miRTarBase - #MIRT637788 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OLA1   
Synonyms DOC45, GBP45, GTBP9, GTPBP9, PTD004
Description Obg like ATPase 1
Transcript NM_001011708   
Other Transcripts NM_013341   
Expression
Putative miRNA Targets on OLA1
3'UTR of OLA1
(miRNA target sites are highlighted)
>OLA1|NM_001011708|3'UTR
   1 AATTTAGTTATTGCTCAGATAAACATACAACTTCCAAAAGGCATCTGATTTTTAAAAAATTAAAATTTCTGAAAACCAAT
  81 GCGACAAATAAAGTTGGGGAGATGGGAATCTTTGACAAACAAATTATTTTTATTTGTTTTAAAATTAAAATACTGTGTAC
 161 CCCCCCCCCCCCATGAAATGCAGGTTCACTAAATGTGAACAGCTTTGCTTTTCACGTGATTAAGACCCTACTCCAAATTG
 241 TAGAAGCTTTTCAGGAACCATATTACTCTCATGATACTTCATTAATCTCCATCATGTATGCCAAGCCTGACACATTTGAC
 321 AGTGAGGACAATGTGGCTTGCTCCTTTTTGAATCTACAGATAATGCATGTTTTACAGTACTCCAGATGTCTACACTCAAT
 401 AAAACATTTGACAAAACCAGCCTTGGTGTGTTTGGGGATGTCTGTATTGACTGACTGTGGTGTGCTGAATGCGATACGGC
 481 ACCTGGTGGTTGCTGATTACAGAATTTTAAGGCGTGTGTATGACACAGTAACTGGCAGTGTGGGGCAGCTGCAATTGTAT
 561 CTTAAAAGTGAGTCTTTCATGGGAATCAGAAGAATAGTATACCAGGGATTTGTCTCAAAAAAGTTAATTAATTTATAGAT
 641 CAACATTTATTGAAAGATGATAGCAATGATATTATGAGGGATATGAGATAGGTGACTGACCACAAAGAAGAAAATTCTGT
 721 CTCAAAAATTAAAGAATTTTGTTTGTTATTGTTGTTCTGACCATATTGAAAAGAGGTTCACTTTTAATCTTTCCTTTGAA
 801 ATTATTAAATTGTAAAAACTGACCCATTGATGTCTGGTGGGTTATGTTTTGCTTCAATTCAGCAATGTGTATAAAAGTTC
 881 CTACACTGATTTTGAAATACTAAGATCAGACTTTGAAAATTTTAAAAATTCTTTCATTCTTACTTTTCAGATATTTGAGA
 961 GCAGTCGAAGTGGTAGTATGGGTAAGTTAAGCACTTCTTAACATTGTAGCAGAAAATTCCAAAAGAAAGACTAGAACAAA
1041 TTGGTAATTTGGAGACCCTTTGCCACTTAGCCTTCTCTTGTGATGATGGCCTGAAAGCTCTCTCGGCCCTGAGCCTCCCT
1121 TTCTCTCCCATGTTTCCATTCCTGTGAGACCTCCCTTCCTTGTCCTTGTCCTCTGCCCTTTTGTGCTCTTCTGTGATCAC
1201 AGGACCATTTCCATGGAATGCAGATTCATACCCAGCCAGCCTTTGCCTCTACTGTATCGCTTTGGGACTTTAAAGATGCA
1281 GAAGTATTAGAACACACACAAACTTAAAATGGAAAGTTACCAAATGTAGCACTAGAGGCAAGAAAAGGGGTGATTTTTTA
1361 AAGATTTGGCTATACTTAAGATATTTAAAGAGGATGAGGTTGAGTCGTGAGTATAATTTAGAAGCTCTCCAGTGAGTATT
1441 TTTTTAGTATCAAATAGTGATCTTCTTTTGCTAACATAAAAATGAGTAAACTACAGCAGAGAAATAAGAATAAAACTAAT
1521 GAAGGGTTTTTTAAAAGAACTAAATAAAACAAATAAAACTAGGCTACAGGTATAGCTGACCAAGTTTGCTGTGAAAAATC
1601 CTTGTTATATCTATTTCTGTATTGGAGTAATGTGTAGATTAGTGGATTGTTAGGGATTTCAGCAGTATAAGAAAGAATCA
1681 AATATCTTGCTTTTGGGTCTTCTCCAAAGTAAATTGCATGGACTTCTTAAAGAAGTTTGAAATCAGTAAAAAGACATTAG
1761 GATCATGCAATTTTACTTTGTCTAGCTTCTAATGTGGTAAATTGCACATTGTGCAACAGAACCATTAATAAAAGAAAGGA
1841 GTTAGTTTTGAGGTAACTGCATTCATTAGGGGCTGAAAATAAATGTTAAAAATGTTTAATTTGGTTAGAAGTTCTACAAC
