540 349 dbSNP
rs1451171169 354 dbSNP
rs1290793277 356 dbSNP
rs187327016 362 dbSNP
rs749895342 370 dbSNP
rs1243998846 371 dbSNP
rs1351912585 384 dbSNP
rs1056292673 385 dbSNP
rs939288927 396 dbSNP
rs1285783001 408 dbSNP
rs194294 409 dbSNP
rs1044954381 413 dbSNP
rs1386366673 414 dbSNP
rs1273640757 426 dbSNP
rs1435054906 438 dbSNP
rs1331183218 440 dbSNP
rs761424616 447 dbSNP
rs776402930 449 dbSNP
rs1417504614 450 dbSNP
rs1445318934 455 dbSNP
rs915217735 459 dbSNP
rs1355491506 462 dbSNP
rs1234625923 464 dbSNP
rs988660891 465 dbSNP
rs935400493 468 dbSNP
rs922814679 471 dbSNP
rs1224881274 473 dbSNP
rs1359555471 474 dbSNP
rs1158991194 477 dbSNP
rs185732574 482 dbSNP
rs1210412584 505 dbSNP
rs976882678 509 dbSNP
rs1258527217 510 dbSNP
rs1486655580 511 dbSNP
rs1422961419 516 dbSNP
rs1190567529 520 dbSNP
rs1477703565 522 dbSNP
rs1269735351 525 dbSNP
rs1411404811 525 dbSNP
rs1201800169 526 dbSNP
rs1487419190 527 dbSNP
rs1262792019 528 dbSNP
rs1217789205 529 dbSNP
rs1159118209 530 dbSNP
rs1319117903 531 dbSNP
rs1409865510 531 dbSNP
rs1277043280 533 dbSNP
rs1219189759 534 dbSNP
rs1345045102 535 dbSNP
rs1284616154 538 dbSNP
rs1397634826 539 dbSNP
rs1339437301 540 dbSNP
rs1298497049 541 dbSNP
rs1375679644 541 dbSNP
rs1432572117 543 dbSNP
rs865913654 549 dbSNP
rs964148131 550 dbSNP
rs1281828802 556 dbSNP
rs112348129 565 dbSNP
rs937231367 570 dbSNP
rs1281236832 576 dbSNP
rs1414993867 577 dbSNP
rs1431421748 578 dbSNP
rs1350310098 580 dbSNP
rs1203364773 581 dbSNP
rs984364462 582 dbSNP
rs951812732 583 dbSNP
rs1182381058 585 dbSNP
rs1027306376 587 dbSNP
rs1234566235 593 dbSNP
rs1178640254 594 dbSNP
rs1476914935 600 dbSNP
rs1445588262 608 dbSNP
rs993267326 608 dbSNP
rs1262671680 609 dbSNP
rs1395516460 616 dbSNP
rs1166369875 618 dbSNP
rs757220258 629 dbSNP
rs927092884 640 dbSNP
rs1410063027 644 dbSNP
rs1331414557 646 dbSNP
rs1329870872 653 dbSNP
rs981329323 662 dbSNP
rs971257538 668 dbSNP
rs574077004 669 dbSNP
rs1226434748 672 dbSNP
rs1487030652 673 dbSNP
rs1236104364 684 dbSNP
rs139039877 685 dbSNP
rs1197630380 689 dbSNP
rs1443464275 692 dbSNP
rs1265611208 698 dbSNP
rs1467072116 699 dbSNP
rs1193002892 702 dbSNP
rs1253360691 705 dbSNP
rs1003384637 706 dbSNP
rs1316769585 711 dbSNP
rs1278365469 712 dbSNP
rs1215997916 718 dbSNP
rs1376636747 722 dbSNP
rs1024948384 723 dbSNP
rs1302022388 734 dbSNP
rs1448535583 736 dbSNP
rs1461352291 742 dbSNP
rs764234473 743 dbSNP
rs982768575 751 dbSNP
rs1433394060 754 dbSNP
rs1045401913 755 dbSNP
rs1329242633 769 dbSNP
rs1464066826 770 dbSNP
rs1327258048 772 dbSNP
rs1423047703 773 dbSNP
rs1229960154 776 dbSNP
rs1282493772 780 dbSNP
rs1334309194 787 dbSNP
rs1212964338 790 dbSNP
rs1273760905 794 dbSNP
rs112933290 796 dbSNP
rs1430495772 812 dbSNP
rs1260849424 814 dbSNP
rs1221722190 825 dbSNP
rs1428744366 825 dbSNP
rs78563934 826 dbSNP
