miRTarBase - #MIRT635050 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MYH11   
Synonyms AAT4, FAA4, SMHC, SMMHC
Description myosin heavy chain 11
Transcript NM_001040113   
Other Transcripts NM_001040114 , NM_002474 , NM_022844   
Expression
Putative miRNA Targets on MYH11
3'UTR of MYH11
(miRNA target sites are highlighted)
>MYH11|NM_001040113|3'UTR
   1 TGCACCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGG
  81 TTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTG
 161 CACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGC
 241 AGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACC
 321 ACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACAC
 401 CTGTGGTCCCAGCTACTAGGGAGGCTGAGCCAGGAAGAACGCTCCAGCCCAGGACTTCGAGGCTGCAATGAGCTATAATT
 481 GCATCATTGCACTCCAGCCTGGGCAACAGAGACCCTGTCTCAACCACCACCACCACCACCACCCCTACTACCCCTGTATT
 561 CAAGGTAAAAATTGAAGTTTGTATGATGTAAGAGATGAGAAAAACCCAACAGGAAACACAGACACATCCTCCAGTTCTAT
 641 CAATGGATTGTGCAGACACTGAGTTTTTAGAAAAACATATCCACGGTAACCGGTCCCTGGCAATTCTGTTTACATGAAAT
 721 GGGGAGAAAGTCACCGAAATGGGTGCCGCCGGCCCCCACTCCCAATTCATTCCCTAACCTGCAAACCTTTCCAACTTCTC
 801 ACGTCAGGCCTTTGAGAATTCTTTCCCCCTCTCCTGGTTTCCACACCTCAGACACGCACAGTTCACCAAGTGCCTTCTGT
 881 AGTCACATGAATTGAAAAGGAGACGCTGCTCCCACGGAGGGGAGCAGGAATGCTGCACTGTTTACACCCTGACTGTGCTT
 961 AAAAACACTTTCACTAATAAATGGTTATAAATCACAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||:  |||  |::|||||| 
Target 5' atAATTGCATCATTGCACTCCa 3'
475 - 496 144.00 -19.50
2
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||  ||||| ||| |:||| 
Target 5' ctAAATCCATTCTCAAATTCCa 3'
260 - 281 128.00 -15.40
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            || ||||    ||| |||| 
Target 5' taAAAACCA---CCACCCTCCa 3'
313 - 331 125.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1171328 3 ClinVar
257254 5 ClinVar
681478 16 ClinVar
386332 27 ClinVar
674417 64 ClinVar
678516 4458 ClinVar
1200891 4653 ClinVar
886712 4675 ClinVar
921660 4681 ClinVar
503630 4689 ClinVar
928329 4690 ClinVar
201043 4697 ClinVar
201044 4701 ClinVar
924729 4709 ClinVar
318088 4724 ClinVar
924346 4726 ClinVar
514103 4730 ClinVar
920086 4734 ClinVar
597048 4741 ClinVar
626141 4744 ClinVar
921204 4751 ClinVar
920485 4753 ClinVar
927588 4764 ClinVar
923445 4765 ClinVar
807997 4770 ClinVar
201045 4774 ClinVar
519932 4775 ClinVar
918428 4782 ClinVar
318087 4787 ClinVar
419054 4788 ClinVar
1013093 4791 ClinVar
487586 4798 ClinVar
922387 4813 ClinVar
927720 4823 ClinVar
928247 4824 ClinVar
192314 4825 ClinVar
378210 4833 ClinVar
381045 4839 ClinVar
318086 4857 ClinVar
885706 4881 ClinVar
318085 4886 ClinVar
318083 5048 ClinVar
885705 5124 ClinVar
884761 5194 ClinVar
318082 5209 ClinVar
318081 5240 ClinVar
884760 5258 ClinVar
318080 5300 ClinVar
318078 5339 ClinVar
318077 5364 ClinVar
318076 5397 ClinVar
318075 5420 ClinVar
887911 5427 ClinVar
887910 5429 ClinVar
887909 5430 ClinVar
887908 5451 ClinVar
318074 5461 ClinVar
318073 5482 ClinVar
318072 5532 ClinVar
318071 5584 ClinVar
318070 5624 ClinVar
COSN30478745 8 COSMIC
COSN18304505 18 COSMIC
COSN25051248 82 COSMIC
COSN7299166 177 COSMIC
COSN1693536 631 COSMIC
COSN15701931 871 COSMIC
COSN24970087 882 COSMIC
COSN15687948 1216 COSMIC
COSN29842145 1351 COSMIC
COSN20988049 1535 COSMIC
COSN25034212 1816 COSMIC
COSN27077845 2248 COSMIC
COSN21059327 2550 COSMIC
COSN24191880 2568 COSMIC
COSN32150572 2579 COSMIC
COSN16590513 2766 COSMIC
COSN29680350 2805 COSMIC
COSN32150571 2925 COSMIC
COSN23670195 3269 COSMIC
COSN29352066 3740 COSMIC
COSN19017978 3817 COSMIC
COSN1693535 3946 COSMIC
COSN28661118 4534 COSMIC
COSN28836234 4570 COSMIC
COSN28869374 4571 COSMIC
COSN28188318 4611 COSMIC
COSM8523940 4690 COSMIC
COSM6078323 4693 COSMIC
COSM4058557 4697 COSMIC
COSM4058556 4698 COSMIC
COSM6143423 4703 COSMIC
COSM5350317 4717 COSMIC
COSM8649905 4717 COSMIC
COSM6719131 4723 COSMIC
COSM5581768 4732 COSMIC
COSM4058555 4734 COSMIC
COSM2127023 4736 COSMIC
COSM4641993 4737 COSMIC
COSM434691 4744 COSMIC
COSM4655701 4754 COSMIC
COSM5174773 4758 COSMIC
COSM1629783 4764 COSMIC
COSM7401809 4770 COSMIC
COSM5458548 4775 COSMIC
COSM701886 4782 COSMIC
COSM5575951 4783 COSMIC
COSM8452975 4786 COSMIC
COSM2127021 4787 COSMIC
COSM9723535 4800 COSMIC
COSM4990832 4805 COSMIC
COSM7755049 4805 COSMIC
COSM8422817 4809 COSMIC
COSM5687486 4813 COSMIC
COSM7528955 4815 COSMIC
COSN30159158 4842 COSMIC
COSN30494848 4844 COSMIC
COSN30144190 4845 COSMIC
COSN30104656 4851 COSMIC
COSN13244059 4878 COSMIC
COSN20112688 4878 COSMIC
COSN26985552 4888 COSMIC
COSN31576921 4915 COSMIC
COSN30455480 4916 COSMIC
COSN30161001 4921 COSMIC
COSN30506613 4924 COSMIC
COSN1693534 4946 COSMIC
COSN31593607 4974 COSMIC
COSN4892708 4977 COSMIC
COSN30494835 4983 COSMIC
COSN7299165 5371 COSMIC
COSN26265153 5523 COSMIC
COSN208626 5526 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1427039928 4 dbSNP
rs886038393 5 dbSNP
rs1418778615 6 dbSNP
rs772484878 8 dbSNP
rs557821702 9 dbSNP
rs113966376 10 dbSNP
rs113247663 11 dbSNP
rs774813200 12 dbSNP
rs770467844 13 dbSNP
rs372646869 15 dbSNP
rs369832024 16 dbSNP
rs751001415 16 dbSNP
rs1354160724 17 dbSNP
rs768702830 21 dbSNP
rs376349256 23 dbSNP
