miRTarBase - #MIRT656470 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAP4K2   
Synonyms BL44, GCK, RAB8IP
Description mitogen-activated protein kinase kinase kinase kinase 2
Transcript NM_004579   
Expression
Putative miRNA Targets on MAP4K2
3'UTR of MAP4K2
(miRNA target sites are highlighted)
>MAP4K2|NM_004579|3'UTR
   1 GAGCAGCGGGCCTGTCCAGGGGCTCCCCGCCCCACCCCACGCCTTAGCTGCAGGCCCTTTTGGGCAAAGGGGCCCATCCT
  81 AGACCAGAGGAGCCCAGGCCCTGGCCCTGCTGGGGCTGAAGGTCAGAAGTAATCCTGAGAAATGTTTCAGGCCTGGGGAG
 161 GGAGGGGAGCCCCCGACGCCTCTGCAATAACTGGACCAGGGGGAGCTGCTGTCACTCCCCCATCCCCGAGGCAGCCCAGT
 241 CCCTAGTGCCCAAGGCAGGGACCCTGGGCCTGGGCCATCCATTCCATTTTGTTCCACATTTCCTTTCTACTCTTTCTGCC
 321 AAGAGCCTGCCCCTGCATTTGTCCTGGGAAACACGGTATTTAAGAGAGAACTATATTGGTATTAAAGCTGGTTTGTTTTA
 401 GTCCTCTGGTCCCTCTGGGTAGGGGGAGTGAACCCAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGU--AACA--GUGUGAGGu 5'
             |: |||  ||||  ||||:|:| 
Target 5' tccATTCCATTTTGTTCCACATTTCc 3'
278 - 303 131.00 -12.20
2
miRNA  3' guuugUGGUAACAGUGUGAGGu 5'
               :|:: |||  |||||| 
Target 5' ggggaGCTGCTGT--CACTCCc 3'
200 - 219 124.00 -13.90
3
miRNA  3' guUUGUGGU---AACAG---UGUGAGGu 5'
            |:|| |:    ||||   : :|||| 
Target 5' -gAGCAGCGGGCCTGTCCAGGGGCTCCc 3'
1 - 27 88.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31591473 10 COSMIC
COSN28851037 28 COSMIC
COSN30528532 53 COSMIC
COSN26345053 101 COSMIC
COSN31778855 174 COSMIC
COSN31488626 220 COSMIC
COSN31554869 264 COSMIC
COSN30164384 294 COSMIC
COSN16443882 448 COSMIC
COSN5263024 538 COSMIC
COSN8282653 878 COSMIC
COSN24974231 1680 COSMIC
COSN22824364 2139 COSMIC
COSN27144928 2286 COSMIC
COSN7016885 2323 COSMIC
COSN8687754 2510 COSMIC
COSN23902708 2623 COSMIC
COSN21237525 2960 COSMIC
COSN24551512 2964 COSMIC
COSN21209821 2997 COSMIC
COSN7016884 3000 COSMIC
COSN5828546 3340 COSMIC
COSN15789510 3383 COSMIC
COSN7016883 3385 COSMIC
COSN21408133 4307 COSMIC
COSN7016882 4308 COSMIC
COSN7016881 4405 COSMIC
rs117925626 892 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1344029800 2 dbSNP
rs751416356 7 dbSNP
rs777686791 8 dbSNP
rs758340406 10 dbSNP
rs752149077 12 dbSNP
rs1160630306 13 dbSNP
rs1463703502 14 dbSNP
rs370427980 18 dbSNP
rs1176019682 19 dbSNP
rs759188754 24 dbSNP
rs753402982 25 dbSNP
rs565546034 28 dbSNP
rs900750990 29 dbSNP
rs1247775529 30 dbSNP
rs1196979567 35 dbSNP
rs1480689150 36 dbSNP
rs1254979055 39 dbSNP
rs762069053 40 dbSNP
rs1208329573 41 dbSNP
rs545430774 41 dbSNP
rs769218032 44 dbSNP
rs1224628295 45 dbSNP
rs1335737945 48 dbSNP
rs943701945 54 dbSNP
rs912234591 55 dbSNP
rs1047220684 59 dbSNP
rs1415655869 63 dbSNP
rs929728164 66 dbSNP
rs963738214 69 dbSNP
rs1436283011 72 dbSNP
rs576550210 73 dbSNP
rs1458668143 78 dbSNP
rs1325223916 90 dbSNP
rs973887189 99 dbSNP
rs1007690214 103 dbSNP
rs2229721 109 dbSNP
rs1197524489 110 dbSNP
rs1052018396 111 dbSNP
rs536377951 114 dbSNP
rs1336201402 116 dbSNP
rs1330016559 119 dbSNP
rs916497259 120 dbSNP
rs992090908 125 dbSNP
rs1291633551 129 dbSNP
rs1249617110 130 dbSNP
rs1445242443 137 dbSNP
rs960956881 153 dbSNP
rs1031013571 164 dbSNP
rs1192434326 166 dbSNP
rs1247193836 168 dbSNP
rs1478759287 170 dbSNP
rs993772257 174 dbSNP
rs1354724275 175 dbSNP
rs1284052176 176 dbSNP
rs749172948 177 dbSNP
rs1241524193 178 dbSNP
rs1161859236 179 dbSNP
rs3180513 182 dbSNP
rs1379833177 186 dbSNP
rs770016357 187 dbSNP
rs1400465618 194 dbSNP
rs1037676639 197 dbSNP
rs1333329832 199 dbSNP
rs747776089 199 dbSNP
rs574054455 201 dbSNP
rs1282663111 202 dbSNP
rs1351366408 207 dbSNP
rs1230420522 209 dbSNP
rs554488240 211 dbSNP
rs942028399 215 dbSNP
rs1204320114 217 dbSNP
rs996294384 219 dbSNP
rs900720047 225 dbSNP
rs1040990215 227 dbSNP