1921 ATTGTATGTACATATACAAAATTTCATTTTCTCTGAAAGTCGAGAATTCCAAGAACTGTTACATATAATCATATATATGC
2001 CTATATCTAAACGTTTTCCCTCCTTTAATATTGATAAAGTTAATATATTTTAGGATGTTATGTAAATATTTTTGCATGTA
2081 TCTGTAGCTCCATCTTAATCAAATTTATGGTTAAAAGAGATTTGAGGCCAGGCGTGGAGGCTCACACCTATAATCCCAAC
2161 ACTTTGGGAGGCCGAGGTGGGAGGATCACTTGAGCACAGGAGTTTGAGACCAGCCTGTGCAACATCATGAAACATCATCT
2241 CTACATAAAAAAATACATATATACAAAAATTAGCTGGGCATCATGGCACACACCTGTAGTCCCAGCTACTTAGGAGGCTG
2321 AGATGGGAGGATTGATCGATCGCTTGAGCCTGGGAGGTGGAGGCTACTGTGAGCCATGATCATGCCACTGCACTCCAGCC
2401 TGGGCAACAGAGTGAGACCCTGTCTCCAAAGAGAAAGAGAAACTTGAGAAGGCTTGTGCCCAAAGCTTGAAGAAAGATTG
2481 TAATAGCATTTAGTTGTGTTTTATCATGTTATCTTCATAACATGCATTTTGCATATGGCTCAGAGCAGAGCCGGATCTCC
2561 CAAGGAAGCACAAATAGTTTTTGTCGCTAACTTAGTTATGAGTGAAGCCTCTGTTCACTTATAACTTGCCAGTTTCATTG
2641 GTGGAATAAGTCCCCTTACTCATGATTCATCAATATTCCTATATTAAAATTCCAGTTTGATGTTTGTCTCTAGTTGTCTG
2721 TGTATAATATTTCCAAAGCTCCTTTGTAAACCCCGTCTCCTTTCATTCAGAGAGTCAGAGACGGTATCTCCTCCTCCTGC
2801 CTCTTCTATTGTTCTGATTAGTCTACTTAAATTCACTTGATGCTCTTTTTATTTTACAAGAGACTTGAGAAATGTCGGTT
2881 GTTCCTAATGGCAAACTACTTTAGCTGGGAAAATTCATTTCAACTTATTTTAAGCTTGTAAAATACACTGTGGTGATAAA
2961 ATAAAAGAGCTGGGTTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGU-AACAG-UGUGAGgu 5'
             || |||  |||| ||||||  
Target 5' agtACTCCAGATGTCTACACTCaa 3'
376 - 399 143.00 -16.60
2
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' atcATGCCACT---GCACTCCa 3'
2379 - 2397 136.00 -13.60
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::||:|| || ||||| || 
Target 5' tgGGCATCA-TGGCACACACCt 3'
2275 - 2295 135.00 -17.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26645710 54 COSMIC
COSN30136174 75 COSMIC
COSN31612114 82 COSMIC
COSN30146063 83 COSMIC
COSN31525157 87 COSMIC
COSN30129464 110 COSMIC
COSN27414539 160 COSMIC
COSN26066947 169 COSMIC
COSN15350266 170 COSMIC
COSN20097390 170 COSMIC
COSN29081884 170 COSMIC
COSN31592165 217 COSMIC
COSN22191753 318 COSMIC
COSN8273928 405 COSMIC
COSN22335969 467 COSMIC
COSN26586818 513 COSMIC
COSN31485310 513 COSMIC
COSN31961745 652 COSMIC
COSN22987081 687 COSMIC
COSN7147213 717 COSMIC
COSN30066226 802 COSMIC
COSN20097389 966 COSMIC
COSN20941985 1128 COSMIC
COSN32055920 1259 COSMIC
COSN15380721 1822 COSMIC
COSN1807293 1882 COSMIC
COSN20090678 1920 COSMIC
COSN6155002 1924 COSMIC
COSN16133167 2070 COSMIC
COSN9866950 2517 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774522182 1 dbSNP
