miRTarBase - #MIRT637693 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CEP89   
Synonyms CCDC123, CEP123
Description centrosomal protein 89
Transcript NM_032816   
Expression
Putative miRNA Targets on CEP89
3'UTR of CEP89
(miRNA target sites are highlighted)
>CEP89|NM_032816|3'UTR
   1 AATCTGCGGGAGCCCGTGGTGTAGCCTCCTCTGGCCTGAAAGGTCTGCCTCACACAGGCCTTCCCTGCAGGGCAGCCCAT
  81 GGTGGCAGCCGGAGGTGCGTAAGCCCACTGAACGCTGCAGGGCAGGGAAGAAATAAATGGTCTCATAGTTTAATCCATTG
 161 ATAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||  ||| ||  ||:|| | 
Target 5' gtAAGCCCACTG-AACGCTGCa 3'
99 - 119 107.00 -14.70
2
miRNA  3' guUUGUGGUAACA-GUGUGAGGu 5'
            |:| ||:| || :|  |||| 
Target 5' ggAGC-CCGTGGTGTAGCCTCCt 3'
9 - 30 95.00 -12.70
3
miRNA  3' guUUGUGGUAAC--AGUGUGaggu 5'
            || ::|  ||  ||||||    
Target 5' gaAAGGTC--TGCCTCACACaggc 3'
38 - 59 94.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26970470 7 COSMIC
COSN30106493 8 COSMIC
COSN15020634 15 COSMIC
COSN30468209 15 COSMIC
COSN31593638 17 COSMIC
COSN27107177 66 COSMIC
COSN17406984 93 COSMIC
COSN31596006 100 COSMIC
COSN31500087 101 COSMIC
COSN30506116 106 COSMIC
COSN31573543 130 COSMIC
COSN9849302 522 COSMIC
COSN9355037 603 COSMIC
COSN20723977 1112 COSMIC
COSN1766545 1317 COSMIC
COSN20979961 1386 COSMIC
COSN6142791 1424 COSMIC
COSN22425178 1707 COSMIC
COSN1214289 1747 COSMIC
COSN28895136 1868 COSMIC
COSN1766544 2134 COSMIC
COSN9849301 2761 COSMIC
COSN23751691 2809 COSMIC
COSN8259577 2934 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1411132150 3 dbSNP
rs757097133 4 dbSNP
rs199880123 7 dbSNP
rs763978785 8 dbSNP
rs762805067 12 dbSNP
rs1303919744 14 dbSNP
rs745439546 15 dbSNP
rs377001468 16 dbSNP
rs759191975 19 dbSNP
rs776078700 20 dbSNP
rs905516334 21 dbSNP
rs1482441009 24 dbSNP
rs770493510 26 dbSNP
rs532070824 31 dbSNP
rs1319226051 35 dbSNP
rs1289256370 38 dbSNP
rs1488138847 39 dbSNP
rs1191698444 43 dbSNP
rs1266358993 49 dbSNP
rs932411929 54 dbSNP
rs1427077692 59 dbSNP
rs1489187755 63 dbSNP
rs898208066 66 dbSNP
rs1037984252 67 dbSNP
rs1426532324 89 dbSNP
rs1263253819 90 dbSNP
rs559764233 91 dbSNP
rs1431205534 98 dbSNP
rs145640340 99 dbSNP
rs1348766457 105 dbSNP
rs1297320505 109 dbSNP
rs1311154733 113 dbSNP
rs1295813519 114 dbSNP
rs1360406449 116 dbSNP
rs1237742293 125 dbSNP
rs185168817 135 dbSNP
rs1326527877 137 dbSNP
rs895528489 142 dbSNP
rs939186806 144 dbSNP
rs1322392872 147 dbSNP
rs1223787484 148 dbSNP
rs1248389948 155 dbSNP
rs539347139 158 dbSNP
rs981301888 159 dbSNP
rs374849523 160 dbSNP
rs1454488386 166 dbSNP