rs1267508801 228 dbSNP
rs1472613229 235 dbSNP
rs1183957811 242 dbSNP
rs1361689929 254 dbSNP
rs1350661374 255 dbSNP
rs1164131376 266 dbSNP
rs868042219 268 dbSNP
rs890760822 275 dbSNP
rs1302671288 281 dbSNP
rs534781404 284 dbSNP
rs1411717457 304 dbSNP
rs1335397460 316 dbSNP
rs929654648 322 dbSNP
rs112747982 323 dbSNP
rs1284520683 324 dbSNP
rs898239524 329 dbSNP
rs565645345 331 dbSNP
rs1290917436 334 dbSNP
rs1061125 353 dbSNP
rs1483129751 354 dbSNP
rs1197029227 355 dbSNP
rs1441452623 359 dbSNP
rs1436808618 369 dbSNP
rs988059298 373 dbSNP
rs956652035 378 dbSNP
rs1177436394 385 dbSNP
rs925218812 387 dbSNP
rs947829345 393 dbSNP
rs545520413 403 dbSNP
rs1248051448 404 dbSNP
rs1396780037 406 dbSNP
rs552004831 414 dbSNP
rs1018014375 415 dbSNP
rs1384785518 417 dbSNP
rs1008430574 425 dbSNP
rs1342700789 426 dbSNP
rs1218928639 427 dbSNP
rs954881514 428 dbSNP
rs1338381929 437 dbSNP
rs1450171516 441 dbSNP
rs1200715235 446 dbSNP
rs1244579087 447 dbSNP
rs1289598640 448 dbSNP
rs538543560 448 dbSNP
rs1183365474 450 dbSNP
rs569353604 460 dbSNP
rs1030944903 464 dbSNP
rs549734452 468 dbSNP
rs747577766 469 dbSNP
rs113751176 471 dbSNP
rs1356428559 473 dbSNP
rs1307776916 474 dbSNP
rs898056340 479 dbSNP
rs1174592257 491 dbSNP
rs1037960632 495 dbSNP
rs1450186967 498 dbSNP
rs1335773891 500 dbSNP
rs1365870587 504 dbSNP
rs939301707 516 dbSNP
rs1383810722 522 dbSNP
rs923878392 525 dbSNP
rs529781497 536 dbSNP
rs978050799 543 dbSNP
rs1306468761 546 dbSNP
rs199655584 553 dbSNP
rs1006191749 556 dbSNP
rs1264694896 557 dbSNP
rs1368438821 560 dbSNP
rs905226389 565 dbSNP
rs1045153768 566 dbSNP
rs1487033960 570 dbSNP
rs1185332386 573 dbSNP
rs777795417 581 dbSNP
rs1433911056 588 dbSNP
rs1434598428 589 dbSNP
rs750159158 598 dbSNP
rs1427475051 603 dbSNP
rs781112274 604 dbSNP
rs968056750 614 dbSNP
rs576866409 619 dbSNP
rs925165755 624 dbSNP
rs979349085 639 dbSNP
rs1358524646 646 dbSNP
rs375708361 660 dbSNP
rs1158002847 663 dbSNP
rs963676955 665 dbSNP
rs1361183911 666 dbSNP
rs1386852843 670 dbSNP
rs910900858 680 dbSNP
rs986553079 683 dbSNP
rs752810493 686 dbSNP
rs964816881 690 dbSNP
rs1019127367 693 dbSNP
rs1009500491 706 dbSNP
rs1224849641 710 dbSNP
rs116564679 711 dbSNP
rs1480133178 725 dbSNP
rs191112937 730 dbSNP
rs993830579 733 dbSNP
rs1477488951 734 dbSNP
rs1016517985 736 dbSNP
rs1420727223 747 dbSNP
rs527848843 761 dbSNP
rs1156589996 764 dbSNP
rs1344551759 773 dbSNP
rs1425175042 775 dbSNP
rs898164591 782 dbSNP
rs1363218857 786 dbSNP
rs1038091820 788 dbSNP
rs1217777590 792 dbSNP
rs1403780067 796 dbSNP
rs1279839820 800 dbSNP
rs947798182 811 dbSNP
rs1222436051 815 dbSNP
rs565474424 823 dbSNP
rs1322888713 826 dbSNP
rs755796812 827 dbSNP
rs939211314 829 dbSNP
rs1490223875 830 dbSNP
rs1205956867 833 dbSNP
rs1216529022 847 dbSNP
rs1312790634 866 dbSNP
rs896521725 866 dbSNP
rs923874522 874 dbSNP
rs1280811582 877 dbSNP
rs1444992253 881 dbSNP
rs117925626 892 dbSNP
rs1383295893 899 dbSNP
rs1367137370 913 dbSNP
rs946681749 914 dbSNP
rs903722347 916 dbSNP
rs1434552013 928 dbSNP
rs1439522645 928 dbSNP
rs576790355 931 dbSNP
rs915252861 936 dbSNP
rs974772217 938 dbSNP
rs1297438778 945 dbSNP
rs1466472377 947 dbSNP
rs911149822 948 dbSNP
rs1173303793 949 dbSNP
rs986833225 959 dbSNP
rs1275150550 970 dbSNP
rs964804826 975 dbSNP
rs1204148671 982 dbSNP
rs1238251966 987 dbSNP
rs1413458598 988 dbSNP
rs1185130949 992 dbSNP
rs1423831408 993 dbSNP
rs1241212535 1001 dbSNP
rs1195440770 1009 dbSNP
rs9326434 1012 dbSNP
rs1261499254 1019 dbSNP
rs1193470488 1025 dbSNP
rs111762410 1031 dbSNP
rs1483865094 1038 dbSNP
rs1407693852 1046 dbSNP
rs1169379115 1050 dbSNP
rs542979386 1053 dbSNP
rs768390930 1053 dbSNP
rs950986878 1054 dbSNP