rs1241115661 2 dbSNP
rs1046824296 14 dbSNP
rs771164602 16 dbSNP
rs372370009 17 dbSNP
rs749421391 20 dbSNP
rs1283515074 21 dbSNP
rs778120859 25 dbSNP
rs1351657080 26 dbSNP
rs756416702 33 dbSNP
rs1447880240 40 dbSNP
rs377223903 41 dbSNP
rs746776961 54 dbSNP
rs1261135717 55 dbSNP
rs942225579 60 dbSNP
rs923457122 68 dbSNP
rs13390888 69 dbSNP
rs907605201 72 dbSNP
rs1226751278 73 dbSNP
rs983174834 79 dbSNP
rs139913634 81 dbSNP
rs556506955 82 dbSNP
rs964994807 83 dbSNP
rs536987884 87 dbSNP
rs1481601979 88 dbSNP
rs1205567345 92 dbSNP
rs990161119 102 dbSNP
rs1481963100 106 dbSNP
rs569962365 115 dbSNP
rs1189550114 124 dbSNP
rs1422717702 132 dbSNP
rs964652298 136 dbSNP
rs1031743226 141 dbSNP
rs146044287 144 dbSNP
rs1169813479 148 dbSNP
rs1370280414 151 dbSNP
rs1456514640 151 dbSNP
rs1163568557 157 dbSNP
rs966551889 158 dbSNP
rs955387462 159 dbSNP
rs1344443300 160 dbSNP
rs1395500562 160 dbSNP
rs1228991350 161 dbSNP
rs1010328017 162 dbSNP
rs539606097 162 dbSNP
rs565799400 163 dbSNP
rs1428202082 164 dbSNP
rs547488154 164 dbSNP
rs1193285882 165 dbSNP
rs1465693514 165 dbSNP
rs199610490 166 dbSNP
rs528963586 166 dbSNP
rs908060306 167 dbSNP
rs942171773 167 dbSNP
rs112003193 168 dbSNP
rs201488222 169 dbSNP
rs7274 169 dbSNP
rs1063613 170 dbSNP
rs1288138313 170 dbSNP
rs375221409 171 dbSNP
rs974423286 171 dbSNP
rs1289824575 172 dbSNP
rs556343057 172 dbSNP
rs1207513279 173 dbSNP
rs1491154532 173 dbSNP
rs58281097 173 dbSNP
rs779214032 173 dbSNP
rs964758080 174 dbSNP
rs1473018814 179 dbSNP
rs372571426 183 dbSNP
rs1008627730 190 dbSNP
rs1224198381 198 dbSNP
rs979357421 201 dbSNP
rs1290730633 208 dbSNP
rs1243758846 209 dbSNP
rs1434006445 213 dbSNP
rs971191508 215 dbSNP
rs1227343252 216 dbSNP
rs1286082215 219 dbSNP
rs1270628541 225 dbSNP
rs1228274857 228 dbSNP
rs1291200609 233 dbSNP
rs1321695404 240 dbSNP
rs1024149175 241 dbSNP
rs1254359072 244 dbSNP
rs13390490 246 dbSNP
rs11558986 252 dbSNP
rs1483595250 255 dbSNP
rs1181649909 258 dbSNP
rs1231462575 260 dbSNP
rs1473812525 271 dbSNP
rs1296627392 274 dbSNP
rs1163962468 276 dbSNP
rs1412934814 290 dbSNP
rs886620092 293 dbSNP
rs1170435728 296 dbSNP
rs1370873980 299 dbSNP
rs561560467 305 dbSNP
rs894389180 310 dbSNP
rs1017297713 311 dbSNP
rs1005203444 314 dbSNP
rs960138015 317 dbSNP
rs549738541 318 dbSNP
rs1448095763 329 dbSNP
rs1036205386 331 dbSNP
rs1001518042 336 dbSNP