rs1036932775 171 dbSNP
rs1248388791 172 dbSNP
rs1022332140 175 dbSNP
rs1365811483 176 dbSNP
rs1161281397 177 dbSNP
rs112767280 178 dbSNP
rs1439505868 180 dbSNP
rs956667498 180 dbSNP
rs2868196 183 dbSNP
rs943256453 183 dbSNP
rs2077201 184 dbSNP
rs1163191256 185 dbSNP
rs1367789358 185 dbSNP
rs879528551 185 dbSNP
rs954745519 187 dbSNP
rs1009116797 188 dbSNP
rs372397715 188 dbSNP
rs1196068235 189 dbSNP
rs777462289 190 dbSNP
rs1264638287 191 dbSNP
rs1268606444 191 dbSNP
rs1208776615 192 dbSNP
rs913962403 194 dbSNP
rs1287758171 195 dbSNP
rs1214123198 198 dbSNP
rs1183146067 200 dbSNP
rs1292829738 200 dbSNP
rs1472892594 200 dbSNP
rs71336972 200 dbSNP
rs1468571895 209 dbSNP
rs1333878099 218 dbSNP
rs551468954 225 dbSNP
rs1359990372 231 dbSNP
rs1352737614 234 dbSNP
rs1303985357 241 dbSNP
rs1235324910 242 dbSNP
rs1450442475 244 dbSNP
rs1029161353 246 dbSNP
rs988267004 247 dbSNP
rs997025489 255 dbSNP
rs1349950405 257 dbSNP
rs898239270 258 dbSNP
rs1288910708 259 dbSNP
rs1038058129 260 dbSNP
rs1198536636 262 dbSNP
rs1382884195 264 dbSNP
rs558794746 269 dbSNP
rs1211792655 273 dbSNP
rs886738372 294 dbSNP
rs1296605712 299 dbSNP
rs1230734109 305 dbSNP
rs539167942 326 dbSNP
rs1471985713 327 dbSNP
rs180690203 329 dbSNP
rs1414878622 338 dbSNP
rs939278759 352 dbSNP
rs1172413455 358 dbSNP
rs1426276246 359 dbSNP
rs1376447624 364 dbSNP
rs1002379645 366 dbSNP
rs969587575 377 dbSNP
rs1025245428 379 dbSNP
rs926471804 379 dbSNP
rs553436254 381 dbSNP
rs536611885 382 dbSNP
rs1377598145 385 dbSNP
rs568386642 389 dbSNP
rs1230932920 391 dbSNP
rs1197501166 397 dbSNP
rs895509531 405 dbSNP
rs1345437111 407 dbSNP
rs1220682367 408 dbSNP
rs1047936025 409 dbSNP
rs993295821 410 dbSNP
rs746641 413 dbSNP
rs946513887 421 dbSNP
rs915346196 422 dbSNP
rs943225196 440 dbSNP
rs567820338 443 dbSNP
rs910440161 444 dbSNP
rs1051713364 445 dbSNP
rs1202011801 454 dbSNP
rs988184679 455 dbSNP
rs11671966 457 dbSNP
rs1170605973 465 dbSNP
rs911889580 468 dbSNP
rs988169371 469 dbSNP
rs777499060 471 dbSNP
rs79874975 479 dbSNP
rs77976196 480 dbSNP
rs376396746 482 dbSNP
rs1438385544 495 dbSNP
rs969574821 496 dbSNP
rs1276465110 498 dbSNP
rs995030918 499 dbSNP
rs1399623374 506 dbSNP
rs1276241073 516 dbSNP
rs1013879123 517 dbSNP
rs963492790 530 dbSNP
rs959966890 533 dbSNP
rs1336525048 535 dbSNP
rs1025946141 538 dbSNP
rs35995416 542 dbSNP
rs576381543 544 dbSNP
rs1187118346 545 dbSNP
rs1016644433 554 dbSNP
rs1450395887 565 dbSNP
rs1190739136 566 dbSNP
rs190920792 576 dbSNP
rs886813307 577 dbSNP
rs898896524 586 dbSNP
rs1056113697 589 dbSNP