rs1026526990 1055 dbSNP
rs1432063934 1059 dbSNP
rs1423501303 1060 dbSNP
rs574066084 1063 dbSNP
rs1360022960 1073 dbSNP
rs554196869 1075 dbSNP
rs1214054755 1076 dbSNP
rs534519466 1077 dbSNP
rs898133554 1078 dbSNP
rs1311704894 1079 dbSNP
rs761812065 1080 dbSNP
rs1016480212 1083 dbSNP
rs985032699 1087 dbSNP
rs1011942996 1089 dbSNP
rs1193874650 1095 dbSNP
rs1243763143 1099 dbSNP
rs894881910 1103 dbSNP
rs571957698 1104 dbSNP
rs1277324377 1106 dbSNP
rs1429578498 1108 dbSNP
rs1396430645 1111 dbSNP
rs1023890198 1112 dbSNP
rs1381225384 1118 dbSNP
rs558322284 1131 dbSNP
rs902348617 1132 dbSNP
rs538582975 1137 dbSNP
rs1320924654 1138 dbSNP
rs1400398824 1143 dbSNP
rs946651633 1144 dbSNP
rs751598105 1145 dbSNP
rs569594070 1146 dbSNP
rs1170156696 1148 dbSNP
rs555910676 1150 dbSNP
rs536212802 1168 dbSNP
rs1043507922 1173 dbSNP
rs1180660468 1178 dbSNP
rs942552164 1179 dbSNP
rs1460880706 1184 dbSNP
rs9326433 1193 dbSNP
rs1445156852 1204 dbSNP
rs547424572 1206 dbSNP
rs1268932514 1216 dbSNP
rs987962669 1217 dbSNP
rs1196907902 1218 dbSNP
rs1428157509 1219 dbSNP
rs1051035001 1220 dbSNP
rs1200671853 1223 dbSNP
rs1456587077 1224 dbSNP
rs933638625 1226 dbSNP
rs1257720315 1229 dbSNP
rs1245183610 1231 dbSNP
rs1323315509 1232 dbSNP
rs1367583444 1233 dbSNP
rs1403169009 1237 dbSNP
rs1310408578 1238 dbSNP
rs1227686863 1239 dbSNP
rs918279233 1242 dbSNP
rs1377630664 1243 dbSNP
rs1332787750 1250 dbSNP
rs950878692 1256 dbSNP
rs919437898 1257 dbSNP
rs941122789 1258 dbSNP
rs1293776835 1259 dbSNP
rs1239390128 1263 dbSNP
rs1458699388 1266 dbSNP
rs973627485 1267 dbSNP
rs1219530223 1268 dbSNP
rs1163185859 1269 dbSNP
rs963604756 1272 dbSNP
rs1437997000 1279 dbSNP
rs527369447 1281 dbSNP
rs985322524 1283 dbSNP
rs1469926325 1284 dbSNP
rs1444553501 1285 dbSNP
rs1381515723 1289 dbSNP
rs1164843670 1293 dbSNP
rs1180563041 1299 dbSNP
rs1387627321 1303 dbSNP
rs1456518568 1311 dbSNP
rs969600317 1313 dbSNP
rs1397513775 1314 dbSNP
rs1393325395 1315 dbSNP
rs1179503703 1323 dbSNP
rs1445764705 1324 dbSNP
rs1023251101 1329 dbSNP
rs1250032847 1334 dbSNP
rs1361431046 1343 dbSNP
rs1011907776 1344 dbSNP
rs571902020 1345 dbSNP
rs959339239 1352 dbSNP
rs1263445183 1358 dbSNP
rs1457652399 1359 dbSNP
rs1220644340 1360 dbSNP
rs1354290972 1363 dbSNP
rs1245529082 1367 dbSNP
rs1311440333 1373 dbSNP
rs1443274308 1375 dbSNP
rs1034738002 1376 dbSNP
rs375130008 1385 dbSNP
rs1237267922 1386 dbSNP
rs1373763446 1400 dbSNP
rs960991570 1409 dbSNP
rs1375562486 1423 dbSNP
rs1003713543 1440 dbSNP
rs1301457579 1446 dbSNP
rs1395952920 1447 dbSNP
rs1388135134 1452 dbSNP
rs1470788301 1460 dbSNP
rs1388212272 1464 dbSNP
rs1337090867 1465 dbSNP
rs1384944345 1466 dbSNP
rs1030997393 1470 dbSNP
rs902317094 1471 dbSNP
rs1326563421 1475 dbSNP
rs1292112007 1479 dbSNP
rs999492067 1481 dbSNP
rs1042222909 1482 dbSNP
rs77450770 1487 dbSNP
rs374685482 1488 dbSNP
rs1437831796 1504 dbSNP
rs1363316715 1505 dbSNP
rs1007107737 1508 dbSNP
rs1263033182 1509 dbSNP
rs889656360 1510 dbSNP
rs1199748034 1515 dbSNP
rs368061946 1528 dbSNP
rs1423204144 1536 dbSNP
rs1038964532 1540 dbSNP
rs943343378 1546 dbSNP
rs1408086802 1548 dbSNP
rs1468025337 1549 dbSNP
rs911888334 1551 dbSNP
rs1051827055 1554 dbSNP
rs929399033 1556 dbSNP
rs1292762963 1558 dbSNP
rs1223793560 1560 dbSNP
rs1339480780 1560 dbSNP
rs1284785577 1561 dbSNP
rs1488509785 1563 dbSNP
rs1321931649 1564 dbSNP
rs919363854 1573 dbSNP
rs1261833130 1582 dbSNP
rs909607045 1591 dbSNP
rs774936506 1592 dbSNP
rs963574205 1600 dbSNP
rs1262616378 1603 dbSNP
rs1490527249 1605 dbSNP
rs187191961 1609 dbSNP
rs529239129 1627 dbSNP
rs1427455036 1635 dbSNP
rs1431235061 1645 dbSNP
rs1328972825 1646 dbSNP
rs948204025 1665 dbSNP