rs1166239212 846 dbSNP
rs752806563 849 dbSNP
rs1288638069 863 dbSNP
rs1386211903 872 dbSNP
rs1027103451 874 dbSNP
rs935454601 880 dbSNP
rs147754411 884 dbSNP
rs1041070785 885 dbSNP
rs1234009857 886 dbSNP
rs995993244 893 dbSNP
rs942892149 900 dbSNP
rs1236878736 905 dbSNP
rs1456904814 908 dbSNP
rs1259899756 913 dbSNP
rs769733532 922 dbSNP
rs1206479118 929 dbSNP
rs1255003599 930 dbSNP
rs1485022706 933 dbSNP
rs1188068256 958 dbSNP
rs984806262 959 dbSNP
rs1259071884 966 dbSNP
rs1206070968 972 dbSNP
rs1417845445 999 dbSNP
rs1159063856 1010 dbSNP
rs952973136 1012 dbSNP
rs1455693513 1017 dbSNP
rs748283055 1031 dbSNP
rs777165070 1039 dbSNP
rs1415413928 1040 dbSNP
rs1384731977 1049 dbSNP
rs945768197 1051 dbSNP
rs193230905 1056 dbSNP
rs892792425 1061 dbSNP
rs961670478 1065 dbSNP
rs1400998657 1069 dbSNP
rs1240919307 1073 dbSNP
rs755197048 1078 dbSNP
rs937054791 1079 dbSNP
rs1348343993 1092 dbSNP
rs746747922 1094 dbSNP
rs1164366750 1102 dbSNP
rs1258971992 1108 dbSNP
rs1479401766 1118 dbSNP
rs779731759 1123 dbSNP
rs1003266799 1130 dbSNP
rs766800840 1164 dbSNP
rs1421184935 1186 dbSNP
rs1387512151 1203 dbSNP
rs1023450012 1205 dbSNP
rs1394926212 1213 dbSNP
rs1011280246 1228 dbSNP
rs893718204 1235 dbSNP
rs1439598228 1246 dbSNP
rs1352785404 1252 dbSNP
rs1052272086 1253 dbSNP
rs1461571378 1254 dbSNP
rs761276595 1256 dbSNP
rs5956167 1257 dbSNP
rs200690620 1260 dbSNP
rs34295199 1260 dbSNP
rs1178428575 1266 dbSNP
rs999487188 1278 dbSNP
rs927140728 1283 dbSNP
rs187708778 1295 dbSNP
rs35544186 1311 dbSNP
rs1041121853 1317 dbSNP
rs1305218082 1318 dbSNP
rs765265629 1323 dbSNP
rs182670254 1325 dbSNP
rs191268689 1326 dbSNP
rs1361270465 1329 dbSNP
rs1048550949 1340 dbSNP
rs1252737310 1343 dbSNP
rs983766828 1344 dbSNP
rs1195687441 1353 dbSNP
rs931590789 1386 dbSNP
rs1427931670 1404 dbSNP
rs1171204354 1410 dbSNP
rs1239202387 1414 dbSNP
rs143806690 1420 dbSNP
rs1309128868 1430 dbSNP
rs1467096105 1445 dbSNP
rs1323867559 1448 dbSNP
rs972939566 1467 dbSNP
rs940355721 1468 dbSNP
rs1293121857 1470 dbSNP
rs997682884 1477 dbSNP
rs1359447270 1482 dbSNP
rs187020001 1490 dbSNP
rs7877301 1491 dbSNP
rs951453078 1492 dbSNP
rs1023924134 1494 dbSNP
rs576713181 1495 dbSNP
rs989338351 1497 dbSNP
rs1215954645 1502 dbSNP
rs1364867742 1511 dbSNP
rs1161919232 1513 dbSNP
rs1187373987 1539 dbSNP
rs190828977 1540 dbSNP
rs1474281701 1580 dbSNP
rs1162655306 1620 dbSNP
rs1266079809 1633 dbSNP
rs1461718840 1640 dbSNP
rs763416705 1651 dbSNP
rs1343284931 1654 dbSNP
rs999371214 1657 dbSNP
rs1289110074 1660 dbSNP
rs1341790656 1666 dbSNP
rs901208726 1679 dbSNP
rs1293149615 1695 dbSNP
rs1336086566 1696 dbSNP
rs1230595227 1698 dbSNP
rs186012956 1700 dbSNP
rs1316752387 1719 dbSNP
rs974197659 1726 dbSNP
rs1244091892 1728 dbSNP
rs773572282 1742 dbSNP
rs1187329489 1750 dbSNP
rs1007423284 1753 dbSNP
rs964100686 1755 dbSNP