rs373484327 27 dbSNP
rs747927379 28 dbSNP
rs780993488 29 dbSNP
rs938476003 31 dbSNP
rs754707982 32 dbSNP
rs751588116 35 dbSNP
rs780139983 37 dbSNP
rs373322898 38 dbSNP
rs779515749 40 dbSNP
rs757301602 43 dbSNP
rs985428245 47 dbSNP
rs753892941 48 dbSNP
rs1201876349 50 dbSNP
rs753914460 55 dbSNP
rs928352490 56 dbSNP
rs1268352638 58 dbSNP
rs539944135 59 dbSNP
rs1202058928 60 dbSNP
rs1294250172 63 dbSNP
rs144505034 64 dbSNP
rs796264302 64 dbSNP
rs369841035 69 dbSNP
rs914265949 72 dbSNP
rs569219458 73 dbSNP
rs1187012610 74 dbSNP
rs1421438601 77 dbSNP
rs112554812 78 dbSNP
rs1170037486 81 dbSNP
rs1366366315 84 dbSNP
rs375413331 85 dbSNP
rs567903065 87 dbSNP
rs1344953429 90 dbSNP
rs1353794833 100 dbSNP
rs1171291321 101 dbSNP
rs1360356703 102 dbSNP
rs970919485 109 dbSNP
rs772457367 110 dbSNP
rs531535087 111 dbSNP
rs2272557 116 dbSNP
rs1187465310 117 dbSNP
rs1450504257 124 dbSNP
rs1475635940 125 dbSNP
rs1243726110 127 dbSNP
rs1012525069 134 dbSNP
rs1260059971 135 dbSNP
rs998844971 136 dbSNP
rs140043055 138 dbSNP
rs189613384 139 dbSNP
rs1446735870 145 dbSNP
rs528322406 151 dbSNP
rs1365083912 152 dbSNP
rs1401321049 155 dbSNP
rs545554756 156 dbSNP
rs1204658035 161 dbSNP
rs894371946 167 dbSNP
rs1247729204 174 dbSNP
rs375112323 177 dbSNP
rs1247765395 178 dbSNP
rs1187096099 183 dbSNP
rs1319364610 185 dbSNP
rs1055658128 192 dbSNP
rs1223799116 194 dbSNP
rs1398582101 197 dbSNP
rs897120351 199 dbSNP
rs1270682047 202 dbSNP
rs1243582397 204 dbSNP
rs1037083833 206 dbSNP
rs1266589534 207 dbSNP
rs1182015199 208 dbSNP
rs944115785 209 dbSNP
rs1355621761 211 dbSNP
rs1314625473 212 dbSNP
rs1160434274 216 dbSNP
rs1389445560 221 dbSNP
rs778978155 224 dbSNP
rs532079170 241 dbSNP
rs757677609 241 dbSNP
rs1050006774 245 dbSNP
rs1372603074 246 dbSNP
rs1337927929 252 dbSNP
rs1298648451 253 dbSNP
rs1408798281 260 dbSNP
rs1450846839 264 dbSNP
rs928403238 265 dbSNP
rs749608747 266 dbSNP
rs1239312170 268 dbSNP
rs914487172 270 dbSNP
rs775577555 271 dbSNP
rs1347895813 274 dbSNP
rs185582991 276 dbSNP
rs940342468 277 dbSNP
rs1325457136 280 dbSNP
rs1201482698 286 dbSNP
rs924266548 287 dbSNP
rs908854333 288 dbSNP
rs1418831672 291 dbSNP
rs1231291372 296 dbSNP
rs867324329 298 dbSNP
rs1177813673 302 dbSNP
rs981228369 304 dbSNP
rs1432009351 306 dbSNP
rs1468571755 317 dbSNP
rs881803 334 dbSNP
rs1397641808 335 dbSNP
rs953019687 337 dbSNP
rs1028974255 341 dbSNP
rs1257826753 342 dbSNP
rs1333498793 346 dbSNP
rs1467492822 348 dbSNP
rs1408641407 350 dbSNP
rs530508593 351 dbSNP
rs965919639 352 dbSNP
rs1025172453 371 dbSNP
rs1255237705 376 dbSNP
rs1339807585 378 dbSNP
rs1197801435 379 dbSNP
rs1271100285 380 dbSNP
rs539928520 385 dbSNP
rs150687675 388 dbSNP
rs1271123781 390 dbSNP
rs1479780255 395 dbSNP
rs967365746 407 dbSNP
rs1021611173 409 dbSNP
rs1242232137 410 dbSNP
rs1027649914 415 dbSNP
rs1325376896 418 dbSNP
rs1368243692 418 dbSNP
rs1428551281 422 dbSNP
rs995680337 425 dbSNP
rs541945879 427 dbSNP
rs529553900 428 dbSNP
rs1366864146 433 dbSNP
rs1385060599 437 dbSNP
rs1056109671 443 dbSNP
rs1002718587 449 dbSNP
rs897195071 451 dbSNP
rs1453266594 452 dbSNP
rs72772013 460 dbSNP
rs540933012 467 dbSNP
rs1294092468 469 dbSNP
rs1489873293 470 dbSNP
rs1453127061 471 dbSNP
rs1394992416 476 dbSNP
rs940391384 479 dbSNP
rs1192533205 487 dbSNP
rs1262992541 493 dbSNP
rs908948152 493 dbSNP
rs1048744159 502 dbSNP
rs1389944392 507 dbSNP
rs573430826 508 dbSNP
rs1049806061 513 dbSNP
rs558147561 516 dbSNP
rs932480813 517 dbSNP
rs114726902 519 dbSNP
rs965518339 520 dbSNP
rs142034693 521 dbSNP
rs193209876 522 dbSNP
rs764794268 524 dbSNP
rs761727093 532 dbSNP
rs949674281 534 dbSNP
rs915666295 536 dbSNP
rs1244068896 540 dbSNP
rs991213183 547 dbSNP
rs959811744 550 dbSNP
rs1261834620 553 dbSNP
rs1487168218 556 dbSNP
rs894923124 560 dbSNP
rs1332932834 562 dbSNP
rs1203871901 565 dbSNP
rs753519545 566 dbSNP
rs920096673 571 dbSNP
rs974334054 575 dbSNP
rs958923049 577 dbSNP
rs1386638959 578 dbSNP
rs535514713 581 dbSNP
rs1363872007 583 dbSNP
rs1015575428 585 dbSNP
rs148558167 586 dbSNP
rs1300493379 589 dbSNP
rs1453045874 590 dbSNP
rs955378497 591 dbSNP
rs1375412170 593 dbSNP
rs1395653344 598 dbSNP
rs1028834886 602 dbSNP
rs1036224525 603 dbSNP
rs996933055 606 dbSNP
rs1227118102 612 dbSNP
rs560815540 613 dbSNP
rs1054272164 616 dbSNP
rs1324725343 621 dbSNP
rs1205909115 627 dbSNP
rs1241669959 628 dbSNP
rs1174788590 630 dbSNP
rs1180890778 631 dbSNP
rs527464582 639 dbSNP
rs1049275776 641 dbSNP
rs931672286 642 dbSNP
rs998803362 643 dbSNP
rs903117038 645 dbSNP
rs754960973 650 dbSNP
rs1045655315 657 dbSNP
rs56365050 658 dbSNP
rs1465777846 660 dbSNP
rs1298916112 668 dbSNP
rs1375663887 672 dbSNP
rs545283129 676 dbSNP
rs144789606 677 dbSNP
rs530468874 681 dbSNP
rs1346761459 687 dbSNP
rs149470922 690 dbSNP
rs977601117 702 dbSNP
rs967514341 707 dbSNP
rs1311952773 708 dbSNP
rs1209015194 710 dbSNP
rs914669833 711 dbSNP
rs1483751223 722 dbSNP
rs756861710 723 dbSNP
rs920116054 725 dbSNP
rs1480759574 727 dbSNP
rs974198225 728 dbSNP
rs1249699602 729 dbSNP
rs961496087 735 dbSNP
rs1034737128 741 dbSNP
rs1327313505 745 dbSNP
rs1280299446 747 dbSNP
rs1413373469 749 dbSNP
rs1307571343 751 dbSNP
rs1355248366 753 dbSNP
rs981426902 759 dbSNP