rs905884534 339 dbSNP
rs531955661 340 dbSNP
rs564390082 350 dbSNP
rs756423265 358 dbSNP
rs886733338 365 dbSNP
rs1366647734 367 dbSNP
rs1188541278 373 dbSNP
rs1236922809 375 dbSNP
rs13390303 385 dbSNP
rs1442869272 398 dbSNP
rs1190356389 399 dbSNP
rs545996238 414 dbSNP
rs1047879518 418 dbSNP
rs933514893 421 dbSNP
rs1165989951 430 dbSNP
rs1423061634 432 dbSNP
rs1403864868 435 dbSNP
rs901575918 436 dbSNP
rs1333112759 442 dbSNP
rs114153284 443 dbSNP
rs933753642 451 dbSNP
rs1474811310 460 dbSNP
rs901982440 461 dbSNP
rs924949393 470 dbSNP
rs979131617 473 dbSNP
rs945267719 477 dbSNP
rs1040547105 478 dbSNP
rs1201191976 481 dbSNP
rs1480552166 482 dbSNP
rs1347601332 483 dbSNP
rs991986679 488 dbSNP
rs1219979901 493 dbSNP
rs767842004 501 dbSNP
rs960839310 511 dbSNP
rs560233828 513 dbSNP
rs779276595 514 dbSNP
rs112677257 523 dbSNP
rs1190966016 524 dbSNP
rs990832698 528 dbSNP
rs969990540 545 dbSNP
rs935964211 554 dbSNP
rs149530769 564 dbSNP
rs1338879225 566 dbSNP
rs977469812 574 dbSNP
rs971474670 577 dbSNP
rs1024847869 578 dbSNP
rs760098269 592 dbSNP
rs1027007190 602 dbSNP
rs1320696346 618 dbSNP
rs755201559 627 dbSNP
rs1225655441 628 dbSNP
rs1387321515 634 dbSNP
rs574868725 659 dbSNP
rs375493914 666 dbSNP
rs997672125 676 dbSNP
rs1282823009 683 dbSNP
rs902022800 691 dbSNP
rs1274471995 692 dbSNP
rs1321731904 696 dbSNP
rs751637018 701 dbSNP
rs1268809104 706 dbSNP
rs1464511987 707 dbSNP
rs958814221 710 dbSNP
rs1016831835 723 dbSNP
rs11460049 729 dbSNP
rs371010806 729 dbSNP
rs397752669 729 dbSNP
rs368767747 731 dbSNP
rs1451956246 736 dbSNP
rs1197968261 737 dbSNP
rs1005441726 740 dbSNP
rs867828843 744 dbSNP
rs753478962 748 dbSNP
rs1177961164 763 dbSNP
rs1469806129 767 dbSNP
rs1025270020 768 dbSNP
rs763626996 774 dbSNP
rs1410502978 776 dbSNP
rs1428179442 785 dbSNP
rs755641057 799 dbSNP
rs190767370 812 dbSNP
rs1043397967 819 dbSNP
rs1287625119 822 dbSNP
rs945046624 823 dbSNP
rs997849456 832 dbSNP
rs992497304 836 dbSNP
rs1344059620 847 dbSNP
rs1411838139 848 dbSNP
rs1233223142 851 dbSNP
rs1328573770 852 dbSNP
rs1181069250 853 dbSNP
rs1436007668 861 dbSNP
rs900913892 862 dbSNP
rs1237049841 864 dbSNP
rs1264858208 867 dbSNP
rs1039889291 883 dbSNP
rs1209202947 900 dbSNP
rs1324315137 904 dbSNP
rs1262784899 910 dbSNP
rs926449909 919 dbSNP
rs1250698573 923 dbSNP
rs943533055 931 dbSNP
rs1376042726 948 dbSNP
rs970110486 961 dbSNP
rs1370669841 963 dbSNP
rs186416020 965 dbSNP
