miRTarBase - #MIRT636516 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FMN1   
Synonyms FMN, LD
Description formin 1
Transcript NM_001103184   
Expression
Putative miRNA Targets on FMN1
3'UTR of FMN1
(miRNA target sites are highlighted)
>FMN1|NM_001103184|3'UTR
   1 GATGAAGACACATGGAAATGATGGCACTGGAGGTGGAGGACCTTGCACGCATACTCTTTGTGACCACAGGGTTGCAGGAC
  81 GTTCTTGAAAGATGTGTCACTAAATGTTTGTTTTTGCTCATCTCTTTCTGAGGTCATCTGCAGAGAGTGCCCCATGCCTT
 161 CTTTAAGAAGTCCCTCATTAAGCCGCAGGAACAATGGAAAACTATTTAAGGGAACATTGCAGAAATATTTGATGACTGTT
 241 TCTTGTGGAAGCCCAAAGTCCACTCTAAGAGCAGAAGAAATACCAAAATGTTTCCAAAATTTTTTTAAAAGCTGAGATTT
 321 CCAGCTTTATAACCAAAGCTTGATATATGTCACATTGTCACAGAAGAGAGAAAAGATCATTGAGGACAGTTGCCTTGGGA
 401 GAGTTCAAGTCTTTGTCGTTACACACTGCTGTTTTGATTATTGGTCTTAGTTTTGATCCTGTTGCAGCAAAATCCTGCAG
 481 CATCTTTCTCTCCAATAATGTTGCAACTCACCAAAACTATTCTTGAAGAGGTCCAAGAACATGTATTATCCAGACTAAAA
 561 AAATGATTTTTTGTTGTTATGGTTTACGTGATGAAAAGGAGAAAAAACAGAATCATACCTGGGTGGAGAGAGGGAGACAA
 641 ATAGCCATAAACTTCATCCTGGAGAACAAGTTACCATGCAAGGAGTTGACATCAGTTGTTAAGTGAGGCCCATTCTTGTT
 721 TTTACATCGGTCCTTTGTGGTTTTTCTGGGCCAGCAGAGATTCTGCACCCCAACTCCCAGGAGAAAATGTAATACCTGAG
 801 CAAGCACAGCCTTGGGTGTGCTTGGACAAGAGACCCAGCGGCAGAGCACCTTTTACATTTTGGACCGTTCATGAATGGGC
 881 AATGTTGTGTTGATACGCAGCCGAGTTCTACGTTATGTGCTGTGACTGTGCAGCTGGACGACCCCCATCCCCAGGAGGCA
 961 GTTTCCAGACAGGAGAGCAAATGCAACTCACAGCACCTGCTCATGACCTTGGCTGATAGGCATGTGAAGTAGGATGAAGC
1041 AGGACTCTTTAATGTCAAAAAAACTGAAGGGCAGAAAAAAGGTTCCTTACATCAAAATGAAAGTAATTACATTAATAGAA
1121 AACTTCCAAGTGGAATATTGTTCACAGGCAGCTCTTTCTGACCCTGGCTCTTGAGTCACATAAGGAAACCACCTTTGACC
1201 TCTCTGACACTTTTGTCTTTAAGCCACGTCTCTGAAATCTTGTGAGGGGTGAAGAAAGAGGACTGGAGATGAATGGACAA
1281 TATGATCAAAGACTCATTTTTAGGCCTTGAAGAGGCCGAGCTTTCTCCCCCCAATTGGTGGAGGACAGTCCAGAGATGAG
1361 CAGAAATCTTAAATTCCTTCCTGATCCAGCCTCCACATGTGGCCTGCCCCTTGCCCCAGCATCTTTCCAGAACCCCTGGA
1441 CTTGCCAGGTGCCTGAGCATCTTCCCAGGATATGCCTGCCAGCCAGCAGCCCCTCAGGAATGCTTCTATAATAGATCCAG
1521 TAATGAAAGCAGCACCATATCCTAATCTAATGTCAGCTTCGAGAATGAAGACTGCAGTCAGGATCAAATCAAGTCACAGA
1601 AGCCATATTCATGCAGGTGCTAACCGCCTTTTCTACTGGTGCAACTGAAAGGAATATGGTAACATGGTTGGATTTTTAAA
1681 ATTCACAATGAAGGAACGAGACAAGCAAAACAGAAAAGCCGAGAAGGAACATGCATGACTAAAAAGGCTTGAAGTTGCTT
1761 GTGAGCAAGAAGCTTTTTATGCTGCTTTCTTACATAGTTTCTCTTCATTTTCACTTAACTCTGAAGACAACCAAAAGAAC
1841 GGATCAATTAAAAACTGATTCCACTTATAACCATTGTATGCTCCTTCTAGTGTTATCATGCACAAGAAAAGTGCCAGTTT
1921 TACCCATGCCATATAATTCAGCTCTTTTGAGTTATGTGGGGCCAGCAGAAGTCTCAATCCTTATAGGCTTGATGGTGAGA
2001 GCAGCGGGAGGTTTGAGGTGTACTCATTGCAGTCCACTTTGGTCTGTAAGTAGGATGCTTACGAGAAATCAGTGAAGGTA
2081 AGCAGGGCTGCCACTGTGGCCACGTAACCCTTCAGGAACCAGTGCTGAAGAATAATGAGTGAGAACACTTAATTTGAGAG
2161 TTAGACAAATACAGCCCACTTTGGATTTCATCCTAGTGAACAGACTAAAACTTTGCAGTAAAATACCTATTTCTACAAAG
2241 CAAGGTTTGCCTGCCTCGGTTGGGGAAACCTAGTGGTTTTGTCACACTAGTCGATGTATGATGTTAGTGTTGTAAGACAC
2321 CATGGCAGAATCTTCATTATTCTCACCTATTCTGAACCCTGCATCATGTATCTGGGATGCCCCCTCCCAAGTCCACCAAT
2401 GTACCACGTTGCTGACACAGCCTTCATTTTTAACTCAAATTGATGCTCAGTAAAGGTCAATGACAATTTGTTCAAGGAAG
2481 TTCATCTAAAATAATCTGGAGGCCTTGAAAATGATCCCTCTAAAATGCTGTTGAGCTTGTGTTCAGTGTAGCAGGAGGAT
2561 CTGAACTTTTCCTGGAGAGGAGGTGATCGGGATGCCATTTGGCAGCTTAAGCACATCCTGCCAGCAGGCTTTAAGTGGCT
2641 GTTCTAGGCATAGCCCTCCCTGAACTAGAAAGGAGAGTAACCAGTTTGCTATGCTGCATCTAACCAGACACACCTGACTT
2721 AGTAGTAACTCTAAGAACCCTTAACTTACAAACAACTTTGTCTCCTCTTAGACAATATTCATTAAATCTGAGGACACAGT
2801 TTGACAGTAGTTCAGATTCTTGCATGAGCAATTGACAGCATCAGAGCACACAATATCATAAGTTACATAAATTACACAAA
2881 GTACATCATAAATTACACTACAGACACGTTAGGTAAAAAGCATCAGGCCCGGGCCGGGCGTGGTGGCTCATGCCTATAAT
2961 CCCAGCACTTTGGGAGGCCAAGCGGGGGCGGATCACGAGGTCAGGAGATTGAGACCATCCTGGCTAACACGGTGAAACCC
3041 CATCTCTACTAAAAATACAAAAAATTAGCCGGGCGTGGTGGTGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCA
3121 GGAGAATGGCGTGAACCCAGGAGGTGGAGCTTGCAGCTAGCCGAGATAGCACCACTGCACTCCAGCCTGGGCGACAGTGA
3201 GACTCCGTTTCAAAAAAAAAAGCATCAGGCCCATGAAGTATCAAAAACCAGGTTAGGAGGTGTGCTGTATGGCTTTTATC
3281 TCAATAAGTGGCAGCTTACTGGGGAAAAAGAAATAAGAAAAAGTGTGGCCAAGCAGAAGTGGATGTTTATGATGACGGTG
3361 GGGGCCCAGAGGTCATAGGTGATGGTCCTACTGCCCAACAGTTGCCTTTTGAATCCTTATGTTGATGATGGTGTCTTTCT
3441 ACACACTCACTGCAACTACTCAGGAATTATAAAGATTTTCTGAAATCTGAGAAGTGGAATAAGGAAACCCAGTGGAGCTA
3521 TTACACTTTTAAATGTTCTAGCCAAAACAAATTGCCAGTATGGTTGAGGAATTGAATATCAGATGGCATGCAGTCTCCCC
3601 TCCCCTCCCCTATCAAGGACAGTAGAAGCTGCAAACCTCTTCTCAGCCTCCTTCAGGCACCTCCTGTTTTCATAAGCACC
3681 ATGAAGAATGGTGTTTCCTAAATGAAAAGTTCAGATACTGCTGGTAAAGAAACTGGAAAAACTGAAGGAAGGAATAAAAT
3761 ATGTTGGTGGTATTAACACCTCCAGTAAGATAAGTCATTGGTACGGTTTTTCTAAGGGCCGCAGTGAGATGTAGCAGAAG
3841 AAATATGTTTATTTTGGGCAAAGATTTGCTTATTGGCCTGGGATTGCACATTTTCTCTATGATGTTTGCAACAGAGAAAT
3921 TTTCATTTTAATGATACTCTTCCTTTCTTGAAAGTTACATGTCCTCATTTCTGTTTCTGCTTCTCCCTTGGCCAGTGTCA
4001 TTGATGCAGATCATTGCATACAACAGCACAGCAAATTGCGCCAAGTCAGTGTGTGAATGGGAATTAGCAATGCACGCTTG
4081 CAGGCTCTTTTTCCAGGAACCAGGCTGTAACATTGACCGGGGAACCTCTTCATTCCCTGACATACTAAATTGGTCAATTT
4161 TGTAGTACTCATCTCCATCCACAAAAACAACAAAGATAAAATCAATTTGGAGCTTTATATGACAAAAAGGAAGAAGTCCA
4241 AAAATATATAGCCTTCCCCCCTCCCACATATCTGATCCAAATATTAAATATCTGATTTTATAAAACAGTTTAAATTGTCT
4321 TTTTAAATTGCTAACAAGCATCAGTTATATTTGAGCTTCATTTTTCTTTTATCCTGTCTGTCCTAATAAAAACAAAAATG
4401 GCCAAAAAGTGGAGAGGAAAGAAAAAGCTTCCACTTTTTAAAATTTGTTTTGTATTAGTTATTTTACCTTTAGGGACCCT
4481 ACAACTGAAGAGAGTGGAGAGAATAAAGAAGTGAACTTTCATTCATGTCTGCTACTTTGACCTCATAAAGAAATCTGCAA
4561 CACAGATGAAACCAGTCTGTGTGGCCAAGCTGATGGGATTTGAAAAGAGTGGATAATTTTTAGCCTTTCCAAAATGCAAA
4641 TAACTTGGATATATTTCCATTTTCCAGCTATAGAGAGAAACAATCCAGCTGCCTGGAAACTGTTATTAGTATAGAAGTGG
4721 CTTAAAGAAAAGCATCTTCAAATACTTGACTTAGCATATCTTTCTTCTTTAGACTTACATAATGATATTCATCTCTCCAT
4801 TAGCAATTGAATCCAGGCATAACCGGGCTCAGTTACACAGCTTGTCTGTGACTGGGAAGCCCATTTTGTGTCATTTCTGC
4881 ACACCTGTCCGCTGTTGACACCTTATTAGAGGCACTGCATTTTGGTTTCACAATTCTTCATCTCCCTTCCCAAGGAATGG
4961 GCAATCTACTGAACTTCCAGATCAATGCTTTGTTGGAAAGTGATGAATTTAAGAGAGTTTTAACATGTCAAATTTGAAGC
5041 CAATTCAGTATCCTTATTTGTTCCAAGACTCTTAACCAATACTGTGATATAAAGTTAGGATTTGGGAAACGTGTAGTTAA
5121 CAACTTGGAAACATGAAGATATTAAAATGGCAGCTGGCTAACTGTCTCTTAAGCCACTATGCAATTTCTACCAATGGAGA
5201 GATTAGGGAAGCAAATTAAGCCTCATTCAGTAGGTCTGCTGTCTGGTGGAACTTACGGAACTCATTTCCTCCTCTATCCC
5281 CAGCCCTTCTCCTAACTATGGTGATAACCAGGGCCATAGAAGACCTTTTCTCTCTTACCTTTCTCTGATAGGATCGTGTC