rs1273535487 764 dbSNP
rs1367382217 765 dbSNP
rs1215453479 767 dbSNP
rs971326148 770 dbSNP
rs908817204 773 dbSNP
rs1442882795 775 dbSNP
rs1273331833 784 dbSNP
rs35439038 784 dbSNP
rs1490357526 786 dbSNP
rs1004752490 789 dbSNP
rs138033033 793 dbSNP
rs777404693 798 dbSNP
rs112651119 805 dbSNP
rs1186950562 805 dbSNP
rs1447932060 812 dbSNP
rs1165717909 814 dbSNP
rs1028323631 817 dbSNP
rs756068792 820 dbSNP
rs1426583262 821 dbSNP
rs1322148864 823 dbSNP
rs1461015379 825 dbSNP
rs1423955363 830 dbSNP
rs74009408 831 dbSNP
rs1432091375 832 dbSNP
rs1457464730 832 dbSNP
rs1348129284 833 dbSNP
rs57351581 833 dbSNP
rs1473996784 834 dbSNP
rs957465761 835 dbSNP
rs996304814 835 dbSNP
rs1287118922 836 dbSNP
rs900177578 836 dbSNP
rs1040469278 839 dbSNP
rs1463339109 841 dbSNP
rs1188201248 842 dbSNP
rs1187919778 844 dbSNP
rs1170575371 846 dbSNP
rs1444125488 848 dbSNP
rs1270796841 849 dbSNP
rs1161592938 852 dbSNP
rs1161881660 852 dbSNP
rs1224294887 852 dbSNP
rs1366944842 852 dbSNP
rs1386952811 852 dbSNP
rs1401833078 852 dbSNP
rs1413158037 852 dbSNP
rs1430586598 852 dbSNP
rs1449769548 852 dbSNP
rs1473824546 852 dbSNP
rs1491362541 852 dbSNP
rs59081092 852 dbSNP
rs60325958 852 dbSNP
rs749239998 852 dbSNP
rs761626697 852 dbSNP
rs768627821 852 dbSNP
rs1207815276 853 dbSNP
rs1491346800 853 dbSNP
rs755900975 853 dbSNP
rs775130276 853 dbSNP
rs1243513951 854 dbSNP
rs1318673584 855 dbSNP
rs1260024181 856 dbSNP
rs1231720659 857 dbSNP
rs1470532918 858 dbSNP
rs1184982828 861 dbSNP
rs529770561 864 dbSNP
rs1294352267 865 dbSNP
rs1450628352 868 dbSNP
rs1177688437 870 dbSNP
rs1033067258 871 dbSNP
rs146921406 874 dbSNP
rs902982300 876 dbSNP
rs1331737216 881 dbSNP
rs540795832 882 dbSNP
rs556563397 883 dbSNP
rs1290150631 885 dbSNP
rs1348619553 892 dbSNP
rs1400428010 893 dbSNP
rs528670974 897 dbSNP
rs142689052 898 dbSNP
rs930416287 899 dbSNP
rs1346829163 903 dbSNP
rs767221896 905 dbSNP
rs1198968671 908 dbSNP
rs1278103672 912 dbSNP
rs898931029 914 dbSNP
rs1036046574 915 dbSNP
rs1416704620 915 dbSNP
rs940195545 916 dbSNP
rs908707830 917 dbSNP
rs558477303 918 dbSNP
rs1472575129 920 dbSNP
rs1167070092 924 dbSNP
rs1163696555 925 dbSNP
rs987499017 936 dbSNP
rs1400976841 940 dbSNP
rs934243238 941 dbSNP
rs921293895 945 dbSNP
rs975454051 949 dbSNP
rs1309387770 952 dbSNP
rs1473639887 953 dbSNP
rs1231155997 955 dbSNP
rs927380706 956 dbSNP
rs1409185014 964 dbSNP
rs1181029854 967 dbSNP
rs138683244 970 dbSNP
rs373818102 971 dbSNP
rs879708594 972 dbSNP
rs1468258044 978 dbSNP
rs150166112 979 dbSNP
rs1435334053 983 dbSNP
rs556890581 984 dbSNP
rs1272634193 985 dbSNP
rs1024140548 991 dbSNP
rs1482742833 999 dbSNP
rs1014609444 1001 dbSNP
rs541941145 1006 dbSNP
rs951930728 1007 dbSNP
rs1027871157 1018 dbSNP
rs1198671715 1019 dbSNP
rs573065948 1021 dbSNP
rs1279293525 1025 dbSNP
rs900289343 1036 dbSNP
rs1170066857 1037 dbSNP
rs1387803651 1047 dbSNP
rs1428493214 1049 dbSNP
rs1294060692 1053 dbSNP
rs1392869527 1054 dbSNP
rs574555938 1055 dbSNP
rs188476655 1057 dbSNP
rs1365633472 1058 dbSNP
rs1379681330 1060 dbSNP
rs894379425 1064 dbSNP
rs376962387 1065 dbSNP
rs185152678 1066 dbSNP
rs58062082 1067 dbSNP
rs534542370 1068 dbSNP
rs576962788 1069 dbSNP
rs1209732562 1070 dbSNP
rs1262923545 1072 dbSNP
rs58842869 1073 dbSNP
rs1190141984 1074 dbSNP
rs1406693162 1079 dbSNP
rs542230906 1082 dbSNP
rs1448490319 1083 dbSNP
rs1041971908 1084 dbSNP
rs946274506 1085 dbSNP
rs893376673 1087 dbSNP
rs887302067 1089 dbSNP
rs1389151526 1091 dbSNP
rs537312030 1092 dbSNP
rs368732478 1099 dbSNP
rs1051261625 1100 dbSNP
rs1314988640 1108 dbSNP
rs1338750643 1108 dbSNP
rs1244722004 1111 dbSNP
rs1261783553 1112 dbSNP
rs1331662715 1127 dbSNP
rs934126082 1129 dbSNP
rs1247313235 1130 dbSNP
rs1267890223 1131 dbSNP
rs1464194975 1134 dbSNP
rs1182067832 1135 dbSNP
rs569674692 1136 dbSNP
rs1224087875 1137 dbSNP
rs1445424364 1138 dbSNP
rs1284020305 1139 dbSNP
rs1458736932 1141 dbSNP
rs1217785024 1148 dbSNP
rs1156765951 1161 dbSNP
rs921549449 1165 dbSNP
rs927401481 1170 dbSNP
rs976033510 1172 dbSNP
rs935997065 1173 dbSNP
rs925934155 1177 dbSNP
rs977539934 1179 dbSNP
rs950034494 1183 dbSNP
rs907850984 1185 dbSNP
rs140904388 1186 dbSNP
rs1352938489 1187 dbSNP
rs1366321314 1187 dbSNP
rs1227066755 1192 dbSNP
rs1274885530 1197 dbSNP
rs1313099661 1200 dbSNP
rs1210425372 1203 dbSNP
rs1438175973 1215 dbSNP
rs1481997658 1218 dbSNP
rs1024586415 1235 dbSNP
rs148021823 1238 dbSNP
rs952082971 1240 dbSNP
rs749889807 1241 dbSNP
rs958759841 1243 dbSNP
rs565815751 1244 dbSNP
rs1018652224 1245 dbSNP
rs1465730436 1251 dbSNP
rs1308759559 1255 dbSNP
rs1372465176 1256 dbSNP
rs766627608 1261 dbSNP
rs1034272372 1274 dbSNP
rs1221239063 1275 dbSNP
rs1299629724 1280 dbSNP
rs1310140565 1281 dbSNP
rs1233068543 1303 dbSNP
rs1274797114 1314 dbSNP
rs1483721700 1317 dbSNP
rs966363319 1318 dbSNP
rs995128553 1322 dbSNP
rs1488690706 1324 dbSNP
rs1010552278 1326 dbSNP
rs778641630 1327 dbSNP
rs1014525075 1328 dbSNP
rs1004618664 1334 dbSNP
rs756794434 1335 dbSNP
rs890217289 1338 dbSNP
rs1002115709 1339 dbSNP
rs1241737597 1343 dbSNP
rs547495856 1348 dbSNP
rs998369372 1359 dbSNP
rs753720168 1365 dbSNP
rs1292186479 1376 dbSNP
rs1489464953 1381 dbSNP
rs1439736573 1382 dbSNP