rs187342813 593 dbSNP
rs563370720 597 dbSNP
rs1391393710 602 dbSNP
rs781257847 603 dbSNP
rs117630116 607 dbSNP
rs1465633226 618 dbSNP
rs1045361632 628 dbSNP
rs753010231 629 dbSNP
rs1364191263 631 dbSNP
rs1435439567 643 dbSNP
rs1425148867 644 dbSNP
rs888972527 650 dbSNP
rs1338272708 652 dbSNP
rs533300718 658 dbSNP
rs1265489936 669 dbSNP
rs1359121971 674 dbSNP
rs766398935 675 dbSNP
rs1052555599 678 dbSNP
rs1237732092 683 dbSNP
rs1189308397 696 dbSNP
rs115760198 705 dbSNP
rs936671992 706 dbSNP
rs925347434 716 dbSNP
rs911906299 717 dbSNP
rs1423414804 719 dbSNP
rs1188395005 721 dbSNP
rs987477910 726 dbSNP
rs931948948 728 dbSNP
rs1387747809 731 dbSNP
rs181891385 736 dbSNP
rs974026715 738 dbSNP
rs386808721 739 dbSNP
rs561429892 741 dbSNP
rs1395056986 743 dbSNP
rs1256213264 745 dbSNP
rs55851701 746 dbSNP
rs536563145 747 dbSNP
rs1225977511 756 dbSNP
rs1330378140 760 dbSNP
rs982518480 761 dbSNP
rs951121167 762 dbSNP
rs565500778 767 dbSNP
rs1483071391 768 dbSNP
rs951623539 773 dbSNP
rs1258427320 775 dbSNP
rs764053952 777 dbSNP
rs1035153291 780 dbSNP
rs1003228697 785 dbSNP
rs142296375 786 dbSNP
rs963042211 787 dbSNP
rs1449638307 788 dbSNP
rs1398799759 789 dbSNP
rs1161066288 793 dbSNP
rs1375714433 798 dbSNP
rs1373987312 807 dbSNP
rs904817181 810 dbSNP
rs1328647780 818 dbSNP
rs190144010 822 dbSNP
rs765664282 824 dbSNP
rs893684277 829 dbSNP
rs573388717 835 dbSNP
rs1030128993 842 dbSNP
rs935432691 844 dbSNP
rs1230744930 848 dbSNP
rs1299727224 855 dbSNP
rs1311964114 860 dbSNP
rs890559972 864 dbSNP
rs1234351370 868 dbSNP
rs1471649915 872 dbSNP
rs1367672018 883 dbSNP
rs1257992065 890 dbSNP
rs1179082429 900 dbSNP
rs1459011437 904 dbSNP
rs1204582143 905 dbSNP
rs1252585045 909 dbSNP
rs573774619 910 dbSNP
rs1198034634 917 dbSNP
rs1265106006 917 dbSNP
rs932006054 937 dbSNP
rs1432389357 939 dbSNP
rs1468976648 961 dbSNP
rs536649815 962 dbSNP
rs1427399476 963 dbSNP
rs921917179 964 dbSNP
rs1226822393 980 dbSNP
rs777260989 981 dbSNP
rs892357225 987 dbSNP
rs1355987440 994 dbSNP
rs1292306736 995 dbSNP
rs1367439629 1007 dbSNP
rs764601958 1011 dbSNP
rs936639037 1014 dbSNP
rs1340350191 1016 dbSNP
rs531457567 1032 dbSNP
rs73041757 1040 dbSNP
rs1275512773 1042 dbSNP
rs376472164 1053 dbSNP
rs553979858 1067 dbSNP
rs1219376132 1074 dbSNP
rs1263642563 1075 dbSNP
rs908078120 1075 dbSNP
rs917997738 1075 dbSNP
rs1309195349 1077 dbSNP
rs1447356861 1080 dbSNP
rs1187527292 1086 dbSNP
rs557067656 1090 dbSNP
rs983596310 1097 dbSNP
rs1411165992 1104 dbSNP
rs112600495 1107 dbSNP
rs1349963842 1112 dbSNP
rs1458851054 1114 dbSNP