rs1164981579 1756 dbSNP
rs889869843 1757 dbSNP
rs1399924994 1758 dbSNP
rs1159289213 1761 dbSNP
rs1362074683 1762 dbSNP
rs1412602809 1768 dbSNP
rs769375003 1774 dbSNP
rs1262352261 1775 dbSNP
rs770397379 1776 dbSNP
rs1157290821 1783 dbSNP
rs1450794444 1808 dbSNP
rs1231020804 1825 dbSNP
rs1350365971 1831 dbSNP
rs1048925003 1840 dbSNP
rs1288359324 1853 dbSNP
rs1345978675 1867 dbSNP
rs1282706821 1881 dbSNP
rs184046526 1889 dbSNP
rs194293 1892 dbSNP
rs897303572 1904 dbSNP
rs1296648360 1905 dbSNP
rs1037316787 1909 dbSNP
rs1231109069 1909 dbSNP
rs938897653 1914 dbSNP
rs1386170398 1917 dbSNP
rs1469384047 1926 dbSNP
rs927653487 1934 dbSNP
rs1177552619 1945 dbSNP
rs981793756 1995 dbSNP
rs1464963967 2003 dbSNP
rs1432442085 2011 dbSNP
rs1377597060 2019 dbSNP
rs1172685765 2022 dbSNP
rs1176511553 2024 dbSNP
rs1375473601 2035 dbSNP
rs192156553 2058 dbSNP
rs947679899 2060 dbSNP
rs780991886 2061 dbSNP
rs1327364885 2065 dbSNP
rs1018352736 2067 dbSNP
rs764552299 2077 dbSNP
rs768813695 2086 dbSNP
rs916338355 2091 dbSNP
rs989613515 2095 dbSNP
rs1008428047 2104 dbSNP
rs957911971 2105 dbSNP
rs1233779988 2108 dbSNP
rs1030777401 2110 dbSNP
rs1304484848 2118 dbSNP
rs1347130569 2119 dbSNP
rs747260158 2132 dbSNP
rs763278234 2135 dbSNP
rs756991552 2138 dbSNP
rs1199233352 2142 dbSNP
rs1239745654 2145 dbSNP
rs1010864235 2149 dbSNP
rs1263616062 2151 dbSNP
rs1192578647 2176 dbSNP
rs1395314920 2180 dbSNP
rs780360098 2182 dbSNP
rs892809000 2188 dbSNP
rs1165639884 2189 dbSNP
rs771739771 2194 dbSNP
rs1410987471 2201 dbSNP
rs1019604886 2203 dbSNP
rs1392686672 2204 dbSNP
rs1006899549 2212 dbSNP
rs1333033251 2214 dbSNP
rs1225600979 2222 dbSNP
rs745735713 2227 dbSNP
rs778714559 2228 dbSNP
rs1340205697 2231 dbSNP
rs777626008 2238 dbSNP
rs1259958003 2239 dbSNP
rs1489870095 2242 dbSNP
rs1027087139 2267 dbSNP
rs1224188997 2281 dbSNP
rs1325776289 2282 dbSNP
rs1212854990 2291 dbSNP
rs1267871790 2292 dbSNP
rs186054247 2302 dbSNP
rs1452973247 2331 dbSNP
rs995966919 2338 dbSNP
rs374774283 2348 dbSNP
rs777447340 2357 dbSNP
rs1001312886 2365 dbSNP
rs758331568 2366 dbSNP
rs1394717667 2393 dbSNP
rs1331956217 2395 dbSNP
rs938950180 2396 dbSNP
rs755788901 2402 dbSNP
rs1393377693 2405 dbSNP
rs907462480 2411 dbSNP
rs1266741997 2413 dbSNP
rs1045005974 2415 dbSNP
rs947766911 2420 dbSNP
rs180700845 2425 dbSNP
rs1327063778 2430 dbSNP
rs1401932816 2431 dbSNP
rs1397543859 2437 dbSNP
rs905646309 2444 dbSNP
rs916205710 2450 dbSNP
rs1232672850 2451 dbSNP
rs1265781269 2461 dbSNP
rs1358263896 2465 dbSNP
rs752757231 2468 dbSNP
rs1475526847 2470 dbSNP
rs188573389 2482 dbSNP
rs1260616036 2494 dbSNP
rs1185137422 2498 dbSNP
rs540154651 2501 dbSNP
rs1254861735 2506 dbSNP
rs1475147465 2510 dbSNP
rs1166169251 2512 dbSNP
rs1370510428 2514 dbSNP
rs1452128000 2516 dbSNP
rs949922532 2520 dbSNP
rs185621297 2523 dbSNP