5361 CTTCAGTCAAGAGCTCATGTGAACTCCAGACTTTATATTACATCTCTGAAGTTCTTGATGTGGGGAAGATTGACTTTTAT
5441 TCCATTTTTATATGAAGGTGTTAGATATAGCCATCAATTTATTTTTCTACATTCCCTCTACGCTTATGTAATTTTCTATT
5521 TTTAAATCTTCTCTTAAATATACTGAGAATCTCTAGTCTCCTTTTCTAAAGGCTGATCCAACTACACTTGTGGGCTATTT
5601 TTCCAAGCTTTGTGTGAAACTTGATGACATTGGGCCAGCAAAATGCAAAGAAGACTATAGTTTCAGGCAGAAAATCACGT
5681 CCAAAGAATTTGGCATGGATTAAACAACCTCTACCACACTATAGCTCTCACATAGGCTGAACATTTTCCTAAATTCTACC
5761 TGTGCAGACACTGAGGGGCTCTCTACCTTTGAAACTATGAGAACGTCTTAAATTAATATGAATATTTCTCTCCATGTATA
5841 GTGTGAGCTGCCAATGCATTATCTTAATACATCAAGAAGGAAATCAGATTTCAGGCACACATTAGCAATTGTTTGTTAAT
5921 GTCCTTGGCAAACGTGTACCTGCTTTCCTTCATTGTTCTCTTCAGGGGCTTTCTTCCACTTTCCTCTTATGAAACGAATG
6001 TGTTTTTGACTGTTAACTGGGTTCGCTTTCCAGATCTGTCTTTCCCAAATGAAAGGTTAGTCCCATAGACCACTGGCTAT
6081 TCAGGGAAATTACTCTCTACCTCCCCATGACATGGATGATAAGTGTTGAGGGATGAACACTCTGGAAACTCTTAGCATGG
6161 ATTTTGAATTCCAGATTTCTTTATAGGAGATGTATAAAAAGGAGTTTATAGCATACAAAAATTATACTGCTCTTCCCAGT
6241 AAGGGACTAAAAGGACATTTGAAATCTTTACATTTTAGATGTTTTTGTGAATTATAAATATCTCCTTTTTCCTCGCTTCA
6321 TGCTAACTTGTCTCTAGATAAAATCTTATTTCTTCATACATTGGACCACAAGGCATAAAGAAGGTAGCTCAGCGCCACTG
6401 AGATTGTGTTCTGCATAATATTTGGAAGGCTTCCATTTCCATTGAAAACAAATCCATGAGTGAGAGGGAAAGTCTAGTAT
6481 CAATTCTTCTGTTTGCTCGCAATGACACAAATAGGTTTTGGGGATCTACCTAAGGGATAGGTCTACTCCAAAATTATTAA
6561 ATTTATAATTGTGCAATTCTGTAATTTCCCAAGGCATAAGTAATATGACCCTACTGTCAGCTAGATGTCTTATCTTCAAA
6641 GAGAGTATGCATTAATAAAAAGAACTTCCCTTTAAAGAACCAATCTAAAATACTAAAAAGGCAGAAACTTTTAAAATTAG
6721 AAATTGGATAATTTTTAAGAATCTTTAGAGAAAACATTGGTTTATCATAGTCTTTTTCTTTCATTGAGTTTTCATTTAGA
6801 CTAGCATGGCAAGCAGGGTGGCCTTGGACTTTGATTTAGGGGATCGTGCTTTGGCCTGGAAAATAAGCACTGGCCTGCAT
6881 GCCTAGAACCTGAGTGAAGGCAGTCAACATCCTAGTATGAATCAGACCTAGCAGAAATGTAAATTATTTCAAGTACTTCA
6961 GGGTTTAGTTTTCTTAGTGACACCCTGGACCCTGGATGCTGCTTTCTAAAGTGCACCTGATCCATGCAGTTTTATGTCTT
7041 CATATAACTGGTATCTTGTGAGTTTGCAAGCAATGGGATGAGCAAGAAAAAAAGGACGCATGGAGGAGAAAAATTTGAAC
7121 GAGGCTAGTGCAATGTTTTGCTGATAGATTACATTGTTAGGGAGCTGGTGATTTTTTGCCATGGTCGTATCGTGGACAGC
7201 TTTTCCGTGGAAATTCAAGGCATCTGTATTAGGCAAATGTGAGTGCCCTTGATCTTGTATTGATCAGTGCCAATGTACTG
7281 GGAAAGCAGGTACCCCAGTGAAACTGGTCTGTGCTTGGTTTAACAGCTCCAACAATTTCAGATCCATGGGGCTGCTTGAC
7361 CATAGACCCTGTTTACTCCATGCCTGTTCAAAAGTCATTTTGACTTCTAGCTTTGTTTCACTTTCTTCTTTCAATACTTC
7441 TGTTTCCTCGTCCTTTTCCTTCATATTCCATGGCTATTTCTTTCCTACTTTACAGTTTCCCCCAGACCCAGATTTTTTCA
7521 CACCTCTGCATCATAGACAACTGAGTAGCTCCCTTGGCCCCTCCTCCATCCTCTCACACCCTGTGCTCCGTTCCTCAGCC
7601 GTTTGGACAGGGAGCTCCGCTGTCACCAAGGAGCCCATGTGAGACACACTGCTGTGACTGCCTCTTGTTAATGTCAGCAT
7681 CACCTCATCACTTAAGCAAAAAGGAAAATCCATAAAAGAGATGGAAAATACGTCTCTTTTTATTTTATTTTAAGAAGATT
7761 GGGCGGGGTGGGGGGGGGGTTCTTATTCTAGGCCTTCTCAATTTCTCATAGATTTTACCTTAAACTAATTAAGGCCATTC
7841 TCTTGATAAATTTGTACATCAGACCGGGTCACCAGCTATGATGCAGAACGCCAGATTTTTGAATCTCAAGTAACTTTCTG
7921 TGGTGCTGGACAAATTGACTTAATTCTGTGCAGGCAAACACTTTGAATCATAAGGATTTTTATTGCCGCTCCATTCTTAC
8001 TACTATTCATGATTCAAACATCTACCCCTGTTCTGAATCAGGATGTTGACACTTCTTGGTTATTTTCAGATGAACAGTAA
8081 CTGCTACACTCTTGAAAGCACTTAAAAGTGCAAGCATGTCCTAAATAGCCATTTAACCTGGTAAAACATAGGCTTTTCTG
8161 TTTAATTAAGTATTAGACCAGTCTGTAGATATAATCTGAAAAGATTGTAGGCAGTAATGAAGACAGTTGGGGAAAGGAGA
8241 AGGCCCTTTAAAGACATGAAACCTTACACGCTCTTGGGATATTTTTAAGCATAATAAGCTCATTGGATTCAGGTATTTTT
8321 CCCTTTGCATTTTTAAAAATACGTATTTCTAATTTGTTTGCATATTTAATTTTGTCAAAGCTGAGAAATGCTCATGAGTT
8401 GAATTTATAAATGTCATTTGCAACCAAATGAAGTATTTATTTTTAAAAAGAGAGTGAAGGAACCAACACTGATTTGTACA
8481 TAATAAAAATGTGTGTATTATATATATATATTTTTTCCTCCTTGACAGTACTTGGTCACAATATCAAGTGTATTTTTGTA
8561 CATAATATATATTGATTAGAAAAACGTCAATTGTCTATTCAAAAAATTCTATCTCTGTGATAGATTATATTTATCCTAAT
8641 CTGTTGATACCTCTGTTAATTTGTTTTAAGAGAATTATATTTTTTGGAATTTACAGAGAATTGCATTCATGGCTTTCAAT
8721 TGTAAATATGCTAAGGGTATTTTAATAAATCTTGGTTTCATGTCCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:||||| |   :|||||| 
Target 5' atAGCACCACT---GCACTCCa 3'
3166 - 3184 145.00 -19.20
2
miRNA  3' guUUGU-GGUAACAGUGUGAGGu 5'
            |||| : | || :||||||: 
Target 5' tgAACAGTAACTGCTACACTCTt 3'
8071 - 8093 144.00 -13.90
3
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               |||||||| |::|||| 
Target 5' ttataACCATTGT-ATGCTCCt 3'
1865 - 1885 140.00 -16.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
194719 1 ClinVar
COSN28796249 33 COSMIC
COSN8865226 33 COSMIC
COSN13614412 48 COSMIC
COSN30504193 49 COSMIC
COSN30170873 59 COSMIC
COSN31572922 69 COSMIC
COSN30501582 81 COSMIC
COSN31496304 81 COSMIC
COSN19735928 134 COSMIC
COSN31531960 157 COSMIC
COSN31558641 161 COSMIC
COSN28793494 184 COSMIC
COSN27153975 329 COSMIC
COSN21212676 537 COSMIC
COSN28834471 587 COSMIC
COSN19266136 768 COSMIC
COSN8741993 2290 COSMIC
COSN142501 2716 COSMIC
COSN20605342 3046 COSMIC
COSN27629638 3087 COSMIC
COSN8172556 3162 COSMIC
COSN23810828 3720 COSMIC
COSN21167436 4152 COSMIC
COSN19263584 4746 COSMIC
COSN26838143 4753 COSMIC
COSN23936703 4890 COSMIC
COSN22223366 5664 COSMIC
COSN28834641 5820 COSMIC
COSN7042944 6190 COSMIC
COSN1673449 6313 COSMIC
COSN1673448 6315 COSMIC
COSN6543943 6719 COSMIC
COSN1673447 6864 COSMIC
COSN1673446 7194 COSMIC
COSN23762636 7450 COSMIC
COSN6641306 7548 COSMIC
COSN22928333 7558 COSMIC
COSN16847416 7573 COSMIC
COSN25477398 7618 COSMIC
COSN23869999 7883 COSMIC
COSN25793236 8413 COSMIC
rs3817591 8736 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs114851360 1 dbSNP
rs754876496 1 dbSNP
rs751444610 2 dbSNP
rs766095623 8 dbSNP
rs762757973 12 dbSNP
rs1312010765 21 dbSNP
rs749937524 23 dbSNP
rs764596462 24 dbSNP
rs751429560 25 dbSNP
rs1351211283 26 dbSNP
rs1165053712 27 dbSNP
rs761392162 29 dbSNP
rs1410988274 31 dbSNP
rs567906972 32 dbSNP
rs16958712 33 dbSNP
rs759876759 35 dbSNP
rs1191185481 37 dbSNP
rs1339766760 40 dbSNP
rs1041486487 45 dbSNP
rs1489352162 48 dbSNP
rs369575483 49 dbSNP
rs1484005256 50 dbSNP
rs1179771851 51 dbSNP
rs993951400 54 dbSNP
rs190125218 56 dbSNP
rs1394304180 58 dbSNP
rs563811078 60 dbSNP
rs545800068 70 dbSNP
rs1463300058 72 dbSNP
rs1415552594 73 dbSNP
rs1449421170 77 dbSNP
rs1174615897 85 dbSNP
rs1361267834 87 dbSNP
rs1175163124 95 dbSNP
rs1464678917 96 dbSNP
rs527253130 100 dbSNP
rs1050026926 101 dbSNP