rs1328418716 1115 dbSNP
rs1363464952 1122 dbSNP
rs930150969 1127 dbSNP
rs1298628320 1128 dbSNP
rs1364289445 1130 dbSNP
rs1226714436 1131 dbSNP
rs1325027816 1136 dbSNP
rs569036248 1139 dbSNP
rs982234746 1140 dbSNP
rs969115951 1148 dbSNP
rs963012853 1149 dbSNP
rs1441337886 1151 dbSNP
rs1207815141 1153 dbSNP
rs1248280067 1155 dbSNP
rs112683198 1162 dbSNP
rs1179643274 1163 dbSNP
rs1177943467 1164 dbSNP
rs1478356018 1175 dbSNP
rs985764674 1180 dbSNP
rs1248517256 1181 dbSNP
rs139678953 1183 dbSNP
rs1451218906 1185 dbSNP
rs1287047033 1186 dbSNP
rs1219180379 1192 dbSNP
rs1324329815 1195 dbSNP
rs1351975012 1208 dbSNP
rs1030511606 1210 dbSNP
rs1387018577 1220 dbSNP
rs1235662346 1222 dbSNP
rs1370430549 1224 dbSNP
rs1321595281 1226 dbSNP
rs1276083677 1235 dbSNP
rs893715535 1242 dbSNP
rs1030895383 1247 dbSNP
rs1433716737 1249 dbSNP
rs999380375 1272 dbSNP
rs1283731486 1276 dbSNP
rs997329321 1278 dbSNP
rs1235141296 1287 dbSNP
rs566255724 1296 dbSNP
rs368028967 1297 dbSNP
rs546245095 1300 dbSNP
rs932053902 1313 dbSNP
rs529652883 1315 dbSNP
rs560981668 1321 dbSNP
rs903783103 1322 dbSNP
rs1045047959 1325 dbSNP
rs1483300292 1338 dbSNP
rs75533701 1339 dbSNP
rs747994863 1346 dbSNP
rs908151833 1352 dbSNP
rs1157891976 1354 dbSNP
rs1472534038 1354 dbSNP
rs1410602537 1356 dbSNP
rs1413047439 1358 dbSNP
rs1047927249 1360 dbSNP
rs1414951961 1361 dbSNP
rs896541118 1364 dbSNP
rs1427236758 1369 dbSNP
rs1056980565 1370 dbSNP
rs1392091268 1371 dbSNP
rs1306213292 1374 dbSNP
rs531268594 1386 dbSNP
rs1279995508 1387 dbSNP
rs758490467 1387 dbSNP
rs930140189 1387 dbSNP
rs1477751219 1389 dbSNP
rs938870937 1394 dbSNP
rs928788266 1396 dbSNP
rs1212452460 1397 dbSNP
rs918789410 1397 dbSNP
rs1248960973 1408 dbSNP
rs1483048922 1425 dbSNP
rs1183531569 1427 dbSNP
rs1264095215 1429 dbSNP
rs1038581034 1432 dbSNP
rs981923289 1440 dbSNP
rs565402453 1441 dbSNP
rs1426175427 1444 dbSNP
rs545636125 1456 dbSNP
rs1166842243 1462 dbSNP
rs1370009103 1468 dbSNP
rs1410444578 1468 dbSNP
rs985733584 1469 dbSNP
rs916278836 1480 dbSNP
rs989161069 1484 dbSNP
rs1434072909 1486 dbSNP
rs923030466 1488 dbSNP
rs1056636035 1491 dbSNP
rs956560937 1491 dbSNP
rs1271943211 1494 dbSNP
rs1340849441 1495 dbSNP
rs111468181 1497 dbSNP
rs1000703982 1503 dbSNP
rs1030927827 1506 dbSNP
rs73041755 1507 dbSNP
rs562524395 1508 dbSNP
rs186494215 1509 dbSNP
rs1012238117 1511 dbSNP
rs1389724993 1512 dbSNP
rs996303396 1518 dbSNP
rs1343680768 1530 dbSNP
rs1398600154 1534 dbSNP
rs1403514591 1544 dbSNP
rs777270638 1546 dbSNP
rs1056549532 1556 dbSNP