rs1047643998 2545 dbSNP
rs1205490533 2550 dbSNP
rs977884424 2556 dbSNP
rs1311142779 2562 dbSNP
rs930522491 2564 dbSNP
rs1414068905 2570 dbSNP
rs1313375818 2571 dbSNP
rs1462669921 2590 dbSNP
rs1236629125 2600 dbSNP
rs1259985101 2602 dbSNP
rs1353964311 2610 dbSNP
rs965148364 2617 dbSNP
rs535150234 2619 dbSNP
rs1277541170 2622 dbSNP
rs1195338910 2630 dbSNP
rs1485069371 2638 dbSNP
rs1182905788 2639 dbSNP
rs1340317188 2663 dbSNP
rs1417648310 2667 dbSNP
rs919957473 2677 dbSNP
rs1381394210 2686 dbSNP
rs912483788 2687 dbSNP
rs985756028 2700 dbSNP
rs762330243 2702 dbSNP
rs531354641 2706 dbSNP
rs1008157260 2715 dbSNP
rs776648342 2717 dbSNP
rs1303299032 2718 dbSNP
rs911343108 2720 dbSNP
rs768687296 2722 dbSNP
rs1455077503 2723 dbSNP
rs1377423181 2726 dbSNP
rs1241801064 2727 dbSNP
rs986878491 2737 dbSNP
rs1398803806 2754 dbSNP
rs1027382771 2755 dbSNP
rs1257311566 2758 dbSNP
rs1327567424 2770 dbSNP
rs1410108505 2771 dbSNP
rs1398174602 2784 dbSNP
rs1239147379 2793 dbSNP
rs1441957396 2795 dbSNP
rs1191942544 2825 dbSNP
rs1020835410 2830 dbSNP
rs1161112590 2833 dbSNP
rs76809023 2854 dbSNP
rs961446465 2866 dbSNP
rs1015653379 2877 dbSNP
rs1460379703 2879 dbSNP
rs1330612952 2880 dbSNP
rs1400705102 2884 dbSNP
rs1323412729 2920 dbSNP
rs1385656573 2920 dbSNP
rs775558711 2924 dbSNP
rs1003047423 2925 dbSNP
rs1302731047 2932 dbSNP
rs907348287 2941 dbSNP
rs754054685 2948 dbSNP
rs1227276774 2949 dbSNP
rs199906138 2952 dbSNP
rs1259306782 2964 dbSNP
rs1459320268 2965 dbSNP
rs1212194152 2969 dbSNP
rs1252834368 2985 dbSNP
rs1193192114 2989 dbSNP
rs957834859 2989 dbSNP
rs1044666616 2993 dbSNP
rs772406949 2995 dbSNP
rs181182884 2997 dbSNP
rs766855022 2999 dbSNP
rs1438477613 3008 dbSNP
rs894832727 3017 dbSNP
rs1467176635 3023 dbSNP
rs1162528135 3041 dbSNP
rs1349133706 3055 dbSNP
rs1436724382 3078 dbSNP
rs1294948827 3082 dbSNP
rs1053859175 3086 dbSNP
rs1001639640 3087 dbSNP
rs1398854664 3093 dbSNP
rs936456882 3094 dbSNP
rs1359112206 3098 dbSNP
rs3859909 3126 dbSNP
rs773613670 3127 dbSNP
rs943891674 3136 dbSNP
rs1375323128 3143 dbSNP
rs1240578663 3145 dbSNP
rs1485549558 3146 dbSNP
rs1194466368 3151 dbSNP
rs1265518046 3160 dbSNP
rs1478747176 3166 dbSNP
rs866426909 3190 dbSNP
rs912354865 3201 dbSNP
rs194292 3212 dbSNP
rs1442230050 3216 dbSNP
rs1337025036 3217 dbSNP
rs1321132185 3218 dbSNP
rs954096903 3225 dbSNP
rs1166392141 3227 dbSNP
rs749269716 3231 dbSNP
rs919973972 3232 dbSNP
rs194291 3233 dbSNP
rs961329976 3234 dbSNP
rs1341886706 3243 dbSNP
rs1413422360 3248 dbSNP
rs775640827 3253 dbSNP
rs1002932900 3254 dbSNP
rs1230399264 3275 dbSNP
rs1282665409 3278 dbSNP
rs1159078419 3283 dbSNP
rs1353257107 3285 dbSNP
rs1470529871 3288 dbSNP
rs1288230926 3292 dbSNP
rs1484745226 3297 dbSNP
rs1185659532 3309 dbSNP
rs971619726 3310 dbSNP
rs1472971237 3316 dbSNP
rs1183372456 3317 dbSNP
rs189039906 3318 dbSNP