rs1385752239 101 dbSNP
rs1179895147 106 dbSNP
rs1299706049 116 dbSNP
rs941481801 117 dbSNP
rs947652295 120 dbSNP
rs1301648793 121 dbSNP
rs1313799403 123 dbSNP
rs927389856 125 dbSNP
rs1255093214 140 dbSNP
rs1464942011 141 dbSNP
rs1210009108 146 dbSNP
rs1044364571 147 dbSNP
rs559999401 150 dbSNP
rs1194815237 151 dbSNP
rs956207249 152 dbSNP
rs1431864097 154 dbSNP
rs917497874 167 dbSNP
rs989104363 170 dbSNP
rs956176930 173 dbSNP
rs16958710 184 dbSNP
rs574210140 185 dbSNP
rs1438733949 186 dbSNP
rs555975407 187 dbSNP
rs780500629 190 dbSNP
rs544004703 193 dbSNP
rs1369426622 197 dbSNP
rs1217313953 204 dbSNP
rs1300362575 206 dbSNP
rs576623451 216 dbSNP
rs767620870 217 dbSNP
rs955073482 219 dbSNP
rs1464093314 220 dbSNP
rs1222941005 222 dbSNP
rs543458849 225 dbSNP
rs1487695341 231 dbSNP
rs951974709 235 dbSNP
rs1253028539 237 dbSNP
rs200392737 238 dbSNP
rs896979561 241 dbSNP
rs1157291268 242 dbSNP
rs1411325683 246 dbSNP
rs1038175986 253 dbSNP
rs1462069624 261 dbSNP
rs1005801486 268 dbSNP
rs1351500051 272 dbSNP
rs768225478 272 dbSNP
rs558240018 273 dbSNP
rs1434261185 276 dbSNP
rs1325153099 277 dbSNP
rs1292666372 281 dbSNP
rs1350903036 284 dbSNP
rs1158822818 289 dbSNP
rs769022179 296 dbSNP
rs1286140472 311 dbSNP
rs1327829018 315 dbSNP
rs75798403 316 dbSNP
rs993330960 320 dbSNP
rs901640887 325 dbSNP
rs1408184277 327 dbSNP
rs1159953420 329 dbSNP
rs1041146318 336 dbSNP
rs565935910 339 dbSNP
rs1194237575 342 dbSNP
rs950029602 346 dbSNP
rs1489415425 357 dbSNP
rs185611437 358 dbSNP
rs535373596 361 dbSNP
rs1183636245 374 dbSNP
rs1050219680 377 dbSNP
rs1403483018 378 dbSNP
rs1162919845 382 dbSNP
rs947385401 405 dbSNP
rs914867208 408 dbSNP
rs1053353509 409 dbSNP
rs1349439169 415 dbSNP
rs1448339724 417 dbSNP
rs770370739 418 dbSNP
rs536316851 422 dbSNP
rs1053261678 425 dbSNP
rs567945573 426 dbSNP
rs926215297 429 dbSNP
rs934838536 434 dbSNP
rs549589784 436 dbSNP
rs943538633 444 dbSNP
rs1344730590 445 dbSNP
rs1203397777 450 dbSNP
rs910963738 453 dbSNP
rs1274415508 459 dbSNP
rs879117351 461 dbSNP
rs1212533267 474 dbSNP
rs970239410 476 dbSNP
rs745345244 483 dbSNP
rs1390760796 490 dbSNP
rs182224795 493 dbSNP
rs984902786 494 dbSNP
rs1232224103 507 dbSNP
rs951652446 512 dbSNP
rs1356901431 514 dbSNP
rs746840147 519 dbSNP
rs773004586 521 dbSNP
rs1347300948 522 dbSNP
rs1297726139 523 dbSNP
rs10519747 541 dbSNP
rs1226845863 544 dbSNP
rs1297254504 548 dbSNP
rs188167136 551 dbSNP
rs1221494262 555 dbSNP
rs1029312987 557 dbSNP
rs1209381560 559 dbSNP
rs1250012121 564 dbSNP
rs34796530 564 dbSNP
rs972384737 566 dbSNP
rs961240679 570 dbSNP
rs1431865661 575 dbSNP
rs1017273010 576 dbSNP
rs1005376992 580 dbSNP
rs201304971 582 dbSNP
rs1422561781 587 dbSNP
rs1468999159 587 dbSNP
rs571606143 588 dbSNP
rs559876584 594 dbSNP
rs550093706 598 dbSNP
rs1433516238 599 dbSNP
rs1318327018 608 dbSNP
rs1432453444 608 dbSNP
rs1332005898 610 dbSNP
rs548097833 616 dbSNP
rs1235946172 627 dbSNP
rs1273463962 628 dbSNP
rs1014379976 632 dbSNP
rs895919280 635 dbSNP
rs1173711525 636 dbSNP
rs529635601 640 dbSNP
rs1229247599 645 dbSNP
rs1053086334 647 dbSNP
rs1049837533 648 dbSNP
rs1011537614 650 dbSNP
rs1185740455 658 dbSNP
rs555471859 662 dbSNP
rs893105518 676 dbSNP
rs142793988 684 dbSNP
rs1265025490 685 dbSNP
rs934649663 695 dbSNP
rs16958702 701 dbSNP
rs1281216552 702 dbSNP
rs1212254729 703 dbSNP
rs1479874918 705 dbSNP
rs754497728 707 dbSNP
rs1159523175 709 dbSNP
rs1306287726 712 dbSNP
rs1455227353 718 dbSNP
rs544037929 723 dbSNP
rs1295441043 725 dbSNP
rs907434217 726 dbSNP
rs1046354381 727 dbSNP
rs1043734941 728 dbSNP
rs1291801950 729 dbSNP
rs948911893 731 dbSNP
rs576661995 732 dbSNP
rs910734000 734 dbSNP
rs930307268 737 dbSNP
rs1374400594 751 dbSNP
rs1266144326 755 dbSNP
rs1356881205 759 dbSNP
rs1211583658 760 dbSNP
rs1287455762 761 dbSNP
rs1490145433 762 dbSNP
rs918901129 763 dbSNP
rs985162493 764 dbSNP
rs1467087570 770 dbSNP
rs1471416374 773 dbSNP
rs971703969 776 dbSNP
rs777666041 781 dbSNP
rs1459844748 791 dbSNP
rs965982250 791 dbSNP
rs1162035168 795 dbSNP
rs1169705672 801 dbSNP
rs1018856850 808 dbSNP
rs986410088 809 dbSNP
rs953202754 810 dbSNP
rs564616103 811 dbSNP
rs1313458726 812 dbSNP
rs1342403373 813 dbSNP
rs972338830 816 dbSNP
rs545974078 819 dbSNP
rs961369938 820 dbSNP
rs1185532034 824 dbSNP
rs752582967 825 dbSNP
rs1011588407 827 dbSNP
rs141206003 828 dbSNP
rs969906719 839 dbSNP
rs553859135 840 dbSNP
rs907486873 841 dbSNP
rs1425105776 843 dbSNP
rs535812818 847 dbSNP
rs1183698643 864 dbSNP
rs2037844 866 dbSNP
rs895866034 867 dbSNP
rs1369113248 868 dbSNP
rs62001261 870 dbSNP
rs200387788 871 dbSNP
rs1250806953 874 dbSNP
rs58065892 879 dbSNP
rs537656032 880 dbSNP
rs904558815 881 dbSNP
rs1404408997 882 dbSNP
rs761965825 889 dbSNP
rs1320616639 896 dbSNP
rs892649462 896 dbSNP
rs751801010 897 dbSNP
rs1232993426 903 dbSNP
rs930402126 904 dbSNP
rs1305609139 908 dbSNP
rs1226233004 909 dbSNP
rs889387976 910 dbSNP
rs1051855606 911 dbSNP
rs2037843 912 dbSNP
rs1370606156 916 dbSNP
rs552282411 928 dbSNP
rs1191119016 933 dbSNP
rs1036781476 940 dbSNP
rs971759388 943 dbSNP
rs1379542929 949 dbSNP
rs1466141483 950 dbSNP
rs1336083904 952 dbSNP
rs1389481336 953 dbSNP
rs1435703602 954 dbSNP
rs1322544033 968 dbSNP
rs1359564463 969 dbSNP
rs944386845 973 dbSNP
rs1301745597 976 dbSNP
rs1313518003 978 dbSNP
rs939684186 980 dbSNP
rs1221318647 984 dbSNP
rs909570026 999 dbSNP
rs983819587 1000 dbSNP
rs11858058 1008 dbSNP
rs1162550148 1011 dbSNP
rs970357224 1012 dbSNP
rs1460689161 1016 dbSNP
rs533627625 1020 dbSNP
rs1211096147 1022 dbSNP
rs986034275 1028 dbSNP
rs566530819 1032 dbSNP
rs992625780 1033 dbSNP
rs1189934574 1038 dbSNP
rs1417540455 1040 dbSNP
rs959893261 1048 dbSNP
rs1177787346 1064 dbSNP
rs1192094510 1064 dbSNP
rs563481124 1066 dbSNP
rs183593001 1069 dbSNP
rs1412788846 1081 dbSNP
rs1458921382 1082 dbSNP
rs998961901 1107 dbSNP
rs1335970402 1111 dbSNP
rs1267584266 1112 dbSNP
rs1343313223 1115 dbSNP
rs1246611662 1117 dbSNP
rs1293840288 1119 dbSNP
rs968735343 1122 dbSNP
rs1305684445 1126 dbSNP
rs1031712889 1127 dbSNP
rs998814083 1140 dbSNP
rs1281568290 1148 dbSNP
rs1316771733 1151 dbSNP