rs369032907 1383 dbSNP
rs1343681429 1385 dbSNP
rs1225469162 1387 dbSNP
rs528727227 1389 dbSNP
rs564661047 1394 dbSNP
rs1223648990 1395 dbSNP
rs1244790204 1396 dbSNP
rs936233719 1400 dbSNP
rs1467839173 1404 dbSNP
rs925965385 1417 dbSNP
rs1189460786 1423 dbSNP
rs1041725521 1429 dbSNP
rs946000430 1432 dbSNP
rs917358044 1438 dbSNP
rs930653835 1439 dbSNP
rs1220439705 1441 dbSNP
rs1407620524 1443 dbSNP
rs1163230771 1445 dbSNP
rs920515881 1451 dbSNP
rs377130761 1453 dbSNP
rs1320821661 1457 dbSNP
rs1458031556 1457 dbSNP
rs552596942 1458 dbSNP
rs531207121 1463 dbSNP
rs763935401 1464 dbSNP
rs1287562113 1467 dbSNP
rs191830391 1479 dbSNP
rs1400176337 1482 dbSNP
rs927117207 1484 dbSNP
rs763137728 1497 dbSNP
rs1463743083 1502 dbSNP
rs1310775550 1506 dbSNP
rs987254444 1508 dbSNP
rs1359655416 1518 dbSNP
rs1178404039 1523 dbSNP
rs1408251348 1524 dbSNP
rs541853108 1531 dbSNP
rs973318178 1534 dbSNP
rs963252482 1535 dbSNP
rs1011021704 1536 dbSNP
rs1386886102 1536 dbSNP
rs186930937 1540 dbSNP
rs760526093 1542 dbSNP
rs752719725 1544 dbSNP
rs1449512583 1547 dbSNP
rs1033679440 1551 dbSNP
rs1354817441 1554 dbSNP
rs1255854967 1558 dbSNP
rs1187609699 1560 dbSNP
rs1290034800 1561 dbSNP
rs143562575 1564 dbSNP
rs906043063 1565 dbSNP
rs1279515453 1568 dbSNP
rs1045959851 1569 dbSNP
rs1208176521 1572 dbSNP
rs1014411423 1573 dbSNP
rs1030091574 1574 dbSNP
rs1184908240 1576 dbSNP
rs1239720859 1583 dbSNP
rs559465739 1585 dbSNP
rs996322966 1586 dbSNP
rs1425501915 1590 dbSNP
rs886558919 1591 dbSNP
rs1047774554 1593 dbSNP
rs1374296457 1593 dbSNP
rs930642074 1598 dbSNP
rs541503223 1619 dbSNP
rs1309729694 1624 dbSNP
rs1348401963 1626 dbSNP
rs920582758 1628 dbSNP
rs1347480432 1630 dbSNP
rs900035183 1632 dbSNP
rs1039378807 1638 dbSNP
rs1279737400 1644 dbSNP
rs1220728478 1650 dbSNP
rs1319485418 1651 dbSNP
rs534171552 1654 dbSNP
rs1483401849 1658 dbSNP
rs71398888 1669 dbSNP
rs576975815 1670 dbSNP
rs1250180008 1672 dbSNP
rs1200106113 1674 dbSNP
rs943331793 1674 dbSNP
rs911792848 1678 dbSNP
rs1291267787 1679 dbSNP
rs558674114 1682 dbSNP
rs1000476650 1683 dbSNP
rs987303922 1686 dbSNP
rs904788158 1687 dbSNP
rs1041967866 1688 dbSNP
rs774232702 1690 dbSNP
rs1439876523 1691 dbSNP
rs945202592 1696 dbSNP
rs917203922 1699 dbSNP
rs913659430 1703 dbSNP
rs71376093 1706 dbSNP
rs1434622706 1711 dbSNP
rs937404949 1712 dbSNP
rs550915949 1713 dbSNP
rs576371172 1727 dbSNP
rs1033321982 1731 dbSNP
rs763044670 1732 dbSNP
rs1339356624 1736 dbSNP
rs1210936177 1739 dbSNP
rs963159140 1740 dbSNP
rs907801608 1741 dbSNP
rs373615208 1742 dbSNP
rs1251923266 1743 dbSNP
rs1449683306 1748 dbSNP
rs970320643 1750 dbSNP
rs1024556081 1752 dbSNP
rs373349958 1752 dbSNP
rs1014440519 1754 dbSNP
rs1392625066 1764 dbSNP
rs886568706 1764 dbSNP
rs1480553581 1765 dbSNP
rs1237043132 1769 dbSNP
rs1324957207 1773 dbSNP
rs954438673 1775 dbSNP
rs1437514024 1777 dbSNP
rs1293589094 1782 dbSNP
rs1198708630 1784 dbSNP
rs1325883122 1787 dbSNP
rs1458862082 1791 dbSNP
rs1267679619 1792 dbSNP
rs773587581 1794 dbSNP
rs994905602 1800 dbSNP
rs1269157860 1802 dbSNP
rs770191974 1806 dbSNP
rs1210185516 1807 dbSNP
rs1259080303 1810 dbSNP
rs1039060728 1811 dbSNP
rs1427341516 1811 dbSNP
rs964801345 1818 dbSNP
rs1370181562 1831 dbSNP
rs1474182729 1832 dbSNP
rs1032064543 1834 dbSNP
rs554888667 1837 dbSNP
rs1459045045 1840 dbSNP
rs1340982368 1841 dbSNP
rs1222014120 1842 dbSNP
rs1375988976 1843 dbSNP
rs1332198577 1845 dbSNP
rs1314919600 1849 dbSNP
rs1000383326 1851 dbSNP
rs1354186115 1852 dbSNP
rs1449083735 1855 dbSNP
rs1289423125 1857 dbSNP
rs890404283 1861 dbSNP
rs140581285 1868 dbSNP
rs1293182366 1870 dbSNP
rs1258523935 1877 dbSNP
rs945212495 1878 dbSNP
rs1485333435 1885 dbSNP
rs182354357 1891 dbSNP
rs1235124639 1893 dbSNP
rs1200602377 1895 dbSNP
rs189680275 1896 dbSNP
rs1257626558 1899 dbSNP
rs1484680805 1899 dbSNP
rs752780520 1900 dbSNP
rs1458567914 1901 dbSNP
rs765370761 1902 dbSNP
rs571861850 1904 dbSNP
rs895839464 1906 dbSNP
rs936463077 1918 dbSNP
rs1057438491 1923 dbSNP
rs1466737911 1924 dbSNP
rs187689642 1925 dbSNP
rs937329618 1937 dbSNP
rs980500757 1938 dbSNP
rs1309124465 1946 dbSNP
rs970348444 1947 dbSNP
rs1352731688 1948 dbSNP
rs1178755673 1962 dbSNP
rs1300334455 1972 dbSNP
rs1024566094 1974 dbSNP
rs1316010782 1979 dbSNP
rs74713965 1987 dbSNP
rs1037712075 1988 dbSNP
rs1345071195 1990 dbSNP
rs183967680 1991 dbSNP
rs1208906687 1999 dbSNP
rs768986720 2006 dbSNP
rs551690739 2009 dbSNP
rs933212208 2014 dbSNP
rs528698813 2019 dbSNP
rs922989421 2028 dbSNP
rs1178442579 2032 dbSNP
rs548468013 2032 dbSNP
rs1007521395 2034 dbSNP
rs1393380956 2037 dbSNP
rs974825638 2038 dbSNP
rs530074826 2043 dbSNP
rs1242166982 2044 dbSNP
rs945266453 2054 dbSNP
rs892364413 2058 dbSNP
rs1053648045 2059 dbSNP
rs936498391 2063 dbSNP
rs1387028716 2064 dbSNP
rs1300594611 2065 dbSNP
rs964384459 2066 dbSNP
rs1032095357 2069 dbSNP
rs979141527 2084 dbSNP
rs1387578536 2085 dbSNP
rs370933226 2085 dbSNP
rs1345133617 2087 dbSNP
rs926401091 2092 dbSNP
rs1393126141 2094 dbSNP
rs1287552656 2095 dbSNP
rs1044799145 2096 dbSNP
rs1160359080 2096 dbSNP
rs1250570875 2096 dbSNP
rs554587198 2096 dbSNP
rs949051280 2096 dbSNP
rs1251433293 2097 dbSNP
rs1453991684 2097 dbSNP