rs916164053 1668 dbSNP
rs1455248944 1672 dbSNP
rs1296239454 1678 dbSNP
rs769497039 1679 dbSNP
rs916796093 1688 dbSNP
rs1343187073 1693 dbSNP
rs1219026332 1697 dbSNP
rs1300191663 1699 dbSNP
rs959038196 1702 dbSNP
rs992813386 1705 dbSNP
rs373204335 1713 dbSNP
rs560282644 1719 dbSNP
rs960912447 1720 dbSNP
rs375376898 1724 dbSNP
rs140297619 1725 dbSNP
rs1003273066 1726 dbSNP
rs1300523610 1730 dbSNP
rs1490553218 1730 dbSNP
rs1224724792 1738 dbSNP
rs537461805 1747 dbSNP
rs1488251898 1748 dbSNP
rs1190439871 1749 dbSNP
rs968035360 1752 dbSNP
rs1020692296 1757 dbSNP
rs553806650 1758 dbSNP
rs1173203569 1759 dbSNP
rs1156844800 1767 dbSNP
rs1379614860 1774 dbSNP
rs1467692714 1778 dbSNP
rs1164878332 1786 dbSNP
rs1010690426 1789 dbSNP
rs1298369584 1791 dbSNP
rs1176023409 1796 dbSNP
rs1390025315 1797 dbSNP
rs558358866 1798 dbSNP
rs112277411 1799 dbSNP
rs1248290052 1806 dbSNP
rs1289634318 1812 dbSNP
rs1017514868 1815 dbSNP
rs1006997921 1822 dbSNP
rs1007918864 1823 dbSNP
rs954010125 1835 dbSNP
rs544777161 1836 dbSNP
rs1191316327 1838 dbSNP
rs779408303 1841 dbSNP
rs1446321639 1848 dbSNP
rs1029530724 1857 dbSNP
rs1256832363 1865 dbSNP
rs998434033 1866 dbSNP
rs1282036393 1869 dbSNP
rs576277095 1874 dbSNP
rs897033896 1875 dbSNP
rs1170787608 1877 dbSNP
rs1355851933 1884 dbSNP
rs1464404578 1886 dbSNP
rs556384472 1897 dbSNP
rs1331041320 1903 dbSNP
rs1384225051 1905 dbSNP
rs1036967156 1912 dbSNP
rs777053386 1916 dbSNP
rs890444560 1920 dbSNP
rs1052176216 1926 dbSNP
rs1215240319 1929 dbSNP
rs1262047921 1930 dbSNP
rs929336348 1931 dbSNP
rs182907263 1936 dbSNP
rs771328586 1937 dbSNP
rs567292701 1950 dbSNP
rs567398544 1951 dbSNP
rs916114910 1953 dbSNP
rs1280488737 1955 dbSNP
rs533658753 1962 dbSNP
rs114510091 1966 dbSNP
rs1326335733 1967 dbSNP
rs938953303 1974 dbSNP
rs1335478647 1980 dbSNP
rs372131314 1981 dbSNP
rs1472180838 1985 dbSNP
rs1186534446 1986 dbSNP
rs916995382 1996 dbSNP
rs982153198 1999 dbSNP
rs966353489 2000 dbSNP
rs1407364620 2001 dbSNP
rs1397823686 2003 dbSNP
rs1020661008 2017 dbSNP
rs1332848930 2022 dbSNP
rs989225740 2027 dbSNP
rs1431593570 2039 dbSNP
rs1175902657 2042 dbSNP
rs1271958503 2043 dbSNP
rs1338477126 2045 dbSNP
rs1056599035 2049 dbSNP
rs571333925 2050 dbSNP
rs886176136 2057 dbSNP
rs866063458 2061 dbSNP
rs978343143 2065 dbSNP
rs1368942644 2070 dbSNP
rs946701272 2071 dbSNP
rs1215926352 2081 dbSNP
rs1017879901 2084 dbSNP
rs915284736 2085 dbSNP
rs747495871 2089 dbSNP
rs1487010628 2103 dbSNP
rs1192564052 2104 dbSNP
rs1429552935 2117 dbSNP
rs1007411687 2123 dbSNP
rs985940336 2129 dbSNP
rs954120828 2137 dbSNP
rs370912287 2139 dbSNP
rs1425116978 2141 dbSNP
rs890341083 2143 dbSNP
rs1320820657 2144 dbSNP
rs1241972498 2145 dbSNP
rs1030256610 2146 dbSNP
rs552019296 2148 dbSNP
rs778278342 2151 dbSNP
rs897866898 2152 dbSNP
rs1005514154 2159 dbSNP
rs1272816774 2160 dbSNP
rs569904239 2161 dbSNP
rs1343993182 2178 dbSNP
rs531900329 2182 dbSNP
rs569452138 2190 dbSNP
rs942120149 2191 dbSNP
rs1350958314 2197 dbSNP
rs1022597633 2198 dbSNP
rs1013001445 2199 dbSNP
rs549695633 2202 dbSNP
rs1056341950 2214 dbSNP
rs529552319 2219 dbSNP
rs1160869731 2220 dbSNP
rs1378934234 2222 dbSNP
rs1419185896 2230 dbSNP
rs928843856 2235 dbSNP
rs1285237013 2245 dbSNP
rs977743195 2256 dbSNP
rs367549934 2257 dbSNP
rs1323117049 2260 dbSNP
rs560570529 2261 dbSNP
rs913600496 2262 dbSNP
rs1311382464 2265 dbSNP
rs1374500716 2266 dbSNP
rs1238825295 2272 dbSNP
rs1336124589 2273 dbSNP
rs1373996390 2273 dbSNP
rs1207756274 2274 dbSNP
rs1447671344 2276 dbSNP
rs1011479711 2277 dbSNP
rs1438756973 2278 dbSNP
rs1402661405 2282 dbSNP
rs989173361 2286 dbSNP
rs1439579014 2287 dbSNP
rs540211464 2292 dbSNP
rs1391202437 2294 dbSNP