rs1379057952 1154 dbSNP
rs1267588663 1163 dbSNP
rs775970743 1167 dbSNP
rs1252872087 1173 dbSNP
rs1473708030 1175 dbSNP
rs1175515094 1178 dbSNP
rs529672591 1179 dbSNP
rs1407369963 1180 dbSNP
rs1007576422 1181 dbSNP
rs1440048002 1184 dbSNP
rs1013143288 1192 dbSNP
rs1391255481 1194 dbSNP
rs1258732 1200 dbSNP
rs1370750613 1202 dbSNP
rs1411279526 1205 dbSNP
rs1052002384 1206 dbSNP
rs1372051316 1212 dbSNP
rs994997363 1215 dbSNP
rs1451899847 1218 dbSNP
rs1363380069 1220 dbSNP
rs1159351527 1221 dbSNP
rs1222153246 1227 dbSNP
rs2037842 1228 dbSNP
rs1202765408 1230 dbSNP
rs1232366958 1237 dbSNP
rs898021893 1241 dbSNP
rs1393314366 1244 dbSNP
rs1473188750 1245 dbSNP
rs1182351666 1246 dbSNP
rs1036728644 1248 dbSNP
rs1442732128 1250 dbSNP
rs531981158 1261 dbSNP
rs1390579234 1271 dbSNP
rs1270004174 1276 dbSNP
rs1326525721 1277 dbSNP
rs770592095 1278 dbSNP
rs370639703 1279 dbSNP
rs911533695 1280 dbSNP
rs1381174642 1287 dbSNP
rs191828511 1296 dbSNP
rs931942148 1305 dbSNP
rs1344838936 1306 dbSNP
rs1259736007 1308 dbSNP
rs546307913 1309 dbSNP
rs1240377939 1316 dbSNP
rs746622362 1317 dbSNP
rs1300607080 1318 dbSNP
rs1233559491 1319 dbSNP
rs565241706 1331 dbSNP
rs5811705 1333 dbSNP
rs765466764 1334 dbSNP
rs915822121 1335 dbSNP
rs1418293749 1337 dbSNP
rs1384564002 1342 dbSNP
rs1045718701 1346 dbSNP
rs572469397 1350 dbSNP
rs1403338267 1353 dbSNP
rs971819754 1357 dbSNP
rs1321851932 1366 dbSNP
rs959840333 1370 dbSNP
rs151204687 1377 dbSNP
rs1393413035 1386 dbSNP
rs1013318421 1390 dbSNP
rs1270008403 1390 dbSNP
rs959018901 1393 dbSNP
rs1027907518 1395 dbSNP
rs924467388 1396 dbSNP
rs1478647808 1397 dbSNP
rs541832896 1402 dbSNP
rs977294548 1403 dbSNP
rs1036129604 1404 dbSNP
rs1190711990 1406 dbSNP
rs1428331617 1409 dbSNP
rs969182557 1413 dbSNP
rs373108820 1416 dbSNP
rs1426549732 1418 dbSNP
rs890184101 1427 dbSNP
rs1468878438 1431 dbSNP
rs1216955836 1435 dbSNP
rs1489063124 1445 dbSNP
rs1387722475 1447 dbSNP
rs1318000201 1448 dbSNP
rs11857248 1453 dbSNP
rs772972192 1457 dbSNP
rs1406992798 1462 dbSNP
rs931633510 1465 dbSNP
rs1209455892 1466 dbSNP
rs1344943473 1468 dbSNP
rs1229032507 1470 dbSNP
rs1345658411 1473 dbSNP
rs915161079 1476 dbSNP
rs1053597066 1480 dbSNP
rs935178781 1487 dbSNP
rs771900548 1503 dbSNP
rs576401806 1512 dbSNP
rs982332807 1517 dbSNP
rs559578632 1518 dbSNP
rs997752980 1520 dbSNP
rs537730980 1521 dbSNP
rs115337564 1524 dbSNP
rs376779468 1530 dbSNP
rs778835513 1535 dbSNP
rs1469038840 1537 dbSNP
rs186928447 1539 dbSNP
rs1015025557 1548 dbSNP
rs1391874145 1550 dbSNP
rs533950689 1555 dbSNP
rs1427003842 1556 dbSNP
rs533780564 1560 dbSNP
rs1415066242 1561 dbSNP
rs888161821 1566 dbSNP
rs1309164372 1569 dbSNP
rs1048175075 1572 dbSNP
rs1334117858 1585 dbSNP
rs1236754458 1588 dbSNP
rs1404398977 1592 dbSNP
rs200111142 1599 dbSNP
rs1166708338 1601 dbSNP
rs1278936827 1602 dbSNP
rs1461906175 1603 dbSNP
rs1224387039 1607 dbSNP
rs1424869887 1608 dbSNP
rs995061112 1614 dbSNP
rs202075890 1625 dbSNP
rs1252049601 1626 dbSNP
rs566454028 1629 dbSNP
rs1435615759 1635 dbSNP
rs1181697664 1637 dbSNP
rs894167779 1641 dbSNP
rs1478605152 1648 dbSNP
rs34874355 1648 dbSNP
rs1354880327 1660 dbSNP
rs1057056920 1664 dbSNP
rs1369506771 1672 dbSNP
rs1447010955 1678 dbSNP
rs938550359 1683 dbSNP
rs78399324 1686 dbSNP
rs1442535214 1688 dbSNP
rs1280100206 1689 dbSNP
rs977617960 1692 dbSNP
rs1394396661 1693 dbSNP
rs1390842413 1695 dbSNP
rs947248102 1697 dbSNP
rs914639159 1698 dbSNP
rs1194065451 1715 dbSNP
rs1358544394 1718 dbSNP
rs1258731 1720 dbSNP
rs953366981 1721 dbSNP
rs893444149 1722 dbSNP
rs760610942 1727 dbSNP
rs773098344 1730 dbSNP
rs771880526 1731 dbSNP
rs1194701121 1732 dbSNP
rs1256251931 1742 dbSNP
rs1463003825 1747 dbSNP
rs1258473828 1755 dbSNP
rs1242916147 1763 dbSNP
rs1030260579 1764 dbSNP
rs1173017520 1766 dbSNP
rs28502036 1769 dbSNP
rs142151396 1778 dbSNP
rs1015186158 1782 dbSNP
rs1292865873 1784 dbSNP
rs1448996512 1786 dbSNP
rs1342397569 1794 dbSNP
rs751676592 1796 dbSNP
rs183884319 1801 dbSNP
rs1382529248 1803 dbSNP
rs1297501089 1806 dbSNP
rs1027130103 1813 dbSNP
rs764275991 1814 dbSNP
rs1226259035 1815 dbSNP
rs538881451 1820 dbSNP
rs894242774 1821 dbSNP
rs1325149786 1827 dbSNP
rs758675076 1830 dbSNP
rs1056795019 1831 dbSNP
rs1202306266 1832 dbSNP
rs577368313 1835 dbSNP
rs991950894 1835 dbSNP
rs1162335377 1840 dbSNP
rs1260097843 1841 dbSNP
rs1428126243 1842 dbSNP
rs1199929268 1843 dbSNP
rs571418191 1846 dbSNP
rs1468348009 1847 dbSNP
rs556505875 1855 dbSNP
rs571098178 1856 dbSNP
rs28696324 1857 dbSNP
rs1454254877 1867 dbSNP
rs962319465 1868 dbSNP
rs1381299178 1870 dbSNP
rs1457305004 1873 dbSNP
rs28403314 1875 dbSNP
rs28633097 1876 dbSNP
rs374620242 1877 dbSNP
rs879668206 1877 dbSNP
rs541920343 1884 dbSNP
rs1221112312 1885 dbSNP
rs16958658 1886 dbSNP
rs1028753945 1887 dbSNP
rs1288813471 1895 dbSNP
rs562519852 1896 dbSNP
rs1485766945 1899 dbSNP
rs1223470726 1902 dbSNP
rs1271261776 1907 dbSNP
rs1041675679 1914 dbSNP
rs1198705638 1916 dbSNP
rs947191404 1917 dbSNP
rs893536874 1918 dbSNP
rs914439584 1922 dbSNP
rs879623417 1923 dbSNP
rs544170380 1930 dbSNP
rs28379322 1934 dbSNP
rs28756786 1937 dbSNP
rs902477013 1941 dbSNP
rs1366978706 1943 dbSNP
rs540056559 1944 dbSNP
rs1441539776 1946 dbSNP
rs1301972103 1949 dbSNP
rs1373511724 1954 dbSNP
rs28425489 1955 dbSNP
rs74011954 1956 dbSNP
rs386782721 1957 dbSNP
rs879634250 1957 dbSNP
rs976022901 1957 dbSNP
rs1247127600 1973 dbSNP
rs536335944 1976 dbSNP
rs796752493 1977 dbSNP
rs1260604426 1978 dbSNP
rs149112832 1984 dbSNP
rs1222103451 1986 dbSNP
rs1233522482 1992 dbSNP
rs952297038 1994 dbSNP
rs192937980 2003 dbSNP
rs188509497 2004 dbSNP
rs958405132 2005 dbSNP
rs183908736 2006 dbSNP
rs1009174577 2012 dbSNP
rs16958655 2016 dbSNP
rs1302188992 2018 dbSNP
rs1354585519 2020 dbSNP
rs1002531727 2022 dbSNP
rs1295980977 2031 dbSNP
rs28728267 2037 dbSNP
rs531943102 2038 dbSNP
rs1029596650 2042 dbSNP
rs117080464 2044 dbSNP
rs28455859 2046 dbSNP
rs386782720 2047 dbSNP
rs28414020 2050 dbSNP
rs1453591221 2062 dbSNP
rs755535622 2063 dbSNP
rs1232386724 2069 dbSNP
rs999147939 2073 dbSNP
rs1244710264 2080 dbSNP
rs1413477324 2087 dbSNP
