miRTarBase - #MIRT632994 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DUSP18   
Synonyms DSP18, DUSP20, LMWDSP20
Description dual specificity phosphatase 18
Transcript NM_152511   
Expression
Putative miRNA Targets on DUSP18
3'UTR of DUSP18
(miRNA target sites are highlighted)
>DUSP18|NM_152511|3'UTR
   1 GCCATCCCACGAGCCCCTGCATTGGAGTCAGAGGTACAGATCTATTGTTGATCTTACACCAAGATCCAAACTTGAACATT
  81 CTACTTTTGTTGATACAGAAAAAAACAGATGATGCCTTTTATGAGCACAAAAAAGAGTTGCTGTAGCTTTTAACTTTATA
 161 ATCCATTTTTTTTAAGATTAAACTAATTGTGAGATGGTGAAGATAAATTTTCTGCCCTGTGAGTGACACTGGCCAGGGGA
 241 TAGGTTGAGGCAGATGGTGCCCAGAAGAAAGAGGGCAGCACCCATTGCACATGGCAGGCCTGGAATCCTGCAGCCCTCCC
 321 CAAAAACAGATTGACCCAGGAATGAATCTGCTACAATTCCACCTCATTCTTTCACACCCAGAGCCAGAGCCTTAAGCATC
 401 ATGGTACCTCTTGCGCTTCTTACAGTGAGTGCCAATCTACTAGATAAATGGCCTTCAGGCAGTGCTCCAGGAATCCTGGG
 481 GGGTCCCAGGCCACCTCTGCTTCCACCTTCACTATAAGTGGCCCAGTTCTGGTTTTCTAGATTGTACTTATGCATAAGAT
 561 AGTTTTTAAAGAAAGCATTCCACTGTGTAAATTTTTTTTTGTCTTTTTTTGAAACTGTCCTGCTCTGTCACCCATCCTAG
 641 AGTGCAGTAGTGTGATCATGGCTCACTGTAGCCACAACCTCTCAGGCTCAAGTGATCCTCTTACCTTAGCCTCCTGCGTG
 721 GCTGGGACTACAGATGTTTGCCACCATGCCCGCCTCATTTTTTTTCTTTTTTTATAGAGATGAGATTTTACTATGTCGCC
 801 CAGACTGGTCTCAAACTCCTGGCCTCAAGCAATCCTCACGCCTCAGCCTCCCAAAGTGTTGATGAGCCACTGTACCCCGA
 881 TACCACTGTATAAAAAATTTAAAAAAAATTGTGAGTGCTATTGTACATGGCAAAGTTTCAAAGAGCTCTTGGCCATCCCT
 961 CACCAAACTTTGGCAAAAGATGGTGTTAGTCCCCTTCTCCAGGGCACATGAGAAAAACAGGCCTAACATCAGGTCTCAGC
1041 GGTTCCTCTCACAGGCCTTGGCTTGGAAGGCTGGAGCTTCGGACCAAGGCCCAGCCCTGTCACCTCCTCTTCATGTGATG
1121 TGGACCCCTGGGAGCATCAGTGTCCTCATCTGTCCAATGACAGCCCTTTTCTCACAGAGTTATTGTGAAGATTCAACAAT
1201 TTCTTGGCATAGTGCCTGGCACATGGTGTGTGCTTAGCGCAAATGGCAGCTCTCATCATGAATGATAGACTCTTTCACCC
1281 TGCTGGTCCCAGGTCGGCACACACATCCCCATAATGGCATTTCTCCTTTCTGTGCACAGCACTTTATTGTTACAAAGTAC
1361 TCTTCCAAAAAGTTACCCTGTGTGTAAAAAAAAAAAAAAAAAAAAATGGTTTAAGTCCTTTCAGACCCTACCTCACAGGA
1441 GGCCTAGACTTAGAGCCTTTTGAGAGCTTCCGTCTTGTTTAATCTAGGTGCAATCTAGAGGTCCTGAAACAAGGAGCACA
1521 GTTCCAGCTTCCCCCAATCACTTCTAAACAGTGACTGCAGCCTTGTTTAGAATCACTATGAAAACCTGCACCCCGGCTGA
1601 CTACTGGGATCCATAAGGGGGCCGTGTCAAAGGGACTAACTAGTGGACTCCATCAGTAGGCCCTGGAATTCAGGATTGTT
1681 CACATCCTCTTGGTGCCAAGGACCTGGCTGAAGACCAGCTCTTCTGATCCAGAGGTTTTCAGCAAACAGCATTTGAAACA
1761 AAAGCACAGCTGCTCTGTTTGACACCAAACTGTGGCTCCAGATTCCAGTAGAAGCCAAATGCTTTTTCTTTTAACAGCTG
1841 GGTGCCTGTAATCCCAGTTACTTGGGAGGCTGAGGCAGGAGAATTGCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCCG
1921 AGCTTGCACCATTGCACTCCAGCCTGGGCAACAAGAGTGAGACTCCATCTCAAAAAGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|||||||   :|||||| 
Target 5' cttGCACCATT---GCACTCCa 3'
1923 - 1941 148.00 -21.80
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             | ||:: | ||| ||||| 
Target 5' cccAGACTGGTCTCAAACTCCt 3'
799 - 820 131.00 -11.80
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||||  |  || | ||||| 