rs1490239247 3322 dbSNP
rs1438670074 3326 dbSNP
rs1013205224 3327 dbSNP
rs1361846732 3331 dbSNP
rs1432328328 3338 dbSNP
rs1334016320 3341 dbSNP
rs1225167633 3343 dbSNP
rs185219203 3344 dbSNP
rs1360235168 3345 dbSNP
rs143128691 3355 dbSNP
rs1376696694 3356 dbSNP
rs1013921221 3369 dbSNP
rs1054678423 3375 dbSNP
rs2003135 3377 dbSNP
rs886281792 3377 dbSNP
rs1284106327 3378 dbSNP
rs1199958394 3381 dbSNP
rs774897578 3382 dbSNP
rs1212211238 3410 dbSNP
rs1279496924 3410 dbSNP
rs1442901379 3410 dbSNP
rs1236080999 3417 dbSNP
rs769301066 3418 dbSNP
rs1178789537 3421 dbSNP
rs750703637 3422 dbSNP
rs1452247216 3458 dbSNP
rs1171477357 3462 dbSNP
rs1425312702 3472 dbSNP
rs549169746 3483 dbSNP
rs1327466089 3484 dbSNP
rs1399973891 3488 dbSNP
rs1403867164 3492 dbSNP
rs891000884 3511 dbSNP
rs1232858758 3527 dbSNP
rs1345731628 3541 dbSNP
rs765616631 3552 dbSNP
rs1304596147 3554 dbSNP
rs1047992040 3563 dbSNP
rs1397835622 3575 dbSNP
rs1347246244 3584 dbSNP
rs757655475 3590 dbSNP
rs932467812 3592 dbSNP
rs930475277 3623 dbSNP
rs1317006774 3632 dbSNP
rs919840272 3637 dbSNP
rs973964137 3643 dbSNP
rs920536987 3644 dbSNP
rs1239847117 3661 dbSNP
rs1449486580 3667 dbSNP
rs1038942066 3674 dbSNP
rs1344418464 3678 dbSNP
rs1318832231 3689 dbSNP
rs1402353480 3691 dbSNP
rs745536397 3702 dbSNP
rs776204234 3705 dbSNP
rs754318614 3714 dbSNP
rs194290 3725 dbSNP
rs1392800146 3726 dbSNP
rs1480183967 3732 dbSNP
rs1324491938 3737 dbSNP
rs1332838732 3738 dbSNP
rs908532591 3739 dbSNP
rs981549628 3745 dbSNP
rs1317216185 3750 dbSNP
rs1219213808 3752 dbSNP
rs1259729458 3777 dbSNP
rs1430181905 3777 dbSNP
rs971883449 3777 dbSNP
rs1354024715 3795 dbSNP
rs1208833355 3799 dbSNP
rs1290161673 3802 dbSNP
rs1023165421 3819 dbSNP
rs1452777862 3821 dbSNP
rs760669384 3825 dbSNP
rs911184582 3845 dbSNP
rs992073666 3859 dbSNP
rs1261925611 3864 dbSNP
rs1478421037 3871 dbSNP
rs1196494489 3892 dbSNP
rs1367044729 3914 dbSNP
rs775645841 3918 dbSNP
rs1457723799 3929 dbSNP
rs957519878 3936 dbSNP
rs1393124744 3946 dbSNP
rs986888346 3947 dbSNP
rs767577917 3948 dbSNP
rs1033241997 3961 dbSNP
rs1280055492 3977 dbSNP
rs913421374 3995 dbSNP
rs1243813553 4008 dbSNP
rs1284627226 4014 dbSNP
rs193113336 4016 dbSNP
rs1358024120 4018 dbSNP
rs774252416 4027 dbSNP
rs989410968 4028 dbSNP
rs957550642 4029 dbSNP
rs1241919148 4038 dbSNP
rs1219343953 4040 dbSNP
rs141784372 4058 dbSNP
rs902216452 4059 dbSNP
rs1423799470 4064 dbSNP
rs1020558237 4083 dbSNP
rs1007967336 4126 dbSNP
rs1370600951 4134 dbSNP
rs890877867 4144 dbSNP
rs1001740661 4149 dbSNP
rs749147525 4155 dbSNP
rs1323631437 4160 dbSNP
rs1361206943 4167 dbSNP
rs747572820 4168 dbSNP
rs1421600902 4185 dbSNP
rs1284761549 4192 dbSNP
rs746852235 4199 dbSNP
rs1313124231 4206 dbSNP
rs969699308 4206 dbSNP
rs1049453033 4208 dbSNP
rs1237453949 4220 dbSNP
rs932497013 4243 dbSNP