rs1442745797 1561 dbSNP
rs900595341 1575 dbSNP
rs754903342 1585 dbSNP
rs1363945374 1601 dbSNP
rs1338034835 1602 dbSNP
rs1006179751 1610 dbSNP
rs1354920203 1612 dbSNP
rs146373635 1617 dbSNP
rs1048000807 1619 dbSNP
rs1207165359 1622 dbSNP
rs1247680184 1623 dbSNP
rs1429307653 1624 dbSNP
rs941547987 1627 dbSNP
rs911444172 1631 dbSNP
rs202208156 1634 dbSNP
rs938930562 1637 dbSNP
rs931665603 1645 dbSNP
rs1395053709 1649 dbSNP
rs1159296338 1650 dbSNP
rs928843264 1653 dbSNP
rs1318249226 1659 dbSNP
rs1462836642 1659 dbSNP
rs1413909536 1660 dbSNP
rs535291926 1664 dbSNP
rs181328809 1665 dbSNP
rs948887191 1667 dbSNP
rs1338183788 1668 dbSNP
rs1364026762 1687 dbSNP
rs1243364509 1688 dbSNP
rs1476950304 1689 dbSNP
rs1262788696 1691 dbSNP
rs866820778 1694 dbSNP
rs142416938 1695 dbSNP
rs989192353 1696 dbSNP
rs957701832 1699 dbSNP
rs1267871184 1705 dbSNP
rs1486350024 1711 dbSNP
rs923597189 1711 dbSNP
rs79065831 1714 dbSNP
rs1254261210 1716 dbSNP
rs954773167 1733 dbSNP
rs1030217624 1735 dbSNP
rs1418524511 1737 dbSNP
rs1476128207 1739 dbSNP
rs996428877 1755 dbSNP
rs991182883 1757 dbSNP
rs1362993681 1759 dbSNP
rs960730869 1761 dbSNP
rs1319285845 1763 dbSNP
rs538453310 1771 dbSNP
rs1399554290 1774 dbSNP
rs11670695 1775 dbSNP
rs537196119 1777 dbSNP
rs1219982975 1779 dbSNP
rs375106557 1785 dbSNP
rs1315642205 1787 dbSNP
rs1006254783 1788 dbSNP
rs1357970125 1793 dbSNP
rs897219793 1812 dbSNP
rs886481391 1813 dbSNP
rs1047717540 1814 dbSNP
rs552742475 1824 dbSNP
rs1050004057 1827 dbSNP
rs1447181736 1829 dbSNP
rs1401005170 1830 dbSNP
rs1211735465 1833 dbSNP
rs934204817 1836 dbSNP
rs1486643807 1839 dbSNP
rs536394780 1847 dbSNP
rs1179916582 1864 dbSNP
rs901430338 1868 dbSNP
rs1040423027 1873 dbSNP
rs1003160093 1876 dbSNP
rs935025756 1879 dbSNP
rs923674010 1886 dbSNP
rs1464161073 1887 dbSNP
rs1423114201 1888 dbSNP
rs907455606 1889 dbSNP
rs758589896 1903 dbSNP
rs916450130 1910 dbSNP
rs750665427 1911 dbSNP
rs1412064638 1914 dbSNP
rs371206952 1917 dbSNP
rs893278082 1921 dbSNP
rs1181692701 1924 dbSNP
rs1393532063 1925 dbSNP
rs1458585699 1929 dbSNP
rs990675116 1931 dbSNP
rs1330791212 1937 dbSNP
rs550564516 1951 dbSNP
rs1034959509 1957 dbSNP
rs1340139034 1959 dbSNP
rs1204448099 1965 dbSNP
rs1053560023 1968 dbSNP
rs1250725380 1972 dbSNP
rs1199924669 1990 dbSNP
rs770834957 1991 dbSNP
rs936405591 1997 dbSNP
rs1264988130 2000 dbSNP
rs34035782 2002 dbSNP
rs1396450985 2003 dbSNP
rs757564234 2014 dbSNP
rs932963855 2017 dbSNP
rs1310281807 2023 dbSNP
rs1245023463 2024 dbSNP
rs1355665985 2035 dbSNP
rs1463957923 2037 dbSNP