Target 5' gcAACA--AGAGTGAGACTCCa 3'
1948 - 1967 124.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13910233 10 COSMIC
COSN30525344 45 COSMIC
COSN30459143 67 COSMIC
COSN508005 98 COSMIC
COSN31503614 110 COSMIC
COSN31580107 162 COSMIC
COSN30676681 166 COSMIC
COSN24381060 173 COSMIC
COSN24297153 174 COSMIC
COSN28744376 174 COSMIC
COSN22687368 240 COSMIC
COSN22232250 454 COSMIC
COSN1260785 1492 COSMIC
COSN20661743 1715 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1243126083 1 dbSNP
rs780536202 4 dbSNP
rs1450102425 7 dbSNP
rs1292051248 8 dbSNP
rs756496468 9 dbSNP
rs371630116 10 dbSNP
rs1011008862 11 dbSNP
rs893879557 13 dbSNP
rs1230588462 17 dbSNP
rs1362394249 18 dbSNP
rs1052420769 21 dbSNP
rs1348072779 21 dbSNP
rs777330023 22 dbSNP
rs1433781963 27 dbSNP
rs1351287772 28 dbSNP
rs758100559 33 dbSNP
rs1428513952 36 dbSNP
rs1368232215 37 dbSNP
rs893125735 39 dbSNP
rs58619343 42 dbSNP
rs78592960 44 dbSNP
rs373502013 45 dbSNP
rs759046552 50 dbSNP
rs759310828 51 dbSNP
rs1045851006 53 dbSNP
rs1362188246 60 dbSNP
rs948975045 77 dbSNP
rs916130083 78 dbSNP
rs1413135500 87 dbSNP
rs1038581128 104 dbSNP
rs111803206 106 dbSNP
rs571380555 106 dbSNP
rs941743916 106 dbSNP
rs532504807 109 dbSNP
rs1263806179 112 dbSNP
rs1046320552 117 dbSNP
rs1333548710 124 dbSNP
rs1440932454 130 dbSNP
rs1279780622 135 dbSNP
rs1425047565 138 dbSNP
rs947939011 143 dbSNP
rs1279394958 144 dbSNP
rs983234091 144 dbSNP
rs1348481510 154 dbSNP
rs1213012466 157 dbSNP
rs1248504133 158 dbSNP
rs747420326 164 dbSNP
rs552648980 165 dbSNP
rs182765470 166 dbSNP
rs1048687783 173 dbSNP
rs2240002 174 dbSNP
rs923133666 174 dbSNP
rs1253650364 175 dbSNP
rs1396125575 187 dbSNP
rs1220002455 189 dbSNP
rs1490149295 209 dbSNP
rs1393615202 212 dbSNP
rs918331297 219 dbSNP
rs1292412845 220 dbSNP
rs1223761339 229 dbSNP
rs1337132867 231 dbSNP
rs529976634 232 dbSNP
rs1438325300 233 dbSNP
rs560958490 237 dbSNP
rs1306449445 238 dbSNP
rs1249559935 239 dbSNP
rs1338774591 240 dbSNP
rs1017575210 244 dbSNP
rs1224512594 250 dbSNP
rs561956840 251 dbSNP
rs1275262067 265 dbSNP
rs1467299609 271 dbSNP
rs1193311360 276 dbSNP
rs1253949672 279 dbSNP
rs1375839709 281 dbSNP
rs370093997 282 dbSNP
rs1191599289 288 dbSNP
rs1373037708 291 dbSNP
rs1404738808 303 dbSNP
rs191779581 310 dbSNP
rs912178934 312 dbSNP
rs987753570 316 dbSNP
rs1476049040 326 dbSNP
rs1167970564 336 dbSNP
rs1401923953 337 dbSNP
rs1459548788 354 dbSNP
rs1346624752 363 dbSNP
rs1324813574 369 dbSNP
rs1394873783 374 dbSNP
rs953733455 377 dbSNP
rs1293306127 397 dbSNP
rs1325759961 399 dbSNP
rs1228136183 406 dbSNP
rs1271996083 408 dbSNP
rs1332771814 414 dbSNP
rs1029184535 415 dbSNP
rs1452314440 423 dbSNP
rs989600900 425 dbSNP
rs527431568 435 dbSNP
rs1470072235 442 dbSNP
rs377191360 448 dbSNP
rs1261536101 449 dbSNP
rs998966511 455 dbSNP