rs1419444215 2099 dbSNP
rs1408740613 2100 dbSNP
rs917560174 2100 dbSNP
rs78974169 2102 dbSNP
rs1350842628 2103 dbSNP
rs1309892852 2108 dbSNP
rs1324285176 2108 dbSNP
rs1363389425 2108 dbSNP
rs1368414630 2108 dbSNP
rs1459714280 2108 dbSNP
rs1212764276 2109 dbSNP
rs1161001572 2110 dbSNP
rs1433362212 2131 dbSNP
rs1375434941 2134 dbSNP
rs1294683704 2140 dbSNP
rs1322244008 2144 dbSNP
rs1215408082 2151 dbSNP
rs146811560 2152 dbSNP
rs963844842 2153 dbSNP
rs973633122 2153 dbSNP
rs1474430935 2156 dbSNP
rs1186463353 2157 dbSNP
rs1415225374 2160 dbSNP
rs1426068766 2164 dbSNP
rs1163270657 2165 dbSNP
rs756961079 2169 dbSNP
rs1184604138 2172 dbSNP
rs1460615322 2188 dbSNP
rs1320762387 2191 dbSNP
rs1007573390 2199 dbSNP
rs1427967061 2201 dbSNP
rs577242603 2204 dbSNP
rs1379859263 2206 dbSNP
rs1487827560 2206 dbSNP
rs1235037800 2207 dbSNP
rs192141881 2209 dbSNP
rs1370164222 2210 dbSNP
rs1035923537 2214 dbSNP
rs1218711612 2221 dbSNP
rs1445479010 2223 dbSNP
rs111861338 2224 dbSNP
rs1009504959 2229 dbSNP
rs777539330 2231 dbSNP
rs1186364557 2232 dbSNP
rs576282335 2237 dbSNP
rs1037786156 2243 dbSNP
rs942119346 2244 dbSNP
rs554951157 2247 dbSNP
rs1333085607 2248 dbSNP
rs775967961 2250 dbSNP
rs1047538744 2259 dbSNP
rs1354598708 2260 dbSNP
rs933137416 2261 dbSNP
rs542935285 2262 dbSNP
rs905002479 2266 dbSNP
rs974646826 2272 dbSNP
rs529617433 2274 dbSNP
rs1044849868 2275 dbSNP
rs572071849 2276 dbSNP
rs979215054 2278 dbSNP
rs1257356868 2286 dbSNP
rs1483659584 2290 dbSNP
rs1413491500 2291 dbSNP
rs1402106649 2292 dbSNP
rs1468301871 2294 dbSNP
rs1467898954 2295 dbSNP
rs1157592739 2300 dbSNP
rs1395169064 2303 dbSNP
rs966437241 2305 dbSNP
rs1466079038 2306 dbSNP
rs1410321987 2310 dbSNP
rs1330694602 2314 dbSNP
rs1333713667 2316 dbSNP
rs1379059823 2317 dbSNP
rs1441791595 2319 dbSNP
rs913626169 2321 dbSNP
rs553698812 2322 dbSNP
rs960195243 2323 dbSNP
rs1232253570 2328 dbSNP
rs538370273 2339 dbSNP
rs1279665450 2340 dbSNP
rs1343563455 2347 dbSNP
rs1263644845 2352 dbSNP
rs1271364427 2364 dbSNP
rs1195555074 2365 dbSNP
rs974023218 2366 dbSNP
rs1455305962 2369 dbSNP
rs1191246871 2370 dbSNP
rs1393927786 2372 dbSNP
rs963595291 2374 dbSNP
rs1036360443 2375 dbSNP
rs910689221 2381 dbSNP
rs986248464 2389 dbSNP
rs571353275 2390 dbSNP
rs555961610 2395 dbSNP
rs200687524 2399 dbSNP
rs1397043163 2400 dbSNP
rs537292283 2403 dbSNP
rs186909746 2405 dbSNP
rs199761369 2407 dbSNP
rs970069525 2415 dbSNP
rs1030369892 2416 dbSNP
rs1009557092 2424 dbSNP
rs1016197499 2425 dbSNP
rs956881795 2426 dbSNP
rs548480265 2427 dbSNP
rs1413318073 2432 dbSNP
rs1340444041 2433 dbSNP
rs1335426349 2434 dbSNP
rs1275408523 2441 dbSNP
rs1398256093 2444 dbSNP
rs559514863 2447 dbSNP
rs886541714 2450 dbSNP
rs1428522344 2452 dbSNP
rs1047785977 2453 dbSNP
rs574695920 2460 dbSNP
rs1328614853 2461 dbSNP
rs1165443691 2463 dbSNP
rs1464830432 2463 dbSNP
rs181523246 2471 dbSNP
rs369329619 2472 dbSNP
rs1039397504 2473 dbSNP
rs4781681 2480 dbSNP
rs1385784895 2487 dbSNP
rs924964284 2493 dbSNP
rs1316312303 2500 dbSNP
rs558643613 2501 dbSNP
rs1234410441 2504 dbSNP
rs1295519445 2509 dbSNP
rs78928767 2510 dbSNP
rs1464058591 2512 dbSNP
rs565407164 2524 dbSNP
rs543932324 2526 dbSNP
rs1206446472 2529 dbSNP
rs1198078584 2530 dbSNP
rs1259016923 2537 dbSNP
rs1446380995 2539 dbSNP
rs190425626 2554 dbSNP
rs910785694 2561 dbSNP
rs1474071202 2562 dbSNP
rs1227013048 2564 dbSNP
rs368469876 2566 dbSNP
rs991888426 2567 dbSNP
rs960518388 2570 dbSNP
rs986302169 2571 dbSNP
rs933481367 2572 dbSNP
rs1384279917 2575 dbSNP
rs928815221 2576 dbSNP
rs980782630 2577 dbSNP
rs988608737 2581 dbSNP
rs1308152747 2586 dbSNP
rs143728194 2592 dbSNP
rs1445356877 2596 dbSNP
rs1016444644 2598 dbSNP
rs1006199181 2604 dbSNP
rs1400633822 2607 dbSNP
rs1032785769 2608 dbSNP
rs529710084 2610 dbSNP
rs1403200434 2612 dbSNP
rs1259606042 2620 dbSNP
rs1484648955 2622 dbSNP
rs754802134 2623 dbSNP
rs1421128772 2626 dbSNP
rs1179867825 2627 dbSNP
rs1363303626 2630 dbSNP
rs1389757813 2631 dbSNP
rs542964146 2639 dbSNP
rs4781680 2641 dbSNP
rs553767071 2642 dbSNP
rs545014195 2643 dbSNP
rs1013434567 2646 dbSNP
rs1038847918 2649 dbSNP
rs1375679966 2653 dbSNP
rs1234473488 2657 dbSNP
rs1007371414 2659 dbSNP
rs1281806833 2660 dbSNP
rs896282823 2666 dbSNP
rs1025415815 2668 dbSNP
rs1240053289 2670 dbSNP
rs994291077 2674 dbSNP
rs903789901 2684 dbSNP
rs1043624327 2685 dbSNP
rs1421892894 2686 dbSNP
rs1195620829 2690 dbSNP
rs1393322556 2694 dbSNP
rs1454247331 2704 dbSNP
rs1451192628 2715 dbSNP
rs1291110087 2724 dbSNP
rs945031625 2725 dbSNP
rs577560299 2726 dbSNP
rs1305024927 2732 dbSNP
rs1309139344 2742 dbSNP
rs185656028 2745 dbSNP
rs554847714 2745 dbSNP
rs1038467006 2746 dbSNP
rs1309168055 2747 dbSNP
rs1056654351 2749 dbSNP
rs181108721 2752 dbSNP
rs928822694 2755 dbSNP
rs1257156479 2762 dbSNP
rs56403331 2765 dbSNP
rs1251223089 2766 dbSNP
rs1330137634 2772 dbSNP
rs948868517 2776 dbSNP
rs1406851050 2777 dbSNP
rs189196232 2781 dbSNP
rs909473538 2788 dbSNP
rs375904599 2789 dbSNP
rs923414325 2791 dbSNP
rs1170251631 2793 dbSNP
rs1418970325 2793 dbSNP
rs1461673577 2795 dbSNP
rs1157997362 2801 dbSNP
rs1327416478 2802 dbSNP
rs1420192690 2803 dbSNP
rs1393438398 2804 dbSNP