rs1005628197 2038 dbSNP
rs1394197842 2039 dbSNP
rs1442007957 2044 dbSNP
rs1305912460 2069 dbSNP
rs1363244904 2072 dbSNP
rs77193470 2073 dbSNP
rs200252724 2086 dbSNP
rs117274342 2088 dbSNP
rs1016033625 2093 dbSNP
rs901393182 2094 dbSNP
rs566035594 2097 dbSNP
rs560034300 2104 dbSNP
rs1294254314 2105 dbSNP
rs934966966 2106 dbSNP
rs1459623060 2113 dbSNP
rs902221607 2116 dbSNP
rs1348401384 2119 dbSNP
rs1043486634 2130 dbSNP
rs950794824 2131 dbSNP
rs188562125 2133 dbSNP
rs1440725294 2134 dbSNP
rs1003286914 2136 dbSNP
rs907176083 2141 dbSNP
rs1023650768 2144 dbSNP
rs775914260 2145 dbSNP
rs1417697457 2152 dbSNP
rs1013152823 2153 dbSNP
rs893330381 2154 dbSNP
rs529424094 2155 dbSNP
rs934783885 2158 dbSNP
rs1430268588 2160 dbSNP
rs1289593101 2173 dbSNP
rs563598482 2176 dbSNP
rs902268641 2190 dbSNP
rs765885316 2191 dbSNP
rs762518144 2194 dbSNP
rs1274789852 2197 dbSNP
rs909853343 2213 dbSNP
rs1354156989 2214 dbSNP
rs1287979945 2217 dbSNP
rs1242267953 2220 dbSNP
rs1486568163 2223 dbSNP
rs1237853606 2225 dbSNP
rs1257485412 2246 dbSNP
rs984090257 2255 dbSNP
rs954105744 2263 dbSNP
rs1028420503 2273 dbSNP
rs370017033 2278 dbSNP
rs1302036969 2285 dbSNP
rs543821143 2287 dbSNP
rs965599323 2292 dbSNP
rs1302789815 2299 dbSNP
rs922950157 2308 dbSNP
rs1354794046 2312 dbSNP
rs1032338951 2313 dbSNP
rs1294971246 2324 dbSNP
rs999140531 2327 dbSNP
rs1222932933 2338 dbSNP
rs1284544921 2341 dbSNP
rs529168636 2355 dbSNP
rs1318303939 2361 dbSNP
rs975089539 2372 dbSNP
rs1256179745 2375 dbSNP
rs943287300 2404 dbSNP
rs1157287086 2410 dbSNP
rs1419603166 2415 dbSNP
rs1250175777 2429 dbSNP
rs1469969337 2433 dbSNP
rs1043371536 2434 dbSNP
rs1378757721 2443 dbSNP
rs1198903966 2444 dbSNP
rs1376138148 2452 dbSNP
rs183782886 2456 dbSNP
rs984595966 2461 dbSNP
rs772837977 2466 dbSNP
rs769380250 2467 dbSNP
rs1264747173 2476 dbSNP
rs1279900909 2477 dbSNP
rs981519030 2488 dbSNP
rs558440951 2490 dbSNP
rs971831006 2491 dbSNP
rs1022944750 2492 dbSNP
rs927856813 2494 dbSNP
rs1212344479 2496 dbSNP
rs1271544977 2503 dbSNP
rs1214234063 2513 dbSNP
rs1437728427 2526 dbSNP
rs376009179 2528 dbSNP
rs893402589 2552 dbSNP
rs1256543733 2555 dbSNP
rs939902950 2556 dbSNP
rs148788780 2560 dbSNP
rs999043935 2561 dbSNP
rs903322886 2569 dbSNP
rs954102932 2574 dbSNP
rs1394294427 2582 dbSNP
rs921332909 2589 dbSNP
rs1042560283 2605 dbSNP
rs1400820403 2606 dbSNP
rs1438373846 2610 dbSNP
rs1342664072 2611 dbSNP
rs976904536 2612 dbSNP
rs1235909409 2621 dbSNP
rs997257707 2627 dbSNP
rs144396401 2630 dbSNP
rs1339371408 2644 dbSNP
rs1038688992 2648 dbSNP