rs907241080 467 dbSNP
rs1400874057 479 dbSNP
rs564589791 482 dbSNP
rs1473947622 483 dbSNP
rs1013072246 484 dbSNP
rs1163699836 484 dbSNP
rs1459161014 485 dbSNP
rs1196934705 493 dbSNP
rs894644226 514 dbSNP
rs1382645575 524 dbSNP
rs544614555 526 dbSNP
rs1358725086 527 dbSNP
rs1353586449 532 dbSNP
rs1479984300 533 dbSNP
rs1187045833 541 dbSNP
rs999534508 544 dbSNP
rs1337194613 552 dbSNP
rs879651012 553 dbSNP
rs1260504453 558 dbSNP
rs754666420 561 dbSNP
rs1207351505 581 dbSNP
rs575598848 582 dbSNP
rs62235876 589 dbSNP
rs1484877285 591 dbSNP
rs1025374090 594 dbSNP
rs1216618584 600 dbSNP
rs1425178437 601 dbSNP
rs908898058 601 dbSNP
rs941580231 601 dbSNP
rs1331419261 603 dbSNP
rs9606762 606 dbSNP
rs895041220 622 dbSNP
rs1454141142 625 dbSNP
rs923051047 631 dbSNP
rs368654453 632 dbSNP
rs1303911074 633 dbSNP
rs931129102 645 dbSNP
rs1313547421 648 dbSNP
rs1361893210 664 dbSNP
rs1287720072 677 dbSNP
rs896949101 678 dbSNP
rs1389824069 681 dbSNP
rs575063869 683 dbSNP
rs1317851345 684 dbSNP
rs150577166 684 dbSNP
rs373265082 684 dbSNP
rs1242812508 685 dbSNP
rs1278692526 688 dbSNP
rs1347766503 694 dbSNP
rs990094155 700 dbSNP
rs1173795931 713 dbSNP
rs41282549 717 dbSNP
rs1031672998 718 dbSNP
rs912247586 736 dbSNP
rs535220293 738 dbSNP
rs985510698 751 dbSNP
rs932286191 752 dbSNP
rs1024383729 763 dbSNP
rs1434023926 765 dbSNP
rs1187117052 766 dbSNP
rs1360908525 766 dbSNP
rs1466309433 774 dbSNP
rs922177113 779 dbSNP
rs1012936241 782 dbSNP
rs1374294299 784 dbSNP
rs1449345120 787 dbSNP
rs566183604 789 dbSNP
rs188894312 791 dbSNP
rs1370718106 797 dbSNP
rs559056017 798 dbSNP
rs1005805888 801 dbSNP
rs1313399124 806 dbSNP
rs1225711664 816 dbSNP
rs376083231 816 dbSNP
rs958208800 819 dbSNP
rs539054014 825 dbSNP
rs868780895 832 dbSNP
rs1047303839 836 dbSNP
rs929005618 838 dbSNP
rs755332513 839 dbSNP
rs978168487 840 dbSNP
rs971203255 846 dbSNP
rs1194130341 847 dbSNP
rs570092289 852 dbSNP
rs368028374 853 dbSNP
rs1427225861 857 dbSNP
rs901492279 861 dbSNP
rs553355078 863 dbSNP
rs1040174478 875 dbSNP
rs184032553 878 dbSNP
rs1012652190 879 dbSNP
rs1324147808 884 dbSNP
rs910403543 885 dbSNP
rs895101162 896 dbSNP
rs550131747 900 dbSNP
rs139004951 901 dbSNP
rs1360463988 908 dbSNP
rs1294226315 909 dbSNP
rs566901409 909 dbSNP
rs1304315222 911 dbSNP
rs1460284113 915 dbSNP
rs1220030167 918 dbSNP
rs1372358170 920 dbSNP
rs567546900 926 dbSNP
rs1171048645 931 dbSNP
rs547276503 941 dbSNP
rs1451311206 955 dbSNP
rs1467835709 959 dbSNP
rs1221996404 961 dbSNP
rs897003052 963 dbSNP
rs527443314 964 dbSNP
rs1484847201 965 dbSNP
rs1185861342 968 dbSNP
rs1420238670 977 dbSNP
rs1383413762 983 dbSNP
rs190940171 985 dbSNP
rs977363174 987 dbSNP
rs1417378806 988 dbSNP
rs370995187 1002 dbSNP
rs890856423 1004 dbSNP
rs1049445520 1009 dbSNP
rs1194361497 1013 dbSNP
rs1480503289 1016 dbSNP