rs966745671 2088 dbSNP
rs1282388308 2089 dbSNP
rs1419745270 2091 dbSNP
rs902872625 2098 dbSNP
rs1013897581 2099 dbSNP
rs1167636888 2100 dbSNP
rs1354530785 2101 dbSNP
rs562607159 2104 dbSNP
rs1232746244 2110 dbSNP
rs1367510453 2120 dbSNP
rs544206605 2121 dbSNP
rs1011464246 2125 dbSNP
rs1452313170 2137 dbSNP
rs192292789 2141 dbSNP
rs16958652 2157 dbSNP
rs1213090638 2160 dbSNP
rs1351294341 2165 dbSNP
rs1272370042 2169 dbSNP
rs931826824 2177 dbSNP
rs773960593 2179 dbSNP
rs540510344 2182 dbSNP
rs1459947915 2187 dbSNP
rs1186499212 2195 dbSNP
rs907841838 2197 dbSNP
rs1476184934 2208 dbSNP
rs1360615043 2211 dbSNP
rs17816333 2214 dbSNP
rs749138705 2218 dbSNP
rs1424350541 2223 dbSNP
rs1177997861 2227 dbSNP
rs940676173 2230 dbSNP
rs1414412215 2244 dbSNP
rs907897763 2245 dbSNP
rs1191599859 2249 dbSNP
rs922200550 2251 dbSNP
rs974920779 2255 dbSNP
rs561043737 2257 dbSNP
rs985207683 2258 dbSNP
rs542816801 2259 dbSNP
rs1216179876 2260 dbSNP
rs1488701440 2272 dbSNP
rs1281465690 2285 dbSNP
rs1288332240 2286 dbSNP
rs952306294 2292 dbSNP
rs577927076 2293 dbSNP
rs1284692189 2295 dbSNP
rs575427297 2300 dbSNP
rs1057472 2301 dbSNP
rs1013241123 2310 dbSNP
rs145050877 2312 dbSNP
rs1035421518 2320 dbSNP
rs1477985775 2321 dbSNP
rs1159693159 2325 dbSNP
rs537511517 2332 dbSNP
rs1360335841 2336 dbSNP
rs1298002840 2342 dbSNP
rs898301816 2342 dbSNP
rs1407012559 2345 dbSNP
rs1277895319 2346 dbSNP
rs1037806477 2349 dbSNP
rs967545325 2356 dbSNP
rs1005398899 2357 dbSNP
rs3825862 2363 dbSNP
rs114305949 2366 dbSNP
rs893021768 2367 dbSNP
rs1490407090 2369 dbSNP
rs1050338846 2371 dbSNP
rs377658283 2373 dbSNP
rs551613955 2377 dbSNP
rs901705993 2380 dbSNP
rs1181926543 2382 dbSNP
rs1040420984 2383 dbSNP
rs925432487 2387 dbSNP
rs1158362069 2388 dbSNP
rs978212829 2390 dbSNP
rs1358033463 2392 dbSNP
rs1426787741 2394 dbSNP
rs3743108 2395 dbSNP
rs533557014 2401 dbSNP
rs765482715 2407 dbSNP
rs879905565 2408 dbSNP
rs1192660049 2414 dbSNP
rs1478303912 2418 dbSNP
rs916830251 2425 dbSNP
rs1289073506 2434 dbSNP
rs1355240265 2436 dbSNP
rs1195801452 2439 dbSNP
rs992276187 2441 dbSNP
rs959033338 2448 dbSNP
rs991108790 2450 dbSNP
rs59626341 2452 dbSNP
rs1185947015 2455 dbSNP
rs1446876786 2456 dbSNP
rs1033606318 2459 dbSNP
rs1368076386 2462 dbSNP
rs1462694108 2463 dbSNP
rs186938486 2466 dbSNP
rs1394505173 2467 dbSNP
rs978274144 2473 dbSNP
rs756353633 2474 dbSNP
rs1482983162 2479 dbSNP
rs1256610128 2480 dbSNP
rs973960817 2487 dbSNP
rs962600300 2488 dbSNP
rs755341646 2490 dbSNP
rs1339451639 2493 dbSNP
rs1015463511 2500 dbSNP
rs550657280 2508 dbSNP
rs989827381 2513 dbSNP
rs532441081 2517 dbSNP
rs886562700 2518 dbSNP
rs1264246864 2519 dbSNP
rs1463077438 2522 dbSNP
rs1030376203 2528 dbSNP
rs182204599 2529 dbSNP
rs546605675 2537 dbSNP
rs1393882459 2541 dbSNP
rs1195651723 2544 dbSNP
rs1371383178 2546 dbSNP
rs1377825661 2553 dbSNP
rs1477508832 2555 dbSNP
rs1177279732 2559 dbSNP
rs1302850829 2565 dbSNP
rs1470922221 2569 dbSNP
rs1300847834 2577 dbSNP
rs376126802 2579 dbSNP
rs1028850287 2580 dbSNP
rs1057473 2581 dbSNP
rs1297339841 2587 dbSNP
rs901779699 2588 dbSNP
rs1169756390 2589 dbSNP
rs1039280518 2591 dbSNP
rs1208723121 2592 dbSNP
rs1255737773 2597 dbSNP
rs190348703 2598 dbSNP
rs936949049 2604 dbSNP
rs542853749 2610 dbSNP
rs1425449705 2615 dbSNP
rs140049369 2617 dbSNP
rs1042985827 2618 dbSNP
rs1423401208 2619 dbSNP
rs1005124147 2620 dbSNP
rs917662464 2623 dbSNP
rs991890246 2632 dbSNP
rs1183661156 2633 dbSNP
rs1186322537 2644 dbSNP
rs886491395 2645 dbSNP
rs1479974047 2649 dbSNP
rs1049645812 2654 dbSNP
rs1454080849 2655 dbSNP
rs766512240 2664 dbSNP
rs930658544 2667 dbSNP
rs563424283 2674 dbSNP
rs1358161827 2676 dbSNP
rs371025886 2681 dbSNP
rs1399027521 2682 dbSNP
rs766980119 2684 dbSNP
rs1199777959 2691 dbSNP
rs1217954643 2696 dbSNP
rs1301129298 2697 dbSNP
rs1258730 2698 dbSNP
rs3743106 2702 dbSNP
rs973718679 2710 dbSNP
rs552914064 2718 dbSNP
rs1488077145 2723 dbSNP
rs1312882810 2728 dbSNP
rs1229515032 2729 dbSNP
rs1487576422 2733 dbSNP
rs534286775 2733 dbSNP
rs1015517435 2738 dbSNP
rs1419606296 2744 dbSNP
rs61420266 2746 dbSNP
rs185779684 2749 dbSNP
rs1418681562 2750 dbSNP
rs536494411 2753 dbSNP
rs1367075469 2754 dbSNP
rs1030843815 2756 dbSNP
rs374451150 2756 dbSNP
rs997587937 2760 dbSNP
rs868083585 2762 dbSNP
rs569099998 2763 dbSNP
rs1393702742 2765 dbSNP
rs550828450 2765 dbSNP
rs1353492011 2767 dbSNP
rs990332154 2771 dbSNP
rs1294166268 2773 dbSNP
rs957046349 2775 dbSNP
rs1220842698 2777 dbSNP
rs1028585053 2778 dbSNP
rs1251981059 2780 dbSNP
rs181143653 2790 dbSNP
rs1437939629 2792 dbSNP
rs1180506574 2795 dbSNP
rs1379720515 2796 dbSNP
rs1179829435 2799 dbSNP
rs1184005057 2801 dbSNP
rs761322868 2802 dbSNP
rs1403254277 2803 dbSNP
rs1163441901 2811 dbSNP
rs904155080 2812 dbSNP
rs571623450 2813 dbSNP
rs1376842789 2815 dbSNP
rs1004710546 2816 dbSNP
rs546989720 2822 dbSNP
rs77331764 2823 dbSNP
rs886310760 2831 dbSNP
rs1228024859 2832 dbSNP
rs539121565 2836 dbSNP
rs1222299823 2837 dbSNP
rs1309379693 2839 dbSNP
rs945545191 2846 dbSNP
rs1027720737 2848 dbSNP
rs191615328 2851 dbSNP
rs1203999572 2853 dbSNP
rs1239046272 2854 dbSNP
rs895249999 2856 dbSNP
rs561170834 2858 dbSNP
rs1180963905 2860 dbSNP
rs1240789145 2860 dbSNP
rs549297547 2866 dbSNP
rs1057014338 2867 dbSNP
rs1478489667 2871 dbSNP
rs146054322 2872 dbSNP
rs1400123802 2877 dbSNP
rs1470599001 2879 dbSNP
rs926349663 2885 dbSNP
rs1357859215 2892 dbSNP
rs1447538392 2894 dbSNP
rs1385983757 2896 dbSNP
rs568591878 2897 dbSNP
rs1038080307 2898 dbSNP
rs1295528369 2899 dbSNP
rs940965949 2899 dbSNP
rs908462313 2900 dbSNP
rs745604230 2903 dbSNP
rs1280433758 2906 dbSNP
rs12050761 2908 dbSNP
rs768232148 2910 dbSNP
rs922485252 2916 dbSNP
rs1190805379 2922 dbSNP
rs1422370900 2924 dbSNP
rs544805875 2930 dbSNP
rs1198644309 2931 dbSNP
rs1434149194 2932 dbSNP
rs138308362 2933 dbSNP
rs200037975 2933 dbSNP
rs1319391405 2934 dbSNP
rs186776371 2935 dbSNP
rs964800343 2936 dbSNP
rs566430342 2939 dbSNP
rs1405456596 2940 dbSNP
rs541283300 2940 dbSNP
rs1487063312 2941 dbSNP
rs1218359352 2942 dbSNP
rs1284767884 2946 dbSNP
rs549603678 2947 dbSNP