rs17316500 967 dbSNP
rs35718686 967 dbSNP
rs374236772 968 dbSNP
rs1432087714 969 dbSNP
rs1026540050 975 dbSNP
rs1442203014 979 dbSNP
rs6737629 986 dbSNP
rs901971714 987 dbSNP
rs879285096 990 dbSNP
rs1243893787 1001 dbSNP
rs1289505724 1004 dbSNP
rs114227716 1017 dbSNP
rs1404684164 1029 dbSNP
rs950063667 1031 dbSNP
rs1273435345 1032 dbSNP
rs917326866 1039 dbSNP
rs1183267539 1041 dbSNP
rs903586845 1043 dbSNP
rs1422733609 1044 dbSNP
rs1043512606 1048 dbSNP
rs1383986841 1052 dbSNP
rs1009206702 1058 dbSNP
rs1169669856 1060 dbSNP
rs1354353745 1067 dbSNP
rs35145102 1071 dbSNP
rs1304825002 1072 dbSNP
rs958541371 1074 dbSNP
rs1017189773 1089 dbSNP
rs1452091415 1089 dbSNP
rs926597283 1092 dbSNP
rs542115646 1104 dbSNP
rs983967555 1105 dbSNP
rs1045289488 1108 dbSNP
rs1256293560 1111 dbSNP
rs1482636769 1116 dbSNP
rs1184082288 1123 dbSNP
rs1241805972 1129 dbSNP
rs1461858531 1131 dbSNP
rs1451841314 1142 dbSNP
rs201373474 1144 dbSNP
rs549099027 1147 dbSNP
rs909277494 1148 dbSNP
rs1427110745 1155 dbSNP
rs1178497008 1158 dbSNP
rs951300347 1158 dbSNP
rs950686079 1171 dbSNP
rs139182029 1183 dbSNP
rs1351901020 1186 dbSNP
rs997795612 1188 dbSNP
rs1317826944 1191 dbSNP
rs1435662260 1208 dbSNP
rs1288231484 1212 dbSNP
rs1453968660 1213 dbSNP
rs1359598868 1218 dbSNP
rs1220795008 1220 dbSNP
rs1381478529 1221 dbSNP
rs965442509 1224 dbSNP
rs1300564156 1225 dbSNP
rs549512321 1231 dbSNP
rs531295026 1240 dbSNP
rs966682232 1245 dbSNP
rs1345437517 1249 dbSNP
rs775370110 1258 dbSNP
rs1464970616 1259 dbSNP
rs1017879216 1276 dbSNP
rs1217054238 1279 dbSNP
rs889257512 1290 dbSNP
rs968218496 1294 dbSNP
rs1193331973 1297 dbSNP
rs1054630199 1300 dbSNP
rs1022017734 1301 dbSNP
rs1009321238 1338 dbSNP
rs113950386 1347 dbSNP
rs1414202416 1351 dbSNP
rs903426989 1372 dbSNP
rs1042020302 1376 dbSNP
rs1457840760 1399 dbSNP
rs1164184302 1406 dbSNP
rs1343411286 1411 dbSNP
rs370062050 1413 dbSNP
rs1344658521 1417 dbSNP
rs771856331 1419 dbSNP
rs1413244595 1425 dbSNP
rs1329226291 1428 dbSNP
rs1222770671 1430 dbSNP
rs1180196777 1436 dbSNP
rs1284159612 1438 dbSNP
rs1003240423 1446 dbSNP
rs527956330 1452 dbSNP
rs1269990846 1456 dbSNP
rs1044982012 1463 dbSNP
rs1490292791 1465 dbSNP
rs1197455507 1468 dbSNP
rs917254718 1471 dbSNP
rs1472946114 1475 dbSNP
rs1176728046 1478 dbSNP
rs1405922565 1483 dbSNP
rs1406966523 1484 dbSNP
rs941168925 1488 dbSNP
rs1364653037 1493 dbSNP
rs1422583012 1503 dbSNP