rs932311832 1018 dbSNP
rs1325925779 1019 dbSNP
rs1252306149 1021 dbSNP
rs9609038 1030 dbSNP
rs1357968227 1035 dbSNP
rs1340545637 1040 dbSNP
rs531285897 1041 dbSNP
rs991551600 1042 dbSNP
rs185920559 1048 dbSNP
rs1228593204 1057 dbSNP
rs924136861 1073 dbSNP
rs1291758241 1075 dbSNP
rs978219288 1081 dbSNP
rs1214921866 1083 dbSNP
rs1263850240 1085 dbSNP
rs970869375 1087 dbSNP
rs1185871903 1092 dbSNP
rs1314428676 1095 dbSNP
rs1165224634 1099 dbSNP
rs542599421 1106 dbSNP
rs917990971 1118 dbSNP
rs990877892 1120 dbSNP
rs1160418578 1121 dbSNP
rs1400515962 1121 dbSNP
rs959642714 1123 dbSNP
rs1413531514 1124 dbSNP
rs1310532335 1129 dbSNP
rs114734655 1134 dbSNP
rs1308439390 1138 dbSNP
rs145135259 1142 dbSNP
rs1363650503 1151 dbSNP
rs1285614918 1157 dbSNP
rs998436645 1161 dbSNP
rs961265076 1163 dbSNP
rs1162933267 1164 dbSNP
rs58640678 1171 dbSNP
rs1445310067 1173 dbSNP
rs775755888 1175 dbSNP
rs541276943 1178 dbSNP
rs1208722136 1180 dbSNP
rs901519950 1182 dbSNP
rs374825925 1193 dbSNP
rs1008476578 1199 dbSNP
rs1189822324 1204 dbSNP
rs1231426025 1206 dbSNP
rs1469854160 1207 dbSNP
rs370605383 1208 dbSNP
rs888832950 1216 dbSNP
rs1054203156 1218 dbSNP
rs1049951541 1222 dbSNP
rs996581534 1225 dbSNP
rs1251640157 1226 dbSNP
rs924450216 1228 dbSNP
rs9606761 1231 dbSNP
rs1352374909 1232 dbSNP
rs1054033668 1233 dbSNP
rs373828068 1238 dbSNP
rs936955524 1239 dbSNP
rs1489986972 1255 dbSNP
rs1231917252 1261 dbSNP
rs1302612411 1268 dbSNP
rs1291698148 1270 dbSNP
rs1202217104 1274 dbSNP
rs949948572 1275 dbSNP
rs1437452493 1280 dbSNP
rs924189206 1288 dbSNP
rs1240344047 1293 dbSNP
rs1193513400 1295 dbSNP
rs1356424414 1296 dbSNP
rs1479316567 1298 dbSNP
rs917251872 1304 dbSNP
rs181287363 1305 dbSNP
rs8630 1309 dbSNP
rs958691621 1329 dbSNP
rs1334822615 1332 dbSNP
rs1402141511 1335 dbSNP
rs1438483200 1336 dbSNP
rs556329536 1338 dbSNP
rs536602349 1347 dbSNP
rs984205770 1349 dbSNP
rs1411432989 1352 dbSNP
rs1268492454 1353 dbSNP
rs1343478966 1363 dbSNP
rs752605804 1375 dbSNP
rs1302456105 1379 dbSNP
rs1376644295 1384 dbSNP
rs1304393986 1385 dbSNP
rs3067260 1386 dbSNP
rs1156930178 1395 dbSNP
rs549480509 1398 dbSNP
rs868714994 1401 dbSNP
rs1412994071 1402 dbSNP
rs1184705247 1404 dbSNP
rs386395203 1406 dbSNP
rs918056035 1406 dbSNP
rs1391273646 1407 dbSNP
rs1425291282 1407 dbSNP
rs1459591452 1407 dbSNP
rs1491130046 1407 dbSNP
rs33914926 1407 dbSNP
rs77182933 1407 dbSNP
rs1387905236 1408 dbSNP
rs1488927444 1409 dbSNP
rs1025780866 1410 dbSNP
rs1193729059 1411 dbSNP
rs1264778655 1413 dbSNP
rs1474021177 1422 dbSNP
rs1163646136 1432 dbSNP
rs190122162 1436 dbSNP
rs540145024 1437 dbSNP
rs965578654 1438 dbSNP
rs1420288901 1444 dbSNP
rs955979854 1447 dbSNP
rs1263855606 1466 dbSNP
rs1353649002 1470 dbSNP
rs919948525 1471 dbSNP
rs113483027 1472 dbSNP
rs1054636528 1473 dbSNP
rs1237296594 1473 dbSNP