rs762820483 2947 dbSNP
rs1291686258 2950 dbSNP
rs1000827093 2951 dbSNP
rs1490385297 2952 dbSNP
rs1355820532 2956 dbSNP
rs935726320 2958 dbSNP
rs921686589 2962 dbSNP
rs1254212941 2963 dbSNP
rs1477994048 2966 dbSNP
rs974344011 2971 dbSNP
rs1382622835 2972 dbSNP
rs1021640962 2979 dbSNP
rs1009843570 2980 dbSNP
rs987806708 2983 dbSNP
rs1388553330 2984 dbSNP
rs3930082 2984 dbSNP
rs1303051162 2985 dbSNP
rs1398457021 2989 dbSNP
rs911807411 2991 dbSNP
rs1284809197 2992 dbSNP
rs983796557 2997 dbSNP
rs950677576 3004 dbSNP
rs904944995 3009 dbSNP
rs182325964 3010 dbSNP
rs1000987304 3011 dbSNP
rs1178447012 3014 dbSNP
rs1400104794 3015 dbSNP
rs994684036 3017 dbSNP
rs1404669457 3019 dbSNP
rs959411597 3021 dbSNP
rs905380887 3022 dbSNP
rs922502922 3026 dbSNP
rs1379732354 3030 dbSNP
rs573296781 3031 dbSNP
rs1318542505 3041 dbSNP
rs1294695817 3042 dbSNP
rs1476665901 3042 dbSNP
rs1281893767 3044 dbSNP
rs1355098575 3047 dbSNP
rs975256787 3058 dbSNP
rs867894346 3063 dbSNP
rs1349987587 3065 dbSNP
rs1261986881 3069 dbSNP
rs865783208 3070 dbSNP
rs906559099 3071 dbSNP
rs963809084 3073 dbSNP
rs1042634573 3074 dbSNP
rs560481504 3075 dbSNP
rs557733710 3076 dbSNP
rs1464049616 3077 dbSNP
rs979458565 3078 dbSNP
rs1402693568 3079 dbSNP
rs1397395094 3081 dbSNP
rs374897274 3082 dbSNP
rs1279558522 3083 dbSNP
rs1345623771 3086 dbSNP
rs865946263 3087 dbSNP
rs1484473855 3088 dbSNP
rs1216544390 3090 dbSNP
rs932827327 3091 dbSNP
rs1255688750 3094 dbSNP
rs189263973 3096 dbSNP
rs1038797720 3097 dbSNP
rs1195916142 3104 dbSNP
rs377132691 3106 dbSNP
rs112722321 3107 dbSNP
rs1476780732 3113 dbSNP
rs1169936795 3119 dbSNP
rs372914807 3121 dbSNP
rs1467351019 3123 dbSNP
rs538823855 3130 dbSNP
rs571724361 3131 dbSNP
rs1299493854 3136 dbSNP
rs983157437 3138 dbSNP
rs1979170 3139 dbSNP
rs920532013 3143 dbSNP
rs1314500115 3144 dbSNP
rs1231441872 3145 dbSNP
rs1397187569 3147 dbSNP
rs544124239 3153 dbSNP
rs1002381160 3157 dbSNP
rs535066529 3158 dbSNP
rs1038142386 3160 dbSNP
rs374924862 3162 dbSNP
rs1170965687 3163 dbSNP
rs1476152985 3164 dbSNP
rs1979169 3168 dbSNP
rs1186208427 3169 dbSNP
rs569939826 3170 dbSNP
rs150883100 3171 dbSNP
rs901094957 3172 dbSNP
rs1039564104 3173 dbSNP
rs1244860414 3173 dbSNP
rs539008134 3174 dbSNP
rs942551272 3175 dbSNP
rs925766749 3178 dbSNP
rs1457171023 3179 dbSNP
rs559442956 3180 dbSNP
rs540759901 3182 dbSNP
rs1033747175 3184 dbSNP
rs540815155 3192 dbSNP
rs913970535 3193 dbSNP
rs769635980 3202 dbSNP
rs777768710 3206 dbSNP
rs1354497665 3207 dbSNP
rs375565000 3210 dbSNP
rs74762077 3211 dbSNP
rs1003661302 3217 dbSNP
rs960956896 3220 dbSNP
rs1180315017 3222 dbSNP
rs1440027820 3222 dbSNP
rs35863528 3222 dbSNP
rs398118703 3222 dbSNP
rs1456816738 3224 dbSNP
rs970816540 3224 dbSNP
rs1021348661 3225 dbSNP
rs1342306457 3228 dbSNP
rs1329940478 3233 dbSNP
rs1307548345 3234 dbSNP
rs114249190 3236 dbSNP
rs894013581 3239 dbSNP
rs1054074798 3245 dbSNP
rs1401488726 3249 dbSNP
rs1320049473 3251 dbSNP
rs1220960151 3252 dbSNP
rs996967628 3254 dbSNP
rs1458163887 3258 dbSNP
rs980995820 3260 dbSNP
rs1236206071 3262 dbSNP
rs1480087636 3266 dbSNP
rs1415533742 3267 dbSNP
rs180928616 3269 dbSNP
rs900032927 3274 dbSNP
rs969609085 3277 dbSNP
rs1467696095 3280 dbSNP
rs1411155257 3282 dbSNP
rs561325127 3284 dbSNP
rs1979168 3285 dbSNP
rs575549846 3288 dbSNP
rs911648373 3293 dbSNP
rs557331893 3295 dbSNP
rs1438931891 3304 dbSNP
rs1227748984 3312 dbSNP
rs929022271 3313 dbSNP
rs28439346 3314 dbSNP
rs997872024 3317 dbSNP
rs1206338104 3320 dbSNP
rs1450133054 3322 dbSNP
rs973342740 3323 dbSNP
rs578108388 3339 dbSNP
rs900809263 3340 dbSNP
rs1039617362 3345 dbSNP
rs937816572 3348 dbSNP
rs1263358729 3351 dbSNP
rs571894633 3356 dbSNP
rs114748719 3357 dbSNP
rs945828862 3361 dbSNP
rs971178574 3362 dbSNP
rs1415364983 3364 dbSNP
rs913995625 3366 dbSNP
rs1021045064 3367 dbSNP
rs75606001 3371 dbSNP
rs927972917 3374 dbSNP
rs1342500565 3375 dbSNP
rs16958630 3377 dbSNP
rs114496231 3398 dbSNP
rs780573275 3399 dbSNP
rs900106435 3401 dbSNP
rs1280541605 3404 dbSNP
rs1310069319 3411 dbSNP
rs550650071 3416 dbSNP
rs1019702737 3420 dbSNP
rs1349619837 3421 dbSNP
rs1008358873 3425 dbSNP
rs1322500279 3426 dbSNP
rs1025407999 3429 dbSNP
rs1190916990 3430 dbSNP
rs1366894334 3431 dbSNP
rs890195439 3435 dbSNP
rs1478652117 3439 dbSNP
rs1047514437 3443 dbSNP
rs1423595159 3444 dbSNP
rs538060644 3447 dbSNP
rs1362722343 3450 dbSNP
rs375338197 3456 dbSNP
rs1317738728 3459 dbSNP
rs1439069923 3468 dbSNP
rs1037387576 3470 dbSNP
rs199522351 3472 dbSNP
rs1365288576 3474 dbSNP
rs201348399 3474 dbSNP
rs80109791 3476 dbSNP
rs1006508355 3477 dbSNP
rs1355417278 3486 dbSNP
rs1245859722 3489 dbSNP
rs1283019359 3491 dbSNP
rs1452691069 3495 dbSNP
rs1199862577 3506 dbSNP
rs569934227 3508 dbSNP
rs937890109 3509 dbSNP
rs1245502668 3524 dbSNP
rs926527155 3525 dbSNP
rs1454076294 3526 dbSNP
rs1179655147 3527 dbSNP
rs1382338764 3531 dbSNP
rs1438126996 3532 dbSNP
rs1158063384 3533 dbSNP
rs113409572 3535 dbSNP
rs1042917851 3536 dbSNP
rs1405860782 3536 dbSNP
rs1355097582 3538 dbSNP
rs1439808515 3539 dbSNP
rs115474922 3549 dbSNP
rs913970779 3553 dbSNP
rs1378641491 3557 dbSNP
rs1236521696 3558 dbSNP
rs1278416954 3559 dbSNP
rs988265602 3560 dbSNP
rs958265585 3566 dbSNP
rs1288266946 3568 dbSNP
rs78263497 3581 dbSNP
rs975388091 3583 dbSNP
rs939459998 3584 dbSNP
rs368903113 3587 dbSNP
rs1019859414 3595 dbSNP
rs947997176 3598 dbSNP
rs1295861227 3601 dbSNP
rs1008810498 3604 dbSNP
rs1161539540 3606 dbSNP
rs74963573 3608 dbSNP
rs1415508738 3612 dbSNP
rs1460910658 3612 dbSNP
rs1418523871 3613 dbSNP
rs1402248604 3614 dbSNP
rs547118434 3615 dbSNP
rs1161221849 3620 dbSNP
rs1246274850 3622 dbSNP
rs75144062 3625 dbSNP
rs993235496 3629 dbSNP
rs1979167 3633 dbSNP
rs1316396141 3634 dbSNP
rs533354407 3636 dbSNP
rs976935880 3637 dbSNP
rs184821986 3643 dbSNP
rs965137117 3645 dbSNP
rs1017937363 3646 dbSNP
rs1172933049 3647 dbSNP
rs372082561 3650 dbSNP
rs1171363549 3651 dbSNP
rs564057121 3660 dbSNP
rs1167117511 3665 dbSNP
rs905100475 3666 dbSNP
rs1402451318 3667 dbSNP
rs1193164999 3669 dbSNP
rs1488669869 3671 dbSNP
rs1021560107 3674 dbSNP
rs1046384504 3679 dbSNP