rs1164840020 2298 dbSNP
rs1387214683 2301 dbSNP
rs192029758 2305 dbSNP
rs564210211 2306 dbSNP
rs957760793 2308 dbSNP
rs1178691137 2309 dbSNP
rs1397474815 2310 dbSNP
rs1410378931 2317 dbSNP
rs910316104 2318 dbSNP
rs1398069932 2325 dbSNP
rs1445987466 2334 dbSNP
rs772101280 2335 dbSNP
rs986334735 2340 dbSNP
rs1235938903 2343 dbSNP
rs1203384986 2344 dbSNP
rs1437552829 2351 dbSNP
rs1339634088 2357 dbSNP
rs1256594733 2358 dbSNP
rs796817461 2358 dbSNP
rs188444163 2359 dbSNP
rs1204878028 2361 dbSNP
rs748265969 2362 dbSNP
rs568083983 2367 dbSNP
rs1422203107 2369 dbSNP
rs1212045432 2370 dbSNP
rs1373901588 2376 dbSNP
rs1357894470 2382 dbSNP
rs1168737794 2383 dbSNP
rs1287603388 2385 dbSNP
rs1397869525 2390 dbSNP
rs1464851359 2393 dbSNP
rs1337389623 2404 dbSNP
rs146690705 2422 dbSNP
rs1240910031 2423 dbSNP
rs1379214755 2432 dbSNP
rs1277943347 2434 dbSNP
rs377685089 2446 dbSNP
rs962024229 2447 dbSNP
rs1326463700 2451 dbSNP
rs1016295049 2452 dbSNP
rs1275849528 2456 dbSNP
rs893032852 2457 dbSNP
rs1350753014 2468 dbSNP
rs1325247588 2469 dbSNP
rs1422570299 2475 dbSNP
rs1482548555 2484 dbSNP
rs183561180 2485 dbSNP
rs1361059019 2489 dbSNP
rs1420918620 2491 dbSNP
rs542940433 2492 dbSNP
rs72156300 2492 dbSNP
rs1477407620 2502 dbSNP
rs1491136381 2503 dbSNP
rs1171880862 2504 dbSNP
rs1357436285 2504 dbSNP
rs1385068093 2504 dbSNP
rs1491519958 2504 dbSNP
rs397745278 2504 dbSNP
rs56139846 2504 dbSNP
rs1478151430 2505 dbSNP
rs1006242322 2507 dbSNP
rs1303817385 2508 dbSNP
rs573830005 2508 dbSNP
rs1233182125 2511 dbSNP
rs1055889128 2512 dbSNP
rs1214525904 2514 dbSNP
rs1262803699 2514 dbSNP
rs1356032956 2514 dbSNP
rs553821830 2514 dbSNP
rs985438141 2514 dbSNP
rs191978141 2515 dbSNP
rs1175275978 2516 dbSNP
rs1380835913 2517 dbSNP
rs1041940590 2519 dbSNP
rs1156279593 2525 dbSNP
rs141164828 2525 dbSNP
rs1458120936 2525 dbSNP
rs922681106 2525 dbSNP
rs1365939647 2527 dbSNP
rs1386564080 2536 dbSNP
rs946326278 2537 dbSNP
rs1308413594 2541 dbSNP
rs577821036 2551 dbSNP
rs1379736729 2552 dbSNP
rs914844470 2555 dbSNP
rs1285441209 2557 dbSNP
rs1360195777 2558 dbSNP
rs1224067302 2570 dbSNP
rs1263835894 2570 dbSNP
rs1356537126 2574 dbSNP
rs1190395709 2581 dbSNP
rs961180233 2583 dbSNP
rs1441430849 2589 dbSNP
rs1015471981 2591 dbSNP
rs1379175603 2596 dbSNP
rs1053355923 2597 dbSNP
rs186305193 2598 dbSNP
rs1276854865 2604 dbSNP
rs1402831203 2608 dbSNP
rs1344646148 2610 dbSNP
rs1457763560 2614 dbSNP
rs1332426687 2615 dbSNP
rs550872751 2623 dbSNP
rs1012556148 2624 dbSNP
rs201528411 2624 dbSNP
rs985937743 2624 dbSNP
rs537935346 2630 dbSNP
rs1196684824 2637 dbSNP
rs1220600869 2637 dbSNP
rs1458884007 2637 dbSNP
rs5792334 2637 dbSNP
rs1237493849 2640 dbSNP
rs1472876240 2644 dbSNP
rs1035385057 2646 dbSNP
rs1343434473 2652 dbSNP
rs1411238048 2655 dbSNP
rs1422913620 2663 dbSNP
rs1170888513 2667 dbSNP
rs1426251707 2671 dbSNP
rs998601403 2685 dbSNP
rs574267535 2687 dbSNP
rs763158535 2690 dbSNP
rs954692752 2695 dbSNP
rs1414561849 2697 dbSNP
rs1301132044 2703 dbSNP
rs569475476 2705 dbSNP
rs1042499364 2706 dbSNP
rs1280270706 2712 dbSNP
rs923156514 2716 dbSNP
rs1479627232 2723 dbSNP
rs1257401239 2739 dbSNP
rs946887748 2741 dbSNP
rs549296436 2742 dbSNP
rs1050442886 2748 dbSNP
rs879478945 2761 dbSNP
rs922614947 2762 dbSNP
rs1194930790 2765 dbSNP
rs1407902750 2765 dbSNP
rs1016200410 2774 dbSNP
rs1006189876 2777 dbSNP
rs958775901 2779 dbSNP
rs181030821 2780 dbSNP
rs1416681167 2789 dbSNP
rs1002990545 2804 dbSNP
rs1280920934 2811 dbSNP
rs908632345 2815 dbSNP
rs983933062 2818 dbSNP
rs752865200 2819 dbSNP
rs1041847210 2827 dbSNP
rs754047856 2843 dbSNP
rs567025186 2844 dbSNP
rs1220887893 2845 dbSNP
rs1276336878 2847 dbSNP
rs546605138 2859 dbSNP