rs1382253143 2805 dbSNP
rs988314469 2805 dbSNP
rs1189533317 2806 dbSNP
rs984975748 2806 dbSNP
rs950754041 2807 dbSNP
rs979878126 2808 dbSNP
rs1026312398 2809 dbSNP
rs969345808 2810 dbSNP
rs1247475840 2813 dbSNP
rs1201523502 2814 dbSNP
rs1159256340 2827 dbSNP
rs1163203021 2827 dbSNP
rs1193529753 2827 dbSNP
rs1201748728 2827 dbSNP
rs1216642888 2827 dbSNP
rs1243901608 2827 dbSNP
rs1258655330 2827 dbSNP
rs1404359947 2827 dbSNP
rs1409545312 2827 dbSNP
rs1415295919 2827 dbSNP
rs1462286109 2827 dbSNP
rs1476356226 2827 dbSNP
rs1485193411 2827 dbSNP
rs57451847 2827 dbSNP
rs1157526168 2828 dbSNP
rs1256375533 2828 dbSNP
rs1487522901 2828 dbSNP
rs1285703231 2830 dbSNP
rs1217991819 2831 dbSNP
rs754838991 2832 dbSNP
rs1285815422 2836 dbSNP
rs1310870393 2839 dbSNP
rs11075276 2840 dbSNP
rs1371432617 2843 dbSNP
rs751402278 2846 dbSNP
rs1343908751 2847 dbSNP
rs1275053321 2848 dbSNP
rs976597866 2851 dbSNP
rs992050565 2860 dbSNP
rs1438685240 2861 dbSNP
rs1207049529 2867 dbSNP
rs377451310 2875 dbSNP
rs966140851 2877 dbSNP
rs1406341467 2878 dbSNP
rs1177520881 2884 dbSNP
rs1338186559 2886 dbSNP
rs1395113575 2887 dbSNP
rs566400127 2889 dbSNP
rs1455559326 2891 dbSNP
rs547751572 2894 dbSNP
rs1401256194 2901 dbSNP
rs1018081951 2902 dbSNP
rs779810298 2904 dbSNP
rs532586070 2907 dbSNP
rs1255144126 2908 dbSNP
rs903654160 2909 dbSNP
rs993994874 2910 dbSNP
rs571542328 2916 dbSNP
rs1304281905 2922 dbSNP
rs914529581 2930 dbSNP
rs1022254897 2933 dbSNP
rs1232746334 2934 dbSNP
rs1009483284 2937 dbSNP
rs898277795 2938 dbSNP
rs1271293643 2940 dbSNP
rs892148280 2944 dbSNP
rs1197573354 2951 dbSNP
rs1056118124 2953 dbSNP
rs1253082650 2954 dbSNP
rs938984324 2957 dbSNP
rs990257618 2958 dbSNP
rs904962021 2961 dbSNP
rs559805287 2962 dbSNP
rs1169481515 2969 dbSNP
rs367651003 2970 dbSNP
rs531810435 2973 dbSNP
rs868687459 2974 dbSNP
rs1262933224 2976 dbSNP
rs1322937506 2978 dbSNP
rs1194831776 2979 dbSNP
rs909378718 2980 dbSNP
rs1268816567 2986 dbSNP
rs985048647 2991 dbSNP
rs929557120 3000 dbSNP
rs919279671 3002 dbSNP
rs561079033 3004 dbSNP
rs1266030534 3005 dbSNP
rs1447539200 3006 dbSNP
rs1053072407 3014 dbSNP
rs1477340327 3016 dbSNP
rs935507331 3016 dbSNP
rs1420345895 3019 dbSNP
rs966401467 3030 dbSNP
rs925369060 3031 dbSNP
rs1017695859 3033 dbSNP
rs986205442 3034 dbSNP
rs11862637 3039 dbSNP
rs1022117533 3050 dbSNP
rs916554194 3051 dbSNP
rs150050549 3054 dbSNP
rs892393181 3055 dbSNP
rs184356470 3058 dbSNP
rs1288968077 3059 dbSNP
rs1003215547 3067 dbSNP
rs1350685132 3073 dbSNP
rs973010814 3075 dbSNP
rs904823964 3081 dbSNP
rs139410313 3083 dbSNP
rs1364049917 3091 dbSNP
rs1422313913 3096 dbSNP
rs1187020692 3098 dbSNP
rs941113412 3102 dbSNP
rs887970299 3103 dbSNP
rs750574151 3104 dbSNP
rs59525893 3111 dbSNP
rs929436496 3112 dbSNP
rs1447143358 3114 dbSNP
rs1156922700 3120 dbSNP
rs1360497563 3126 dbSNP
rs1435863656 3127 dbSNP
rs776914690 3128 dbSNP
rs1400467958 3130 dbSNP
rs1393935808 3133 dbSNP
rs182190179 3136 dbSNP
rs1335969957 3139 dbSNP
rs904711 3141 dbSNP
rs573370346 3148 dbSNP
rs953783331 3163 dbSNP
rs1211454051 3172 dbSNP
rs1423179513 3175 dbSNP
rs1171885276 3176 dbSNP
rs1282200628 3177 dbSNP
rs371604826 3184 dbSNP
rs910552536 3185 dbSNP
rs986236546 3187 dbSNP
rs997805453 3190 dbSNP
rs968110698 3195 dbSNP
rs150870031 3202 dbSNP
rs1237565885 3203 dbSNP
rs536479840 3205 dbSNP
rs1456199379 3207 dbSNP
rs1052669075 3212 dbSNP
rs956709111 3214 dbSNP
rs1465905898 3215 dbSNP
rs1299096961 3217 dbSNP
rs1034954411 3234 dbSNP
rs1000107708 3239 dbSNP
rs903999915 3240 dbSNP
rs1309066618 3241 dbSNP
rs1310228065 3253 dbSNP
rs1003864109 3254 dbSNP
rs969122554 3255 dbSNP
rs572550752 3256 dbSNP
rs1251655835 3258 dbSNP
rs554491114 3262 dbSNP
rs1196944606 3263 dbSNP
rs538924532 3266 dbSNP
rs1399908975 3267 dbSNP
rs1423765795 3270 dbSNP
rs1433082598 3277 dbSNP
rs948145331 3279 dbSNP
rs1005288071 3285 dbSNP
rs916647346 3286 dbSNP
rs571636132 3287 dbSNP
rs550163224 3288 dbSNP
rs1168019551 3290 dbSNP
rs114610715 3293 dbSNP
rs939324907 3294 dbSNP
rs776046343 3295 dbSNP
rs1348505707 3296 dbSNP
rs918506405 3299 dbSNP
rs1424959653 3301 dbSNP
rs1296067804 3303 dbSNP
rs866567009 3304 dbSNP
rs972636443 3306 dbSNP
rs1217049261 3307 dbSNP
rs1184951584 3308 dbSNP
rs1257733427 3313 dbSNP
rs1335720855 3323 dbSNP
rs144836188 3327 dbSNP
rs1245005520 3328 dbSNP
rs1488457992 3329 dbSNP
rs1187544198 3330 dbSNP
rs1437302704 3331 dbSNP
rs1264313334 3340 dbSNP
rs1477077896 3342 dbSNP
rs770390900 3345 dbSNP
rs541207991 3349 dbSNP
rs1236986954 3352 dbSNP
rs1198884730 3354 dbSNP
rs1046759750 3358 dbSNP
rs1166324639 3364 dbSNP
rs748799237 3366 dbSNP
rs34868865 3367 dbSNP
rs1040668520 3368 dbSNP
rs772860184 3370 dbSNP
rs190582160 3373 dbSNP
rs953836870 3380 dbSNP
rs1237813553 3381 dbSNP
rs1376294910 3382 dbSNP
rs527519429 3385 dbSNP
rs1029360252 3387 dbSNP
rs560047218 3387 dbSNP
rs1321135512 3395 dbSNP
rs74009407 3406 dbSNP
rs1050427531 3407 dbSNP
rs946674465 3410 dbSNP
rs1193454464 3416 dbSNP
rs1258601663 3423 dbSNP
rs915333134 3425 dbSNP
rs1472943054 3431 dbSNP
rs999756262 3434 dbSNP
rs988600331 3442 dbSNP
rs1422792191 3446 dbSNP
rs1159193450 3447 dbSNP
rs185285647 3447 dbSNP
rs1417764351 3449 dbSNP
rs1458713312 3449 dbSNP