rs192825643 3681 dbSNP
rs891698535 3682 dbSNP
rs1057390860 3684 dbSNP
rs1227079915 3687 dbSNP
rs1257017028 3691 dbSNP
rs1002707303 3697 dbSNP
rs1208644139 3703 dbSNP
rs906618255 3706 dbSNP
rs562844891 3711 dbSNP
rs763786423 3712 dbSNP
rs1195934790 3715 dbSNP
rs1265171354 3723 dbSNP
rs1426719199 3725 dbSNP
rs1052711574 3729 dbSNP
rs1467241198 3733 dbSNP
rs746559811 3733 dbSNP
rs936745884 3751 dbSNP
rs544652420 3756 dbSNP
rs909862355 3758 dbSNP
rs578151758 3763 dbSNP
rs1419704741 3770 dbSNP
rs1225708311 3779 dbSNP
rs559673154 3780 dbSNP
rs1360476240 3793 dbSNP
rs1048374282 3794 dbSNP
rs1325289436 3795 dbSNP
rs1333244088 3797 dbSNP
rs1232588781 3801 dbSNP
rs762577361 3804 dbSNP
rs925379183 3805 dbSNP
rs1218866973 3807 dbSNP
rs918841084 3810 dbSNP
rs1484834100 3812 dbSNP
rs1275940622 3819 dbSNP
rs975378178 3820 dbSNP
rs879281922 3821 dbSNP
rs190185406 3823 dbSNP
rs529092106 3829 dbSNP
rs1439988114 3834 dbSNP
rs1159930454 3838 dbSNP
rs987101380 3840 dbSNP
rs1445808839 3841 dbSNP
rs574199483 3845 dbSNP
rs1453651402 3846 dbSNP
rs951733434 3846 dbSNP
rs1025789293 3855 dbSNP
rs1294585479 3859 dbSNP
rs1393517233 3866 dbSNP
rs1439084647 3869 dbSNP
rs1325718066 3872 dbSNP
rs1377918976 3881 dbSNP
rs968420281 3884 dbSNP
rs555848852 3886 dbSNP
rs79439446 3895 dbSNP
rs1316364146 3897 dbSNP
rs1176577200 3898 dbSNP
rs199773039 3899 dbSNP
rs35005255 3901 dbSNP
rs68061475 3901 dbSNP
rs774908741 3901 dbSNP
rs1265888355 3904 dbSNP
rs1469776962 3907 dbSNP
rs1421143115 3909 dbSNP
rs1170250851 3911 dbSNP
rs1211577623 3912 dbSNP
rs1478232856 3912 dbSNP
rs1252219570 3914 dbSNP
rs537487378 3916 dbSNP
rs956191240 3918 dbSNP
rs1405376915 3923 dbSNP
rs2697929 3927 dbSNP
rs963087470 3929 dbSNP
rs1483234946 3930 dbSNP
rs1238524074 3933 dbSNP
rs1206076937 3934 dbSNP
rs1035573428 3936 dbSNP
rs1002716698 3942 dbSNP
rs16958627 3943 dbSNP
rs1001865920 3944 dbSNP
rs1023746507 3949 dbSNP
rs1401543026 3957 dbSNP
rs16958624 3958 dbSNP
rs1296625668 3959 dbSNP
rs539331739 3959 dbSNP
rs1046332467 3960 dbSNP
rs1048910452 3964 dbSNP
rs1013474171 3966 dbSNP
rs929951927 3971 dbSNP
rs892395816 3973 dbSNP
rs1226088416 3976 dbSNP
rs1377761308 3985 dbSNP
rs1318275993 3986 dbSNP
rs1052236247 3996 dbSNP
rs1230757286 4004 dbSNP
rs936536054 4012 dbSNP
rs750500604 4022 dbSNP
rs370177112 4024 dbSNP
rs1259089993 4029 dbSNP
rs1474506488 4034 dbSNP
rs1164765940 4037 dbSNP
rs1397853500 4038 dbSNP
rs1258729 4039 dbSNP
rs1168802804 4040 dbSNP
rs545442428 4041 dbSNP
rs942692289 4044 dbSNP
rs1466779303 4047 dbSNP
rs1304652718 4048 dbSNP
rs1356469901 4050 dbSNP
rs1414258307 4051 dbSNP
rs1292525599 4059 dbSNP
rs1162815436 4063 dbSNP
rs770824366 4066 dbSNP
rs1423349629 4070 dbSNP
rs115032471 4075 dbSNP
rs947172437 4076 dbSNP
rs1306559495 4079 dbSNP
rs987226990 4084 dbSNP
rs951625333 4087 dbSNP
rs574849822 4089 dbSNP
rs1282042142 4094 dbSNP
rs1484366684 4095 dbSNP
rs1438383528 4101 dbSNP
rs535233458 4107 dbSNP
rs1476701991 4112 dbSNP
rs1199641277 4116 dbSNP
rs1480778126 4118 dbSNP
rs16958617 4119 dbSNP
rs368593634 4121 dbSNP
rs1218864920 4126 dbSNP
rs1016002117 4130 dbSNP
rs1320604156 4132 dbSNP
rs1036031325 4135 dbSNP
rs1298938229 4143 dbSNP
rs1001982093 4145 dbSNP
rs969137995 4147 dbSNP
rs12442768 4150 dbSNP
rs376695242 4151 dbSNP
rs570374706 4152 dbSNP
rs892375104 4157 dbSNP
rs531378542 4163 dbSNP
rs1345324068 4168 dbSNP
rs3110558 4172 dbSNP
rs1391724391 4174 dbSNP
rs552082447 4179 dbSNP
rs1292023027 4196 dbSNP
rs1006052616 4207 dbSNP
rs888529024 4212 dbSNP
rs1195924556 4219 dbSNP
rs1393446183 4222 dbSNP
rs192615898 4236 dbSNP
rs1159326513 4239 dbSNP
rs1457537714 4240 dbSNP
rs1410334325 4241 dbSNP
rs1399044766 4243 dbSNP
rs148378639 4247 dbSNP
rs942766427 4248 dbSNP
rs891214922 4249 dbSNP
rs1051074251 4250 dbSNP
rs929999020 4252 dbSNP
rs918841066 4257 dbSNP
rs1041004514 4259 dbSNP
rs1352142492 4260 dbSNP
rs1221577207 4262 dbSNP
rs1284129410 4263 dbSNP
rs944320794 4264 dbSNP
rs1215912665 4268 dbSNP
rs974752273 4270 dbSNP
rs941495808 4271 dbSNP
rs780518469 4274 dbSNP
rs1487951446 4292 dbSNP
rs1179432823 4297 dbSNP
rs1234822061 4298 dbSNP
rs369266433 4303 dbSNP
rs1468632129 4308 dbSNP
rs980284180 4309 dbSNP
rs541644732 4313 dbSNP
rs1291946193 4314 dbSNP
rs947540892 4319 dbSNP
rs1351467482 4324 dbSNP
rs1461931668 4325 dbSNP
rs762632827 4325 dbSNP
rs914313976 4330 dbSNP
rs1439909372 4334 dbSNP
rs144411657 4347 dbSNP
rs1329031809 4348 dbSNP
rs969087032 4351 dbSNP
rs1285258081 4353 dbSNP
rs988550319 4363 dbSNP
rs1239616984 4373 dbSNP
rs1025152461 4374 dbSNP
rs1298921525 4386 dbSNP
rs928346495 4387 dbSNP
rs1346369145 4393 dbSNP
rs562201610 4393 dbSNP
rs543916043 4398 dbSNP
rs1199698223 4399 dbSNP
rs142081167 4399 dbSNP
rs377612775 4399 dbSNP
rs1252870615 4401 dbSNP
rs756577341 4403 dbSNP
rs1258728 4408 dbSNP
rs1030906177 4410 dbSNP
rs1159669854 4427 dbSNP
rs1415584990 4428 dbSNP
rs1460690320 4429 dbSNP
rs1000710524 4434 dbSNP
rs1455742980 4436 dbSNP
rs781708825 4437 dbSNP
rs951882149 4439 dbSNP
rs757761123 4445 dbSNP
rs1006688304 4446 dbSNP
rs557889178 4451 dbSNP
rs1291936114 4454 dbSNP
rs1269110887 4458 dbSNP
rs1355410474 4468 dbSNP
rs1201081091 4477 dbSNP
rs1228587856 4477 dbSNP
rs961746225 4478 dbSNP
rs1051653300 4481 dbSNP
rs1195503663 4491 dbSNP
rs1261759801 4494 dbSNP
rs929973130 4498 dbSNP
rs1208856034 4499 dbSNP
rs897175427 4502 dbSNP
rs1352738604 4503 dbSNP
rs1254081134 4505 dbSNP
rs1232225204 4512 dbSNP
rs1474313871 4518 dbSNP
rs1323941124 4519 dbSNP
rs1166893081 4521 dbSNP
rs201954168 4523 dbSNP
rs1038391614 4525 dbSNP
rs1375715268 4526 dbSNP
rs1435988810 4527 dbSNP
rs1310599029 4531 dbSNP
rs567212505 4534 dbSNP
rs1285455249 4535 dbSNP
rs1383337425 4538 dbSNP
rs1258727 4540 dbSNP
rs1339941068 4545 dbSNP
rs927532392 4548 dbSNP
rs1227155606 4551 dbSNP
rs756518691 4554 dbSNP
rs1350347755 4561 dbSNP
rs1208786673 4566 dbSNP
rs533373307 4568 dbSNP
rs199823671 4571 dbSNP
rs917658008 4572 dbSNP
rs183276678 4573 dbSNP
rs1470522879 4575 dbSNP
rs758008717 4576 dbSNP
rs751955368 4577 dbSNP
rs752816612 4584 dbSNP
rs1431837030 4588 dbSNP
rs1031062194 4590 dbSNP
rs1258726 4595 dbSNP