rs796214692 4256 dbSNP
rs898301245 4259 dbSNP
rs1038325798 4260 dbSNP
rs1241660878 4262 dbSNP
rs13323 4273 dbSNP
rs1253804062 4281 dbSNP
rs1432718266 4287 dbSNP
rs1357347990 4297 dbSNP
rs777591634 4321 dbSNP
rs190522696 4322 dbSNP
rs1406968491 4333 dbSNP
rs112860242 4360 dbSNP
rs769857119 4383 dbSNP
rs1178795647 4389 dbSNP
rs981430434 4392 dbSNP
rs1381171838 4400 dbSNP
rs995112202 4410 dbSNP
rs898994348 4411 dbSNP
rs747551487 4426 dbSNP
rs748067989 4429 dbSNP
rs778871869 4458 dbSNP
rs1187453446 4469 dbSNP
rs1407937098 4486 dbSNP
rs1476598968 4494 dbSNP
rs943231389 4516 dbSNP
rs1241766410 4549 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084076. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugGUAACAGUGUGAGGu 5'
                 ||||   :|||||| 
Target 5' --ugugaCAUU---GCACUCCa 3'
1 - 17
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084076
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SigmaAb
Location of target site ENST00000371410.3 | 3UTR | UGUGACAUUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.731 2.5e-5 0.719 3.8e-5 24 Click to see details
GSE27834 Pluripotent stem cells -0.514 2.1e-2 -0.450 4.0e-2 16 Click to see details
GSE21687 Ependynoma primary tumors -0.218 4.2e-2 -0.280 1.3e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.284 9.5e-2 -0.410 2.6e-2 23 Click to see details
GSE19350 CNS germ cell tumors 0.389 1.1e-1 0.287 1.8e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.553 1.3e-1 0.714 5.5e-2 6 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.254 1.4e-1 0.035 4.4e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.176 2.0e-1 0.244 1.2e-1 25 Click to see details
GSE38226 Liver fibrosis 0.164 2.4e-1 0.224 1.6e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.208 2.5e-1 0.060 4.2e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.111 3.0e-1 -0.041 4.2e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.091 3.1e-1 -0.055 3.8e-1 32 Click to see details
GSE21849 B cell lymphoma 0.095 3.1e-1 0.293 6.1e-2 29 Click to see details
GSE17306 Multiple myeloma 0.07 3.2e-1 0.228 5.8e-2 49 Click to see details
GSE14794 Lymphoblastoid cells 0.014 4.5e-1 -0.029 3.9e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.008 4.8e-1 0.036 4.3e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.994 0.03 0.500 0.33 3 Click to see details
KIRP -0.613 0.04 -0.667 0.02 9 Click to see details
THCA -0.783 0.06 -0.700 0.09 5 Click to see details
STAD -0.505 0.1 0.048 0.46 8 Click to see details
ESCA 0.34 0.29 0.400 0.25 5 Click to see details
LIHC 0.069 0.32 -0.027 0.43 49 Click to see details
KIRC 0.064 0.37 0.050 0.4 29 Click to see details
KICH -0.138 0.37 -0.095 0.41 8 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
CHOL -0.072 0.43 0.200 0.3 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*