rs991838332 2860 dbSNP
rs959731313 2861 dbSNP
rs1487085260 2866 dbSNP
rs893355996 2868 dbSNP
rs1247676698 2870 dbSNP
rs868446629 2886 dbSNP
rs998485135 2891 dbSNP
rs1189982580 2903 dbSNP
rs1425071295 2904 dbSNP
rs533119422 2912 dbSNP
rs1420441755 2917 dbSNP
rs1054638357 2929 dbSNP
rs1324384249 2930 dbSNP
rs1358661620 2930 dbSNP
rs1448036394 2930 dbSNP
rs564245954 2934 dbSNP
rs1331478345 2942 dbSNP
rs1438342785 2944 dbSNP
rs189832606 2955 dbSNP
rs781111139 2956 dbSNP
rs1334187227 2959 dbSNP
rs1011044393 2964 dbSNP
rs893993687 2965 dbSNP
rs1049988671 2966 dbSNP
rs910252426 2967 dbSNP
rs1050585205 2969 dbSNP
rs1041029913 2970 dbSNP
rs1246683303 2972 dbSNP
rs940022835 2972 dbSNP
rs908601222 2981 dbSNP
rs1378564189 2994 dbSNP
rs1439093803 2994 dbSNP
rs933107612 2997 dbSNP
rs1171806123 2998 dbSNP
rs923030888 2999 dbSNP
rs757139009 3005 dbSNP
rs971860737 3006 dbSNP
rs1417945439 3012 dbSNP
rs915769375 3017 dbSNP
rs991414456 3018 dbSNP
rs374428057 3023 dbSNP
rs960194238 3030 dbSNP
rs879672534 3031 dbSNP
rs928558058 3034 dbSNP
rs1357995462 3035 dbSNP
rs1483587783 3037 dbSNP
rs1239274925 3038 dbSNP
rs562729095 3044 dbSNP
rs1461017221 3046 dbSNP
rs1236878178 3047 dbSNP
rs371287826 3051 dbSNP
rs1021315396 3054 dbSNP
rs984741954 3055 dbSNP
rs1471951024 3066 dbSNP
rs958226554 3069 dbSNP
rs752234436 3071 dbSNP
rs1034378828 3072 dbSNP
rs1333358004 3073 dbSNP
rs1398005555 3075 dbSNP
rs573891532 3079 dbSNP
rs1028941424 3087 dbSNP
rs1381330137 3089 dbSNP
rs981869422 3091 dbSNP
rs1242181823 3108 dbSNP
rs1312241106 3112 dbSNP
rs1292221318 3117 dbSNP
rs1319117280 3124 dbSNP
rs1451341561 3130 dbSNP
rs1220838531 3140 dbSNP
rs1256770266 3142 dbSNP
rs971477459 3144 dbSNP
rs1339267213 3151 dbSNP
rs1400513401 3154 dbSNP
rs1201485607 3159 dbSNP
rs901403582 3160 dbSNP
rs1440713113 3172 dbSNP
rs1332989727 3174 dbSNP
rs1020334050 3180 dbSNP
rs1010321023 3182 dbSNP
rs893344516 3184 dbSNP
rs1033215886 3187 dbSNP
rs560447719 3188 dbSNP
rs540235875 3190 dbSNP
rs1421159608 3192 dbSNP
rs1461443229 3200 dbSNP
rs1048471830 3201 dbSNP
rs532239045 3204 dbSNP
rs1393786997 3211 dbSNP
rs1311955041 3213 dbSNP
rs1340722397 3219 dbSNP
rs764716668 3226 dbSNP
rs1170264965 3228 dbSNP
rs932992794 3242 dbSNP
rs901557471 3248 dbSNP
rs1234621417 3257 dbSNP
rs1258212862 3257 dbSNP
rs894567597 3261 dbSNP
rs1210233812 3262 dbSNP
rs1287066191 3263 dbSNP
rs1424901753 3270 dbSNP
rs1036114683 3274 dbSNP
rs577759127 3277 dbSNP
rs1191720026 3280 dbSNP
rs1055996249 3291 dbSNP
rs1181809743 3297 dbSNP
rs1444113567 3299 dbSNP
rs1238945897 3300 dbSNP
rs938546102 3302 dbSNP
rs1379285087 3306 dbSNP
rs1258996426 3310 dbSNP
rs928525042 3338 dbSNP
rs1197787376 3342 dbSNP
rs185806485 3343 dbSNP
rs977335734 3346 dbSNP
rs1250545169 3349 dbSNP
rs759199519 3350 dbSNP
rs776318759 3354 dbSNP
rs1329831197 3358 dbSNP
rs1323408931 3363 dbSNP
rs1312859973 3383 dbSNP
rs537980711 3385 dbSNP
rs985095485 3387 dbSNP
rs1485455201 3399 dbSNP
rs1210192712 3402 dbSNP
rs953210130 3411 dbSNP
rs1310922788 3430 dbSNP
rs607389 3431 dbSNP
rs927216574 3441 dbSNP
rs1156571179 3444 dbSNP
rs1372250180 3451 dbSNP
rs1344220092 3458 dbSNP
rs965567453 3459 dbSNP
rs571190303 3462 dbSNP
rs555950250 3463 dbSNP
rs971806623 3468 dbSNP
rs1379301711 3473 dbSNP
rs1020324008 3487 dbSNP
rs988889323 3489 dbSNP
rs1424030414 3490 dbSNP
rs1380982996 3506 dbSNP
rs181219416 3510 dbSNP
rs1322525230 3517 dbSNP
rs1033163368 3520 dbSNP
rs1267016077 3525 dbSNP
rs1027368185 3526 dbSNP
rs1007487383 3533 dbSNP
rs1212996532 3542 dbSNP
rs144621665 3550 dbSNP
rs1238707299 3554 dbSNP
rs1458753427 3561 dbSNP
rs761060695 3562 dbSNP
rs890013441 3565 dbSNP
rs1030333280 3570 dbSNP
rs894528692 3574 dbSNP