rs1242936081 1505 dbSNP
rs1215279343 1506 dbSNP
rs1350783818 1519 dbSNP
rs1055852666 1525 dbSNP
rs1049096389 1533 dbSNP
rs1230470896 1533 dbSNP
rs1380740570 1533 dbSNP
rs937428104 1547 dbSNP
rs1293145354 1554 dbSNP
rs1220783069 1558 dbSNP
rs1247436265 1558 dbSNP
rs929379524 1567 dbSNP
rs745836795 1572 dbSNP
rs560355630 1583 dbSNP
rs983913785 1596 dbSNP
rs1181386147 1601 dbSNP
rs919377276 1605 dbSNP
rs1473818736 1607 dbSNP
rs976470317 1615 dbSNP
rs542406781 1619 dbSNP
rs966090617 1620 dbSNP
rs910766392 1637 dbSNP
rs1359358215 1640 dbSNP
rs1311138314 1641 dbSNP
rs1215840726 1643 dbSNP
rs1170301688 1649 dbSNP
rs951248019 1666 dbSNP
rs1408963166 1670 dbSNP
rs1361993004 1674 dbSNP
rs1269267715 1676 dbSNP
rs1448207762 1678 dbSNP
rs1316321220 1681 dbSNP
rs918486218 1688 dbSNP
rs976657161 1696 dbSNP
rs965046962 1697 dbSNP
rs1018366169 1700 dbSNP
rs1300208620 1702 dbSNP
rs1340513444 1704 dbSNP
rs1195373869 1707 dbSNP
rs1271222596 1709 dbSNP
rs1303525805 1726 dbSNP
rs1444185031 1730 dbSNP
rs1022467377 1735 dbSNP
rs1006603326 1745 dbSNP
rs1172383131 1754 dbSNP
rs1190462614 1756 dbSNP
rs77269297 1762 dbSNP
rs1032127973 1764 dbSNP
rs1426903796 1782 dbSNP
rs1414512125 1784 dbSNP
rs1000352086 1785 dbSNP
rs1451019493 1794 dbSNP
rs1327381912 1805 dbSNP
rs1193290626 1814 dbSNP
rs1268611877 1816 dbSNP
rs562960968 1827 dbSNP
rs1034800866 1833 dbSNP
rs6748785 1837 dbSNP
rs1262536674 1838 dbSNP
rs1460048810 1838 dbSNP
rs1210442703 1845 dbSNP
rs1262424562 1845 dbSNP
rs1223710472 1846 dbSNP
rs1446200546 1872 dbSNP
rs577285656 1874 dbSNP
rs904870567 1884 dbSNP
rs1023473957 1891 dbSNP
rs1041966519 1894 dbSNP
rs1014932973 1903 dbSNP
rs1005428878 1927 dbSNP
rs1264236624 1936 dbSNP
rs888404120 1938 dbSNP
rs1046867264 1942 dbSNP
rs558972127 1947 dbSNP
rs770408843 1951 dbSNP
rs1307618366 1960 dbSNP
rs1056200428 1961 dbSNP
rs1216480603 1962 dbSNP
rs184713510 1983 dbSNP
rs1283461825 1985 dbSNP
rs1404132863 1987 dbSNP
rs1365173953 1989 dbSNP
rs1405719577 1990 dbSNP
rs1040473663 1991 dbSNP
rs1321502292 1992 dbSNP
rs1230374056 1994 dbSNP
rs1462422991 1997 dbSNP
rs546155742 1999 dbSNP
rs572358871 2004 dbSNP
rs1355257808 2006 dbSNP
rs909959829 2012 dbSNP
rs553728433 2013 dbSNP
rs748857314 2019 dbSNP
rs1291684934 2021 dbSNP
rs181129845 2022 dbSNP
rs1048487434 2026 dbSNP
rs1198229751 2047 dbSNP
rs986167925 2048 dbSNP
rs1181950190 2057 dbSNP
rs1453620196 2069 dbSNP