rs943004316 2649 dbSNP
rs909135458 2651 dbSNP
rs968933301 2652 dbSNP
rs1253898866 2656 dbSNP
rs1469964784 2660 dbSNP
rs1021895561 2665 dbSNP
rs1010562660 2683 dbSNP
rs1372576507 2684 dbSNP
rs894834277 2691 dbSNP
rs1003326968 2702 dbSNP
rs906278851 2707 dbSNP
rs1048941210 2712 dbSNP
rs552781373 2714 dbSNP
rs1442628677 2718 dbSNP
rs919082612 2723 dbSNP
rs1227448178 2730 dbSNP
rs1316387636 2734 dbSNP
rs909790923 2734 dbSNP
rs1333274054 2738 dbSNP
rs981954755 2762 dbSNP
rs1048324840 2765 dbSNP
rs932643228 2767 dbSNP
rs1337312130 2769 dbSNP
rs1203621484 2796 dbSNP
rs1261235082 2798 dbSNP
rs971501642 2799 dbSNP
rs1191182277 2800 dbSNP
rs1447682185 2811 dbSNP
rs915949557 2828 dbSNP
rs991492824 2833 dbSNP
rs1265298026 2834 dbSNP
rs11666472 2835 dbSNP
rs543639437 2847 dbSNP
rs111740430 2848 dbSNP
rs999096215 2849 dbSNP
rs1156458983 2850 dbSNP
rs1383728854 2854 dbSNP
rs1482267713 2861 dbSNP
rs977554777 2865 dbSNP
rs556732674 2868 dbSNP
rs537059813 2876 dbSNP
rs1354166037 2877 dbSNP
rs113211034 2896 dbSNP
rs746933477 2897 dbSNP
rs1021866174 2905 dbSNP
rs1357777636 2907 dbSNP
rs1237279072 2923 dbSNP
rs997707852 2935 dbSNP
rs771238725 2937 dbSNP
rs1276568600 2938 dbSNP
rs1351636007 2939 dbSNP
rs1227076638 2940 dbSNP
rs1341443609 2941 dbSNP
rs1134575 2954 dbSNP
rs1207024485 2965 dbSNP
rs901600473 2969 dbSNP
rs149550516 2970 dbSNP
rs551392047 2972 dbSNP
rs752720766 2975 dbSNP
rs887413260 2992 dbSNP
rs1048993900 2995 dbSNP
rs929218623 3006 dbSNP
rs765117730 3014 dbSNP
rs1179341192 3044 dbSNP
rs1362900249 3045 dbSNP
rs1003639840 3062 dbSNP
rs1406045449 3069 dbSNP
rs919120968 3076 dbSNP
rs1015326480 3078 dbSNP
rs369186922 3089 dbSNP
rs1390068827 3095 dbSNP
rs1306710257 3097 dbSNP
rs1465712889 3104 dbSNP
rs1336637810 3108 dbSNP
rs1241448323 3110 dbSNP
rs949886101 3114 dbSNP
rs916017785 3115 dbSNP
rs779922005 3121 dbSNP
rs1211625319 3134 dbSNP
rs528820748 3137 dbSNP
rs138342316 3141 dbSNP
rs1193904674 3147 dbSNP
rs1368812383 3158 dbSNP
rs745881224 3159 dbSNP
rs571962902 3160 dbSNP
rs565404224 3172 dbSNP
rs925926286 3174 dbSNP
rs553714723 3179 dbSNP
rs563687561 3195 dbSNP
rs1361460075 3198 dbSNP
rs1460907274 3199 dbSNP
rs1298034015 3203 dbSNP
rs1421950740 3214 dbSNP
rs74798671 3217 dbSNP
rs1393441172 3224 dbSNP
rs541389211 3235 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' aucAUGCCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000305768.5 | 3UTR | UGAUCAUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000305768.5 | 3UTR | UGAUCAUGCCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*