rs1453871622 4605 dbSNP
rs934458503 4607 dbSNP
rs1381957801 4613 dbSNP
rs1327050276 4627 dbSNP
rs1373424490 4636 dbSNP
rs1232447070 4639 dbSNP
rs1302973891 4640 dbSNP
rs201676569 4644 dbSNP
rs367609300 4647 dbSNP
rs72521272 4647 dbSNP
rs10672209 4648 dbSNP
rs550816173 4648 dbSNP
rs1241317912 4651 dbSNP
rs1372060213 4656 dbSNP
rs567904972 4657 dbSNP
rs1207847751 4658 dbSNP
rs1253465944 4671 dbSNP
rs1448708447 4675 dbSNP
rs1191298915 4679 dbSNP
rs16958600 4679 dbSNP
rs1419108980 4680 dbSNP
rs1254032934 4681 dbSNP
rs759306763 4690 dbSNP
rs1362540943 4692 dbSNP
rs1006678336 4693 dbSNP
rs1264702779 4696 dbSNP
rs1217102556 4701 dbSNP
rs191483182 4702 dbSNP
rs1270896535 4704 dbSNP
rs1439169554 4705 dbSNP
rs1229663489 4708 dbSNP
rs1325430552 4711 dbSNP
rs1374361668 4718 dbSNP
rs1338731056 4720 dbSNP
rs915841676 4723 dbSNP
rs1305012575 4727 dbSNP
rs955410189 4732 dbSNP
rs1029735386 4741 dbSNP
rs994632412 4742 dbSNP
rs1273751918 4751 dbSNP
rs1258725 4752 dbSNP
rs1211620041 4756 dbSNP
rs766338724 4758 dbSNP
rs1005563538 4760 dbSNP
rs550136750 4762 dbSNP
rs1168100095 4763 dbSNP
rs961522835 4764 dbSNP
rs1472541566 4768 dbSNP
rs1189191321 4770 dbSNP
rs1019617808 4777 dbSNP
rs1008190558 4779 dbSNP
rs1355305973 4783 dbSNP
rs1366144118 4786 dbSNP
rs10519742 4788 dbSNP
rs1372627838 4790 dbSNP
rs1415479426 4794 dbSNP
rs950232859 4795 dbSNP
rs1028552223 4796 dbSNP
rs1231202198 4799 dbSNP
rs1244804785 4800 dbSNP
rs774431714 4803 dbSNP
rs1196502646 4805 dbSNP
rs77274880 4806 dbSNP
rs1274007644 4813 dbSNP
rs1197719990 4819 dbSNP
rs1354346530 4823 dbSNP
rs540074804 4823 dbSNP
rs1249272596 4824 dbSNP
rs1482421119 4825 dbSNP
rs1264869827 4827 dbSNP
rs1211012584 4831 dbSNP
rs749482687 4837 dbSNP
rs1474536657 4848 dbSNP
rs1181636808 4863 dbSNP
rs1385594443 4883 dbSNP
rs1430678669 4884 dbSNP
rs935034185 4887 dbSNP
rs893367555 4890 dbSNP
rs548099066 4891 dbSNP
rs1377160244 4892 dbSNP
rs979056211 4899 dbSNP
rs999428808 4902 dbSNP
rs748721684 4904 dbSNP
rs1336680945 4912 dbSNP
rs1298220490 4916 dbSNP
rs967729237 4917 dbSNP
rs1292940105 4923 dbSNP
rs1329147824 4931 dbSNP
rs911121364 4933 dbSNP
rs985374999 4937 dbSNP
rs370920201 4940 dbSNP
rs529543557 4940 dbSNP
rs534030779 4940 dbSNP
rs1388036670 4942 dbSNP
rs1045476895 4944 dbSNP
rs774672960 4944 dbSNP
rs1209962033 4946 dbSNP
rs955332773 4962 dbSNP
rs1029887863 4964 dbSNP
rs1185164419 4965 dbSNP
rs1389758148 4965 dbSNP
rs1454901021 4969 dbSNP
rs1049190856 4970 dbSNP
rs1393406399 4971 dbSNP
rs144090466 4976 dbSNP
rs994019216 4980 dbSNP
rs971925393 4983 dbSNP
rs370890731 4984 dbSNP
rs912659461 4985 dbSNP
rs1364006592 4996 dbSNP
rs986824158 5001 dbSNP
rs1305195551 5007 dbSNP
rs531728127 5010 dbSNP
rs1345035908 5011 dbSNP
rs1017064557 5014 dbSNP
rs954110846 5017 dbSNP
rs1285510396 5018 dbSNP
rs1319304885 5019 dbSNP
rs1214050641 5020 dbSNP
rs1469457443 5023 dbSNP
rs1469061624 5025 dbSNP
rs1195666356 5027 dbSNP
rs1251375917 5028 dbSNP
rs775822636 5028 dbSNP
rs769117017 5039 dbSNP
rs1233186238 5047 dbSNP
rs1184252864 5048 dbSNP
rs1159273032 5050 dbSNP
rs1408589071 5057 dbSNP
rs1005537228 5058 dbSNP
rs564562720 5060 dbSNP
rs770187520 5069 dbSNP
rs1387564097 5070 dbSNP
rs1291196499 5073 dbSNP
rs1327454134 5073 dbSNP
rs1223278400 5078 dbSNP
rs1361630634 5083 dbSNP
rs1284532653 5084 dbSNP
rs545882232 5090 dbSNP
rs1376160533 5099 dbSNP
rs1222616830 5102 dbSNP
rs1351858806 5106 dbSNP
rs896070737 5110 dbSNP
rs11853746 5111 dbSNP
rs553692128 5113 dbSNP
rs1328973029 5116 dbSNP
rs528477706 5127 dbSNP
rs1182620379 5131 dbSNP
rs1405059464 5132 dbSNP
rs957684782 5134 dbSNP
rs1411192390 5140 dbSNP
rs1461725066 5141 dbSNP
rs757712311 5142 dbSNP
rs1156790249 5145 dbSNP
rs1032303040 5147 dbSNP
rs999043614 5155 dbSNP
rs1408524926 5164 dbSNP
rs1160065966 5170 dbSNP
rs1477186415 5174 dbSNP
rs541706170 5178 dbSNP
rs923687999 5179 dbSNP
rs1288225788 5182 dbSNP
rs1043482062 5184 dbSNP
rs137935005 5185 dbSNP
rs1291899256 5186 dbSNP
rs555963082 5190 dbSNP
rs1024459429 5195 dbSNP
rs1275389294 5222 dbSNP
rs1490866075 5228 dbSNP
rs186631142 5230 dbSNP
rs1215794413 5231 dbSNP
rs894220255 5236 dbSNP
rs910860961 5243 dbSNP
rs1475516659 5244 dbSNP
rs1189793956 5246 dbSNP
rs1366559875 5247 dbSNP
rs1048758474 5248 dbSNP
rs777286043 5252 dbSNP
rs757876354 5256 dbSNP
rs930265585 5256 dbSNP
rs1036660149 5258 dbSNP
rs11853545 5268 dbSNP
rs1417231327 5270 dbSNP
rs1332790958 5271 dbSNP
rs911750381 5272 dbSNP
rs1228655069 5273 dbSNP
rs1272099460 5275 dbSNP
rs985914371 5289 dbSNP
rs1227719045 5292 dbSNP
rs1281210454 5298 dbSNP
rs33941825 5298 dbSNP
rs199657956 5299 dbSNP
rs5811704 5299 dbSNP
rs1253998401 5300 dbSNP
rs200017518 5300 dbSNP
rs140440034 5301 dbSNP
rs1217798929 5303 dbSNP
rs1323219348 5310 dbSNP
rs1282261698 5311 dbSNP
rs1374407262 5312 dbSNP
rs1258724 5316 dbSNP
rs1167404234 5324 dbSNP
rs1436048647 5332 dbSNP
rs141245495 5334 dbSNP
rs1402148874 5335 dbSNP
rs746019916 5336 dbSNP
rs1363280160 5337 dbSNP
rs781278737 5337 dbSNP
rs961275032 5337 dbSNP
rs1304459630 5338 dbSNP
rs1031938322 5343 dbSNP
rs1017017106 5355 dbSNP
rs1231196549 5356 dbSNP
rs16958576 5361 dbSNP
rs1344280971 5365 dbSNP
rs1205500623 5368 dbSNP
rs1249725863 5373 dbSNP
rs543804158 5374 dbSNP
rs201735675 5375 dbSNP
rs138417751 5377 dbSNP
rs550116503 5378 dbSNP
rs1320162367 5382 dbSNP
rs1013086194 5394 dbSNP
rs894231463 5395 dbSNP
rs200237114 5401 dbSNP
rs531885723 5402 dbSNP
rs150143090 5404 dbSNP
rs897460983 5407 dbSNP
rs546269252 5408 dbSNP
rs1300758318 5414 dbSNP
rs776114491 5417 dbSNP
rs1185984315 5419 dbSNP
rs999412575 5420 dbSNP
rs1269950710 5422 dbSNP
rs1244363789 5431 dbSNP
rs577928428 5440 dbSNP
rs183010208 5448 dbSNP
rs140851892 5452 dbSNP
rs1489282681 5453 dbSNP
rs150983354 5454 dbSNP
rs1169139547 5457 dbSNP
rs890366377 5458 dbSNP
rs1043221457 5464 dbSNP
rs1461156025 5464 dbSNP
rs574408650 5467 dbSNP
rs879164059 5468 dbSNP
rs1325224579 5472 dbSNP
rs931779233 5477 dbSNP
rs889536507 5483 dbSNP
rs1213512880 5485 dbSNP
rs1361979954 5488 dbSNP
rs1271870523 5489 dbSNP
rs556386323 5491 dbSNP
rs1293177286 5494 dbSNP
rs1450279888 5498 dbSNP
rs1405172335 5500 dbSNP