rs946942881 2069 dbSNP
rs1431753578 2074 dbSNP
rs1425765405 2076 dbSNP
rs1302767888 2078 dbSNP
rs929789302 2106 dbSNP
rs1343926259 2107 dbSNP
rs1433011866 2112 dbSNP
rs1393389932 2122 dbSNP
rs141390634 2133 dbSNP
rs556189600 2134 dbSNP
rs1267215573 2136 dbSNP
rs1481241297 2140 dbSNP
rs777396183 2143 dbSNP
rs1221526318 2147 dbSNP
rs1257900390 2150 dbSNP
rs1196223103 2153 dbSNP
rs1483811588 2159 dbSNP
rs1196044373 2161 dbSNP
rs146536921 2163 dbSNP
rs1416799691 2169 dbSNP
rs1263404349 2173 dbSNP
rs570140527 2174 dbSNP
rs911179422 2187 dbSNP
rs1035156433 2195 dbSNP
rs755792199 2205 dbSNP
rs1310281387 2210 dbSNP
rs551739389 2213 dbSNP
rs981892249 2219 dbSNP
rs752943197 2224 dbSNP
rs1372544158 2226 dbSNP
rs1463668961 2233 dbSNP
rs144045357 2235 dbSNP
rs957754195 2237 dbSNP
rs1395856712 2239 dbSNP
rs1444700165 2241 dbSNP
rs1005209726 2254 dbSNP
rs888345081 2254 dbSNP
rs1032075527 2256 dbSNP
rs1408353041 2258 dbSNP
rs1245186440 2259 dbSNP
rs1177487674 2260 dbSNP
rs1312589222 2263 dbSNP
rs1344063164 2273 dbSNP
rs977852436 2282 dbSNP
rs967509804 2286 dbSNP
rs1020471680 2289 dbSNP
rs1250479903 2313 dbSNP
rs994378710 2316 dbSNP
rs35073559 2324 dbSNP
rs1376350231 2326 dbSNP
rs548507030 2337 dbSNP
rs530282186 2338 dbSNP
rs115003745 2341 dbSNP
rs1372768100 2342 dbSNP
rs1460498560 2344 dbSNP
rs767041121 2346 dbSNP
rs1406956863 2347 dbSNP
rs1048435264 2353 dbSNP
rs930070422 2356 dbSNP
rs1238648921 2362 dbSNP
rs1334617853 2368 dbSNP
rs915475192 2369 dbSNP
rs775551473 2373 dbSNP
rs1382631557 2376 dbSNP
rs1462297887 2379 dbSNP
rs1041274431 2396 dbSNP
rs544721929 2398 dbSNP
rs1199590383 2400 dbSNP
rs988426951 2401 dbSNP
rs1225000987 2405 dbSNP
rs943919561 2408 dbSNP
rs1322223112 2413 dbSNP
rs1239533936 2417 dbSNP
rs911116527 2429 dbSNP
rs1241893414 2438 dbSNP
rs1307047182 2441 dbSNP
rs533649567 2442 dbSNP
rs1385151745 2443 dbSNP
rs982728106 2449 dbSNP
rs969102766 2452 dbSNP
rs1178874306 2454 dbSNP
rs1430001259 2460 dbSNP
rs1469417967 2468 dbSNP
rs1337459761 2474 dbSNP
rs1174170590 2476 dbSNP
rs750536653 2478 dbSNP
rs565318024 2482 dbSNP
rs1346946435 2494 dbSNP
rs1431156283 2506 dbSNP
rs1023364182 2511 dbSNP
rs1359619942 2519 dbSNP
rs200793240 2524 dbSNP
rs1283598960 2532 dbSNP
rs138462264 2535 dbSNP
rs1221202320 2554 dbSNP
rs924952544 2572 dbSNP
rs1277081237 2581 dbSNP
rs762119070 2585 dbSNP
rs572371006 2586 dbSNP
rs1260450977 2591 dbSNP
rs1201861036 2593 dbSNP