rs1260556649 1487 dbSNP
rs999935336 1493 dbSNP
rs1453880231 1496 dbSNP
rs1219521451 1497 dbSNP
rs144406312 1502 dbSNP
rs1041512921 1506 dbSNP
rs1180876246 1510 dbSNP
rs1256464040 1511 dbSNP
rs1202864452 1532 dbSNP
rs771497337 1533 dbSNP
rs961318449 1537 dbSNP
rs917199305 1541 dbSNP
rs1440163644 1542 dbSNP
rs747410659 1550 dbSNP
rs1160397904 1553 dbSNP
rs773642436 1554 dbSNP
rs1055637636 1557 dbSNP
rs937367910 1561 dbSNP
rs1008111179 1570 dbSNP
rs955398354 1573 dbSNP
rs1308987156 1576 dbSNP
rs1229909934 1584 dbSNP
rs1028135735 1588 dbSNP
rs1282441930 1589 dbSNP
rs116386177 1594 dbSNP
rs892876631 1595 dbSNP
rs1208783904 1597 dbSNP
rs1332784100 1603 dbSNP
rs1054085204 1621 dbSNP
rs186145267 1623 dbSNP
rs1237277725 1624 dbSNP
rs1440101033 1627 dbSNP
rs533761206 1640 dbSNP
rs1393158873 1642 dbSNP
rs1432572629 1652 dbSNP
rs376458022 1654 dbSNP
rs951470764 1658 dbSNP
rs918750444 1672 dbSNP
rs976883011 1677 dbSNP
rs141040023 1683 dbSNP
rs1468483021 1697 dbSNP
rs902814928 1700 dbSNP
rs1367496234 1705 dbSNP
rs1043038581 1708 dbSNP
rs1007129323 1714 dbSNP
rs1301272979 1722 dbSNP
rs181701741 1727 dbSNP
rs76352804 1729 dbSNP
rs1479255068 1733 dbSNP
rs1257066179 1741 dbSNP
rs1000356204 1743 dbSNP
rs1240866344 1747 dbSNP
rs1055280041 1748 dbSNP
rs938122936 1759 dbSNP
rs562602773 1765 dbSNP
rs548706853 1766 dbSNP
rs1488115774 1769 dbSNP
rs920000791 1778 dbSNP
rs1193175592 1780 dbSNP
rs1269484231 1783 dbSNP
rs1426840322 1788 dbSNP
rs1464036508 1795 dbSNP
rs1424571727 1798 dbSNP
rs974114686 1805 dbSNP
rs1248157578 1818 dbSNP
rs1349666584 1819 dbSNP
rs1014082792 1828 dbSNP
rs202024432 1829 dbSNP
rs200849606 1833 dbSNP
rs199884774 1834 dbSNP
rs895636760 1834 dbSNP
rs11325761 1835 dbSNP
rs398101724 1835 dbSNP
rs9609037 1840 dbSNP
rs1220160601 1841 dbSNP
rs1346956994 1843 dbSNP
rs908515442 1848 dbSNP
rs1320906141 1856 dbSNP
rs1222157812 1863 dbSNP
rs1268343135 1867 dbSNP
rs1487293687 1870 dbSNP
rs937233624 1881 dbSNP
rs987141936 1884 dbSNP
rs1478884832 1885 dbSNP
rs1365997614 1886 dbSNP
rs955301597 1890 dbSNP
rs1406348410 1894 dbSNP
rs1048349534 1898 dbSNP
rs1028605503 1899 dbSNP
rs930057822 1900 dbSNP
rs1419685236 1903 dbSNP
rs975267632 1904 dbSNP
rs1322696353 1911 dbSNP
rs918712548 1915 dbSNP
rs190148042 1919 dbSNP
rs1405635289 1920 dbSNP
rs1282094478 1921 dbSNP
rs1378124729 1922 dbSNP
rs1335190855 1925 dbSNP
rs1291826152 1927 dbSNP
rs1416512339 1928 dbSNP
rs1417883519 1930 dbSNP
rs1351410116 1931 dbSNP
rs1032723119 1932 dbSNP
rs1215809505 1933 dbSNP
rs766654414 1935 dbSNP
rs965559343 1936 dbSNP
rs998524480 1937 dbSNP
rs1167818975 1939 dbSNP
rs1450679780 1940 dbSNP
rs148129737 1943 dbSNP
rs985722490 1948 dbSNP
rs187497355 1951 dbSNP
rs1459656233 1952 dbSNP
rs1236539865 1955 dbSNP
rs1439551240 1955 dbSNP
rs1159801148 1958 dbSNP
rs1360553433 1959 dbSNP