rs1055895799 3577 dbSNP
rs1250138330 3580 dbSNP
rs938504805 3592 dbSNP
rs997150488 3596 dbSNP
rs189701467 3598 dbSNP
rs1403057631 3603 dbSNP
rs1440166201 3610 dbSNP
rs1490788708 3611 dbSNP
rs1036103396 3612 dbSNP
rs940446888 3629 dbSNP
rs1289422815 3635 dbSNP
rs914501087 3648 dbSNP
rs1310763704 3652 dbSNP
rs887546810 3661 dbSNP
rs1235336197 3662 dbSNP
rs1232438810 3667 dbSNP
rs1258684102 3668 dbSNP
rs1319868657 3672 dbSNP
rs1202304174 3674 dbSNP
rs1231830046 3677 dbSNP
rs1483253941 3678 dbSNP
rs606132 3691 dbSNP
rs1048859640 3698 dbSNP
rs140800418 3701 dbSNP
rs185248149 3707 dbSNP
rs59902882 3707 dbSNP
rs1019828821 3717 dbSNP
rs9666975 3727 dbSNP
rs982957363 3733 dbSNP
rs1359817776 3734 dbSNP
rs1236307208 3739 dbSNP
rs1046101269 3740 dbSNP
rs1467644158 3742 dbSNP
rs951569230 3749 dbSNP
rs561223 3751 dbSNP
rs950046880 3758 dbSNP
rs545741538 3759 dbSNP
rs1413979335 3768 dbSNP
rs1278638891 3782 dbSNP
rs373128628 3783 dbSNP
rs1363751040 3785 dbSNP
rs913263258 3786 dbSNP
rs550536613 3791 dbSNP
rs569097722 3793 dbSNP
rs1211596283 3794 dbSNP
rs957427739 3795 dbSNP
rs1485159150 3797 dbSNP
rs531053958 3802 dbSNP
rs985611403 3803 dbSNP
rs995885041 3819 dbSNP
rs1301742960 3834 dbSNP
rs1474592623 3854 dbSNP
rs1186512340 3864 dbSNP
rs1426467521 3869 dbSNP
rs1416286457 3881 dbSNP
rs954355758 3887 dbSNP
rs1374882595 3892 dbSNP
rs1420560410 3898 dbSNP
rs1300204020 3903 dbSNP
rs1346821452 3905 dbSNP
rs1361778919 3919 dbSNP
rs1029910178 3921 dbSNP
rs1160348208 3928 dbSNP
rs1451749324 3929 dbSNP
rs1363397886 3930 dbSNP
rs1034827261 3934 dbSNP
rs901929292 3935 dbSNP
rs1236356966 3938 dbSNP
rs562004142 3938 dbSNP
rs1346448018 3939 dbSNP
rs28622268 3940 dbSNP
rs1198510043 3943 dbSNP
rs659943 3948 dbSNP
rs1215490971 3949 dbSNP
rs1247840041 3949 dbSNP
rs1445693864 3949 dbSNP
rs72193917 3949 dbSNP
rs965685943 3951 dbSNP
rs1479306229 3953 dbSNP
rs1041496704 3957 dbSNP
rs529031615 3958 dbSNP
rs560384557 3961 dbSNP
rs559353 3962 dbSNP
rs1256160528 3978 dbSNP
rs1224949490 3982 dbSNP
rs893015985 3986 dbSNP
rs577986140 3987 dbSNP
rs1054409967 3989 dbSNP
rs1001373483 3990 dbSNP
rs905726424 3995 dbSNP
rs768667487 3999 dbSNP
rs1281736395 4001 dbSNP
rs949994488 4002 dbSNP
rs1223331394 4010 dbSNP
rs181604505 4011 dbSNP
rs1053019869 4017 dbSNP
rs776855800 4024 dbSNP
rs1291060254 4025 dbSNP
rs1320888484 4029 dbSNP
rs1252909722 4033 dbSNP
rs1458314387 4049 dbSNP
rs1180557664 4053 dbSNP
rs1231208425 4054 dbSNP
rs543833894 4055 dbSNP
rs10897525 4063 dbSNP
rs1462812488 4064 dbSNP
rs1384365178 4065 dbSNP
rs985985990 4075 dbSNP
rs368606890 4077 dbSNP
rs1471077195 4082 dbSNP
rs780452871 4093 dbSNP
rs1284353058 4123 dbSNP
rs976938618 4128 dbSNP
rs555544527 4135 dbSNP
rs1273156916 4137 dbSNP
rs1319257584 4157 dbSNP
rs961593880 4160 dbSNP
rs1015862780 4165 dbSNP
rs1190947670 4169 dbSNP
rs1004513471 4173 dbSNP
rs951731517 4192 dbSNP
rs1027398749 4195 dbSNP
rs1248529122 4197 dbSNP
rs1437249208 4198 dbSNP
rs1001719864 4201 dbSNP
rs905677052 4203 dbSNP
rs1256231259 4213 dbSNP
rs555129550 4216 dbSNP
rs974374209 4217 dbSNP
rs9666831 4222 dbSNP
rs1185486841 4223 dbSNP
rs1416846923 4224 dbSNP
rs1014054995 4226 dbSNP
rs1169518321 4227 dbSNP
rs1393695618 4232 dbSNP
rs1262142585 4235 dbSNP
rs1408851676 4236 dbSNP
rs1334459474 4239 dbSNP
rs891677815 4245 dbSNP
rs1340505405 4246 dbSNP
rs767772365 4249 dbSNP
rs1356942681 4259 dbSNP
rs1412494085 4265 dbSNP
rs1293091299 4273 dbSNP
rs1272375002 4274 dbSNP
rs1052967009 4275 dbSNP
rs1326428064 4277 dbSNP
rs116137216 4279 dbSNP
rs1454697374 4285 dbSNP
rs904553898 4287 dbSNP
rs1034386634 4288 dbSNP
rs1049820035 4300 dbSNP
rs1210377919 4304 dbSNP
rs932707059 4310 dbSNP