rs1375763128 3453 dbSNP
rs747958672 3457 dbSNP
rs780809087 3459 dbSNP
rs1282700375 3462 dbSNP
rs1378710950 3464 dbSNP
rs1224442195 3470 dbSNP
rs904088074 3470 dbSNP
rs956601926 3470 dbSNP
rs1367793783 3472 dbSNP
rs927786984 3482 dbSNP
rs1022492057 3487 dbSNP
rs895265218 3488 dbSNP
rs533052437 3490 dbSNP
rs1235447873 3492 dbSNP
rs147937192 3492 dbSNP
rs1472243745 3494 dbSNP
rs1178768100 3504 dbSNP
rs1381575777 3505 dbSNP
rs1437753171 3506 dbSNP
rs982075399 3508 dbSNP
rs1157914858 3510 dbSNP
rs1379165519 3519 dbSNP
rs969265371 3521 dbSNP
rs1023478901 3525 dbSNP
rs939350521 3531 dbSNP
rs531609636 3532 dbSNP
rs897130740 3538 dbSNP
rs1443135301 3544 dbSNP
rs1037427052 3561 dbSNP
rs941312128 3563 dbSNP
rs1240080835 3566 dbSNP
rs562750871 3566 dbSNP
rs1347750480 3569 dbSNP
rs1217877194 3570 dbSNP
rs3784857 3574 dbSNP
rs932454938 3578 dbSNP
rs922360157 3580 dbSNP
rs1239480749 3582 dbSNP
rs1456110315 3583 dbSNP
rs1177460756 3584 dbSNP
rs1247256054 3586 dbSNP
rs1488700198 3587 dbSNP
rs1170614148 3592 dbSNP
rs976449649 3595 dbSNP
rs192087904 3596 dbSNP
rs952346505 3600 dbSNP
rs1398364378 3603 dbSNP
rs1446223936 3612 dbSNP
rs754965709 3614 dbSNP
rs751499071 3617 dbSNP
rs1352822323 3630 dbSNP
rs994318874 3637 dbSNP
rs1434881243 3638 dbSNP
rs1274666873 3639 dbSNP
rs1286906949 3646 dbSNP
rs1340422230 3647 dbSNP
rs898016456 3656 dbSNP
rs1310714007 3665 dbSNP
rs1197508315 3668 dbSNP
rs1040927721 3671 dbSNP
rs1300872059 3672 dbSNP
rs968367201 3673 dbSNP
rs1347777934 3677 dbSNP
rs1453285903 3679 dbSNP
rs1397947118 3681 dbSNP
rs1882706 3686 dbSNP
rs889387563 3687 dbSNP
rs1050625114 3694 dbSNP
rs1035121430 3697 dbSNP
rs1003601353 3698 dbSNP
rs573282677 3702 dbSNP
rs1465279342 3709 dbSNP
rs1163932191 3711 dbSNP
rs1392921544 3722 dbSNP
rs1404110217 3743 dbSNP
rs897214299 3746 dbSNP
rs893806861 3747 dbSNP
rs1402287507 3750 dbSNP
rs1052572516 3755 dbSNP
rs561492585 3758 dbSNP
rs1217588016 3766 dbSNP
rs1037074457 3773 dbSNP
rs941351357 3780 dbSNP
rs796353672 3782 dbSNP
rs539943492 3789 dbSNP
rs1480521685 3791 dbSNP
rs1049594737 3792 dbSNP
rs1289149849 3800 dbSNP
rs1488560772 3805 dbSNP
rs572610791 3807 dbSNP
rs554027767 3808 dbSNP
rs140954447 3812 dbSNP
rs947867449 3814 dbSNP
rs1191221923 3818 dbSNP
rs916504570 3824 dbSNP
rs1487961112 3826 dbSNP
rs1471888752 3828 dbSNP
rs1162708062 3835 dbSNP
rs79741230 3839 dbSNP
rs1296767503 3844 dbSNP
rs1206770439 3847 dbSNP
rs370823128 3852 dbSNP
rs758533076 3853 dbSNP
rs750447805 3859 dbSNP
rs1283065994 3865 dbSNP
rs972536543 3867 dbSNP
rs3784858 3868 dbSNP
rs1019334760 3870 dbSNP
rs1341735317 3872 dbSNP
rs1200814628 3878 dbSNP
rs1320881883 3880 dbSNP
rs556873480 3882 dbSNP
rs1440886816 3885 dbSNP
rs1399445516 3886 dbSNP
rs978484100 3887 dbSNP
rs1301692967 3888 dbSNP
rs1470050025 3889 dbSNP
rs1157319627 3891 dbSNP
rs1430971025 3896 dbSNP
rs374658888 3900 dbSNP
rs1304934016 3902 dbSNP
rs538289369 3906 dbSNP
rs567652122 3908 dbSNP
rs761984307 3920 dbSNP
rs187165325 3951 dbSNP
rs1376912211 3954 dbSNP
rs777079903 3960 dbSNP
rs991046713 3965 dbSNP
rs959540918 3973 dbSNP
rs1035211231 3982 dbSNP
rs893837888 3983 dbSNP
rs1257489400 3985 dbSNP
rs1477384727 3989 dbSNP
rs1200014953 4000 dbSNP
rs1238878346 4004 dbSNP
rs1373391172 4009 dbSNP
rs1176854830 4015 dbSNP
rs1004117504 4016 dbSNP
rs1238148961 4018 dbSNP
rs1434239873 4019 dbSNP
rs1178718858 4024 dbSNP
rs1376242771 4025 dbSNP
rs961519403 4026 dbSNP
rs371585177 4029 dbSNP
rs1421926712 4031 dbSNP
rs117760029 4033 dbSNP
rs1255624418 4034 dbSNP
rs566679849 4035 dbSNP
rs1328660316 4038 dbSNP
rs1204377059 4045 dbSNP
rs551255307 4046 dbSNP
rs533136575 4047 dbSNP
rs1222657361 4050 dbSNP
rs1198196887 4052 dbSNP
rs1319075012 4053 dbSNP
rs1046436923 4054 dbSNP
rs1049648529 4059 dbSNP
rs1193363571 4063 dbSNP
rs1243276701 4066 dbSNP
rs764420554 4076 dbSNP
rs916413096 4081 dbSNP
rs562472721 4087 dbSNP
rs149291068 4089 dbSNP
rs1491142761 4090 dbSNP
rs1353343111 4093 dbSNP
rs1458355955 4095 dbSNP
rs984025203 4097 dbSNP
rs1365404461 4104 dbSNP
rs1404155721 4109 dbSNP
rs374798626 4111 dbSNP
rs1342639759 4116 dbSNP
rs761071411 4127 dbSNP
rs775930668 4128 dbSNP
rs1169416252 4135 dbSNP
rs1322347193 4137 dbSNP
rs34505716 4143 dbSNP
rs972826732 4145 dbSNP
rs71376092 4146 dbSNP
rs1043158380 4152 dbSNP
rs1490323010 4152 dbSNP
rs947054127 4158 dbSNP
rs1184341185 4174 dbSNP
rs1190976437 4175 dbSNP
rs72772012 4178 dbSNP
rs561308730 4180 dbSNP
rs1423953388 4183 dbSNP
rs772777571 4186 dbSNP
rs1348106722 4187 dbSNP
rs1423877506 4188 dbSNP
rs147372492 4192 dbSNP
rs1362148281 4193 dbSNP
rs928193828 4196 dbSNP
rs577410821 4197 dbSNP
rs1380161065 4201 dbSNP
rs77529526 4203 dbSNP
rs1310602610 4212 dbSNP
rs1275627530 4215 dbSNP
rs545300653 4225 dbSNP
rs1015698374 4228 dbSNP
rs772565008 4230 dbSNP
rs780875121 4231 dbSNP
rs370489233 4233 dbSNP
rs768373611 4235 dbSNP
rs142777165 4237 dbSNP
rs1293115631 4242 dbSNP
rs1241197481 4257 dbSNP
rs1483362181 4264 dbSNP
rs999937944 4272 dbSNP
rs1028306849 4273 dbSNP
rs1382813977 4283 dbSNP
rs906525711 4284 dbSNP
rs1248751112 4298 dbSNP
rs1382082068 4313 dbSNP
rs1417704847 4318 dbSNP
rs1384366321 4320 dbSNP
rs901129960 4321 dbSNP
rs1243803639 4328 dbSNP