rs958275306 1962 dbSNP
rs1331679177 1963 dbSNP
rs1358198822 1967 dbSNP
rs1448381764 1967 dbSNP
rs1210471553 1971 dbSNP
rs1374398120 1972 dbSNP
rs1443918642 1975 dbSNP
rs146820373 1977 dbSNP
rs1195127809 1978 dbSNP
rs1342826777 1981 dbSNP
rs1299860426 1982 dbSNP
rs1278077720 1983 dbSNP
rs1443210536 1985 dbSNP
rs572758556 1987 dbSNP
rs878868331 1987 dbSNP
rs978485848 1988 dbSNP
rs1243872942 1989 dbSNP
rs1382208654 1990 dbSNP
rs967446995 1992 dbSNP
rs1020017031 1993 dbSNP
rs1403799881 1993 dbSNP
rs1414622432 1993 dbSNP
rs1491057586 1993 dbSNP
rs375019336 1993 dbSNP
rs397723342 1993 dbSNP
rs555969142 1993 dbSNP
rs56242112 1993 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugGUAACAGUGUGAGGu 5'
                 ||||   :|||||| 
Target 5' ---aggaCAUU---GCACUCCa 3'
1 - 16
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000403268.1 | 3UTR | AGGACAUUGCACUCCAGCCUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000403268.1 | 3UTR | ACAUUGCACUCCAGCCUGGGCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.64 3.8e-4 0.666 1.9e-4 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.397 2.5e-2 -0.362 3.8e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.316 3.9e-2 -0.389 1.4e-2 32 Click to see details
GSE38226 Liver fibrosis -0.305 8.9e-2 -0.274 1.1e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.315 1.6e-1 -0.252 2.1e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.114 1.8e-1 -0.100 2.2e-1 64 Click to see details
GSE14794 Lymphoblastoid cells -0.09 2.0e-1 -0.118 1.3e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.16 2.2e-1 0.006 4.9e-1 25 Click to see details
GSE17306 Multiple myeloma -0.096 2.6e-1 -0.129 1.9e-1 49 Click to see details
GSE21849 B cell lymphoma 0.091 3.2e-1 0.012 4.8e-1 29 Click to see details
GSE42095 Differentiated embryonic stem cells -0.1 3.2e-1 0.141 2.6e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.095 3.5e-1 0.032 4.5e-1 20 Click to see details
GSE28260 Renal cortex and medulla 0.122 3.5e-1 0.005 4.9e-1 13 Click to see details
GSE27834 Pluripotent stem cells -0.094 3.6e-1 -0.029 4.6e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.043 4.2e-1 0.103 3.2e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.001 5.0e-1 -0.143 3.9e-1 6 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.431 0 -0.372 0 49 Click to see details
KIRC -0.417 0.01 -0.361 0.03 29 Click to see details
HNSC -0.992 0.04 -0.500 0.33 3 Click to see details
KICH 0.633 0.05 0.690 0.03 8 Click to see details
ESCA 0.787 0.06 0.900 0.02 5 Click to see details
CHOL 0.476 0.1 0.267 0.24 9 Click to see details
THCA -0.361 0.28 -0.200 0.37 5 Click to see details
STAD 0.164 0.35 0.214 0.31 8 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
KIRP 0.032 0.47 -0.267 0.24 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*