rs922724981 4311 dbSNP
rs548667556 4313 dbSNP
rs9666331 4313 dbSNP
rs971413174 4321 dbSNP
rs1172688104 4323 dbSNP
rs553143832 4329 dbSNP
rs1388345385 4331 dbSNP
rs940174932 4334 dbSNP
rs1376691201 4335 dbSNP
rs1020340621 4338 dbSNP
rs1311830727 4339 dbSNP
rs1361651363 4352 dbSNP
rs1384263438 4355 dbSNP
rs1010012905 4359 dbSNP
rs908793764 4360 dbSNP
rs1326321613 4361 dbSNP
rs142692894 4379 dbSNP
rs1305748251 4381 dbSNP
rs1054778508 4386 dbSNP
rs1210441898 4390 dbSNP
rs1475023830 4404 dbSNP
rs570778829 4407 dbSNP
rs1486101566 4416 dbSNP
rs148473896 4418 dbSNP
rs1184850614 4429 dbSNP
rs1259352947 4430 dbSNP
rs1442272584 4436 dbSNP
rs1446380938 4450 dbSNP
rs1242071613 4458 dbSNP
rs1194125355 4459 dbSNP
rs1396371476 4459 dbSNP
rs1027757619 4461 dbSNP
rs1178879990 4462 dbSNP
rs1439254363 4464 dbSNP
rs979811033 4474 dbSNP
rs1384635258 4480 dbSNP
rs970182053 4483 dbSNP
rs1275548315 4486 dbSNP
rs1328434771 4490 dbSNP
rs1368952728 4493 dbSNP
rs1233641097 4497 dbSNP
rs1310318994 4500 dbSNP
rs1040024800 4501 dbSNP
rs1194481631 4501 dbSNP
rs537002429 4515 dbSNP
rs777765915 4519 dbSNP
rs907595248 4525 dbSNP
rs1214322649 4528 dbSNP
rs1254804485 4532 dbSNP
rs1466791203 4534 dbSNP
rs1024015459 4537 dbSNP
rs1192425118 4551 dbSNP
rs1250565145 4559 dbSNP
rs774012446 4563 dbSNP
rs75461864 4569 dbSNP
rs1363588124 4573 dbSNP
rs1462289086 4577 dbSNP
rs116476958 4579 dbSNP
rs1380686244 4580 dbSNP
rs764785322 4581 dbSNP
rs528576767 4601 dbSNP
rs1298843147 4603 dbSNP
rs1375550726 4607 dbSNP
rs1389899102 4609 dbSNP
rs1306559877 4618 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGU--GGUAACAGUGUGAGGu 5'
            ||||  ||| |   :|||||| 
Target 5' agAACAUGCCACU---GCACUCCa 3'
1 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000294066.2 | 3UTR | AGAACAUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.777 8.9e-4 0.659 7.1e-3 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.318 7.0e-2 -0.486 9.4e-3 23 Click to see details
GSE28544 Breast cancer -0.269 1.0e-1 -0.258 1.1e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.366 1.2e-1 -0.245 2.2e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.255 1.4e-1 -0.158 2.5e-1 20 Click to see details
GSE38226 Liver fibrosis -0.236 1.5e-1 -0.186 2.1e-1 21 Click to see details
GSE17306 Multiple myeloma 0.118 2.1e-1 0.155 1.4e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.149 2.4e-1 -0.164 2.2e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.347 2.5e-1 -0.200 3.5e-1 6 Click to see details
GSE17498 Multiple myeloma -0.066 3.4e-1 -0.018 4.6e-1 40 Click to see details
GSE32688 Pancreatic cancer -0.069 3.5e-1 -0.151 2.0e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.043 3.7e-1 -0.054 3.4e-1 64 Click to see details
GSE21849 B cell lymphoma 0.048 4.0e-1 -0.024 4.5e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.051 4.0e-1 0.085 3.4e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.014 4.5e-1 0.032 3.8e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells 0.011 4.8e-1 0.059 3.9e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.003 5.0e-1 0.032 4.5e-1 16 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.288 0.02 -0.251 0.04 49 Click to see details
KIRC -0.289 0.06 -0.348 0.03 29 Click to see details
HNSC 0.973 0.07 1.000 0.5 3 Click to see details
THCA -0.512 0.19 -0.300 0.31 5 Click to see details
CHOL 0.099 0.4 0.000 0.5 9 Click to see details
KICH 0.08 0.43 0.262 0.27 8 Click to see details
KIRP 0.046 0.45 -0.017 0.48 9 Click to see details
STAD -0.029 0.47 0.381 0.18 8 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
ESCA 0.03 0.48 -0.200 0.37 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1