rs1454660574 2593 dbSNP
rs1269946672 2595 dbSNP
rs1380041976 2596 dbSNP
rs1157434221 2598 dbSNP
rs1024766907 2602 dbSNP
rs993394287 2606 dbSNP
rs994099066 2608 dbSNP
rs960260729 2617 dbSNP
rs775108199 2621 dbSNP
rs80335972 2622 dbSNP
rs1386331211 2628 dbSNP
rs759378416 2629 dbSNP
rs1158294183 2631 dbSNP
rs1186244692 2636 dbSNP
rs1343209277 2640 dbSNP
rs188690786 2641 dbSNP
rs1303355737 2644 dbSNP
rs994169064 2645 dbSNP
rs1402747581 2655 dbSNP
rs1280735188 2665 dbSNP
rs897237616 2672 dbSNP
rs1263450938 2673 dbSNP
rs1373441380 2676 dbSNP
rs1205324943 2682 dbSNP
rs1224763860 2683 dbSNP
rs3739152 2687 dbSNP
rs1010885005 2697 dbSNP
rs1225253029 2702 dbSNP
rs748728247 2709 dbSNP
rs556061963 2712 dbSNP
rs889644997 2716 dbSNP
rs1219675192 2724 dbSNP
rs1234605560 2729 dbSNP
rs1360070668 2730 dbSNP
rs772788652 2734 dbSNP
rs537582405 2735 dbSNP
rs1405761701 2736 dbSNP
rs1053077366 2739 dbSNP
rs1163934772 2742 dbSNP
rs935594254 2751 dbSNP
rs936578402 2754 dbSNP
rs1330483121 2755 dbSNP
rs924900429 2755 dbSNP
rs1440918785 2758 dbSNP
rs1046547549 2765 dbSNP
rs1338734228 2765 dbSNP
rs928240732 2765 dbSNP
rs1316111913 2767 dbSNP
rs948241183 2776 dbSNP
rs1298047447 2780 dbSNP
rs367711613 2782 dbSNP
rs983843384 2783 dbSNP
rs1042071555 2788 dbSNP
rs945054798 2794 dbSNP
rs769278780 2796 dbSNP
rs879540603 2803 dbSNP
rs1203962466 2806 dbSNP
rs1296743640 2808 dbSNP
rs1236465201 2812 dbSNP
rs1462555516 2814 dbSNP
rs1184145929 2815 dbSNP
rs1384304884 2824 dbSNP
rs537933151 2826 dbSNP
rs374224564 2827 dbSNP
rs991942595 2835 dbSNP
rs1419853685 2837 dbSNP
rs918254195 2851 dbSNP
rs1167654051 2862 dbSNP
rs960457645 2864 dbSNP
rs1407688466 2871 dbSNP
rs143835714 2874 dbSNP
rs3739153 2876 dbSNP
rs386652861 2877 dbSNP
rs952963294 2877 dbSNP
rs1382478488 2878 dbSNP
rs1019970902 2881 dbSNP
rs755371905 2906 dbSNP
rs149010407 2913 dbSNP
rs1193531073 2914 dbSNP
rs1256170738 2916 dbSNP
rs1325762473 2923 dbSNP
rs1204219112 2924 dbSNP
rs1242523087 2925 dbSNP
rs567067577 2940 dbSNP
rs1477286555 2942 dbSNP
rs145850207 2946 dbSNP
rs994115003 2949 dbSNP
rs1029050990 2951 dbSNP
rs961380895 2962 dbSNP
rs1430710155 2970 dbSNP
rs1469919512 2978 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::||| |   :|||||| 
Target 5' aucAUGCCACU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000284719.3 | 3UTR | UGAUCAUGCCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*