rs1046956318 4333 dbSNP
rs148190982 4338 dbSNP
rs902991031 4341 dbSNP
rs1352105464 4343 dbSNP
rs1223630291 4348 dbSNP
rs895010765 4355 dbSNP
rs1042824954 4365 dbSNP
rs1312445900 4372 dbSNP
rs1048226964 4380 dbSNP
rs1389689504 4382 dbSNP
rs1240740425 4392 dbSNP
rs931123418 4409 dbSNP
rs1055503785 4410 dbSNP
rs367862587 4410 dbSNP
rs1426398209 4416 dbSNP
rs557079970 4422 dbSNP
rs1157813166 4423 dbSNP
rs1425523386 4430 dbSNP
rs1416395095 4440 dbSNP
rs928241898 4442 dbSNP
rs1405612333 4443 dbSNP
rs1466241519 4447 dbSNP
rs1036914188 4448 dbSNP
rs1333418956 4450 dbSNP
rs1375360944 4455 dbSNP
rs943738134 4456 dbSNP
rs1275820024 4457 dbSNP
rs1409050590 4457 dbSNP
rs912229632 4457 dbSNP
rs2242549 4458 dbSNP
rs1322364157 4461 dbSNP
rs750533405 4464 dbSNP
rs1259384301 4465 dbSNP
rs1180925653 4484 dbSNP
rs953764489 4489 dbSNP
rs1478923321 4500 dbSNP
rs1196975525 4502 dbSNP
rs574083510 4503 dbSNP
rs1172951628 4508 dbSNP
rs1269962664 4509 dbSNP
rs989666851 4512 dbSNP
rs1225380701 4526 dbSNP
rs1352125391 4527 dbSNP
rs952834847 4531 dbSNP
rs1283344334 4535 dbSNP
rs1324852687 4536 dbSNP
rs958193678 4537 dbSNP
rs1434815848 4538 dbSNP
rs1283020234 4539 dbSNP
rs1344505782 4540 dbSNP
rs1218787009 4547 dbSNP
rs975391329 4549 dbSNP
rs1336943172 4551 dbSNP
rs555769054 4552 dbSNP
rs534318282 4553 dbSNP
rs1433808219 4555 dbSNP
rs1019546046 4557 dbSNP
rs1220002110 4561 dbSNP
rs747874749 4561 dbSNP
rs143874929 4573 dbSNP
rs1021900221 4579 dbSNP
rs372266248 4579 dbSNP
rs558212776 4579 dbSNP
rs1406759108 4580 dbSNP
rs1416653757 4582 dbSNP
rs1358546699 4584 dbSNP
rs1423243888 4585 dbSNP
rs1024917361 4590 dbSNP
rs1302926447 4595 dbSNP
rs1361503136 4602 dbSNP
rs1402223540 4608 dbSNP
rs1319953496 4616 dbSNP
rs1012172524 4619 dbSNP
rs1297707181 4620 dbSNP
rs1324287905 4629 dbSNP
rs1226119806 4631 dbSNP
rs1401339518 4634 dbSNP
rs764224357 4636 dbSNP
rs1243595578 4637 dbSNP
rs1449840751 4638 dbSNP
rs756316568 4639 dbSNP
rs1205602940 4640 dbSNP
rs753021112 4644 dbSNP
rs1290777890 4645 dbSNP
rs1048424841 4648 dbSNP
rs1265949547 4649 dbSNP
rs767970254 4650 dbSNP
rs115195346 4653 dbSNP
rs1273794768 4661 dbSNP
rs1218518653 4663 dbSNP
rs1055513863 4666 dbSNP
rs896977101 4667 dbSNP
rs1188362889 4677 dbSNP
rs568702510 4678 dbSNP
rs762461340 4681 dbSNP
rs757308358 4682 dbSNP
rs772670393 4689 dbSNP
rs764285909 4690 dbSNP
rs769356338 4690 dbSNP
rs149529195 4697 dbSNP
rs768566847 4698 dbSNP
rs746791674 4700 dbSNP
rs113667224 4701 dbSNP
rs758347098 4705 dbSNP
rs145505544 4709 dbSNP
rs756122406 4710 dbSNP
rs1334252862 4716 dbSNP
rs1242721939 4718 dbSNP
rs764375446 4724 dbSNP
rs199752132 4730 dbSNP
rs751862398 4734 dbSNP
rs766875173 4735 dbSNP
rs1461531096 4736 dbSNP
rs1277442569 4737 dbSNP
rs763403240 4739 dbSNP
rs773572276 4740 dbSNP
rs1258689018 4741 dbSNP
rs764843752 4744 dbSNP
rs769211342 4753 dbSNP
rs776407200 4758 dbSNP
rs1258510512 4759 dbSNP
rs1339159334 4760 dbSNP
rs1453794285 4766 dbSNP
rs1358904937 4767 dbSNP
rs1332460597 4769 dbSNP
rs768140376 4770 dbSNP
rs149701021 4774 dbSNP
rs761000142 4775 dbSNP
rs1448853511 4780 dbSNP
rs1388227616 4781 dbSNP
rs772155686 4782 dbSNP
rs745846240 4783 dbSNP
rs778681567 4784 dbSNP
rs1207603681 4785 dbSNP
rs112999816 4786 dbSNP
rs140789717 4787 dbSNP
rs146413415 4788 dbSNP
rs1203781203 4789 dbSNP
rs781487785 4791 dbSNP
rs1317809527 4798 dbSNP
rs1209834920 4804 dbSNP
rs755125529 4808 dbSNP
rs914328780 4813 dbSNP
rs1282723230 4818 dbSNP
rs751944339 4821 dbSNP
rs780448164 4822 dbSNP
rs376561783 4824 dbSNP
rs1875184 4825 dbSNP
rs1367486637 4827 dbSNP
rs191562149 4833 dbSNP
rs1265270356 4834 dbSNP
rs1424265284 4837 dbSNP
rs187644296 4839 dbSNP
rs1179887800 4843 dbSNP
rs753223174 4845 dbSNP
rs377591580 4846 dbSNP
rs1180951826 4848 dbSNP
rs1481798046 4852 dbSNP
rs1293246149 4854 dbSNP
rs763873926 4856 dbSNP
rs182768107 4857 dbSNP
rs760933374 4858 dbSNP
rs878895293 4858 dbSNP
rs544941741 4860 dbSNP
rs1394432795 4863 dbSNP
rs376557282 4864 dbSNP
rs1288000802 4867 dbSNP
rs759244620 4868 dbSNP
rs774403210 4869 dbSNP
rs1361697784 4870 dbSNP
rs751402120 4872 dbSNP
rs770713830 4873 dbSNP
rs1349205951 4874 dbSNP
rs748264006 4877 dbSNP
rs1402260686 4880 dbSNP
rs564766108 4881 dbSNP
rs769170292 4881 dbSNP
rs781091185 4883 dbSNP
rs768701330 4885 dbSNP
rs535850378 4886 dbSNP
rs5815842 4886 dbSNP
rs761233140 4886 dbSNP
rs769713915 4886 dbSNP
rs773153750 4886 dbSNP
rs776191750 4886 dbSNP
rs746630375 4889 dbSNP
rs1471365595 4894 dbSNP
rs747272561 4895 dbSNP
rs780252094 4896 dbSNP
rs368583753 4898 dbSNP
rs1245457654 4900 dbSNP
rs1218512799 4901 dbSNP
rs1330273573 4904 dbSNP
rs1267833673 4908 dbSNP
rs1226800337 4909 dbSNP
rs758822191 4914 dbSNP
rs1278933981 4917 dbSNP
rs1302129458 4920 dbSNP
rs1202521571 4923 dbSNP
rs779481499 4925 dbSNP
rs772589716 4927 dbSNP
rs1291735978 4930 dbSNP
rs1432734836 4933 dbSNP
rs757668972 4937 dbSNP
rs753413924 4942 dbSNP
rs763742608 4943 dbSNP
rs760229510 4946 dbSNP
rs1176209843 4950 dbSNP
rs1432127297 4951 dbSNP
rs1422388785 4955 dbSNP
rs752462194 4962 dbSNP
rs1465691872 4965 dbSNP
rs1247868069 4970 dbSNP
rs767264034 4972 dbSNP
rs759387362 4974 dbSNP
rs1256840634 4975 dbSNP
rs574348179 4976 dbSNP
rs745665629 4978 dbSNP