miRTarBase - #MIRT658905 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DPY19L4   
Synonyms -
Description dpy-19 like 4
Transcript NM_181787   
Expression
Putative miRNA Targets on DPY19L4
3'UTR of DPY19L4
(miRNA target sites are highlighted)
>DPY19L4|NM_181787|3'UTR
   1 AAAATAACAGAGCCTTCATTTCAAAGACTACCTGAAGTAAAATGCAGTTTTCTTCTACCTACTCGGTGTCTTTTGCAGAT
  81 CAGAGTATGGACATTTGAAATATTGCTGCTTCTTTCCCCCTTCTGCTGTTAACTGGATCCAGAGTTCTGTGGGAAATAGA
 161 AGATCAAGCATTACTGTCCTTTGATTAAATGTGATATCTACCACTCTGCAATATTCCAGACAGGTGTCTTCCTTACCGTT
 241 ACATGGTCTTTAACACTTTTACTGATTGCAATATTTTCCCCATAAAATCTTCATTCTATTATAATATTGATCTTGAATTT
 321 GAATATGTGCAAGGTCAGATACATTTCTCAAACATAACATTTAATAAATAATGTGATATAATTATTTAATAGAAAGAATA
 401 ATTCCGACCTTCAAGCAAGTTTCTGAAGGTATTTTATGATGTATAACAACTGAAGTTTTACAATAAAAACTAATTTAAAT
 481 GTTAGCTGAAGATATGTGGCATTTAAATTAAAATGGAAATTATATAAAGGAAAGTGATTTTTAAGGATATACATAAAGAT
 561 ATATTTAGAATTTTCATGATACTGTTCTCCTCATCTACTGCTTATGTTAAGTGAGAACTTTCTTAGTAATACATAATGCA
 641 TGATGTTACTGCATTTTCTAAATGACTAGTAAGTGATTAGTTTTTTCACTTATGCCTATTAATTTGATACCAATTTAATC
 721 ATGATAAAACAATAACCGTTAACATATATTTTGTTAAATGGACATTTAAAAGAATGTTGTTCAGGTTTTTTTTTTAAATA
 801 CTGATATGGGGCATACAATCTATTCACATGTTTTCTACTGAAGTACTAAGTAAAAAAATTAAATCATTATCAGAATAAAA
 881 ATATGTGTTCTAAAATTAGCAACAATTTCTGGGGATACATGCAGATGTTGTTAAACGTACCTCTGCATACAGATATATTA
 961 TAAAACACAAGCAATGTTATTTATGAAACTGTGATGCAGTCTTCAACATCAAGAAAAAATGACAACTATAATAAAATTTA
1041 CAACACAGTTTCACAGTCTAAATGCTATGTTCCTTTAAGTATTTTCATATTTTTAATCATTTATTAAGAGAAAATTGTGA
1121 AAAGTTAATTTGGCCTTATAGAGAGATTCAGGATAGATGTAGCCTATAGATGTGTCATTTTAATAAGTTGGGATACATGT
1201 TTAGTTTTTCCTTATATTCCTGTTCAGTGAACAGATTTTCATAATTCTCACTTGTTAAAGTGCTGCAAAAATTGCATTTT
1281 CAGTACTCTAAATTACTACATTAGAAGAGAGCATTTCTCCATTGTCTTTATTTTCTGTTATATATGTGTTGTAAAAGTAC
1361 ACTACATTAGAAGGGAGCTTTTCCGTTGTCTTTATTTTCTGTTATACATGTGTTGTTAAAGTACATGCATTCTTAGACTA
1441 ACTCTCAGATGCTTTGCTCTTTTGGAGCTGAAGAATTGTTTGATGGTGATGTCATATATCTGATAGATTAGTTTCAGTGG
1521 TTCTCATTTCACTTTTATACGTAATTTCTTAACTATATTAAGATAGTTGCAGGCAGTGTACCTCAGGTTGACTCTGTACA
1601 TCTGAATAGTGAGTCACTAGTATTTTGCTTCAAGCCTTCTGAAAATATAACCATAGTTACCTAAGCACACAGTGAATAGT
1681 CACATGGTAGTACTTGTGATTAGAGCATGTAAAACAATGTAATTGAAAAGTCAGCTTCCATATTTTGTAGGGGAAATAGA
1761 ACACCCTACTTTTTATCTAGTGTGAAATATTTAATCGAATTTTTGTTGATTTATATTATGTTACCTGTGCTGAATTAGGT
1841 TTGGTACTTGTGTTTTGTTTGACATATTAGTAAGTTGCTTTTGCTTCTTTCTGTCAACTTATTTTTTAAATAAAATTGAT
1921 CTGGAAAAATTGTTAATGGGATGTTTTAAATAATGAATTTTTCATCCAGCATCAGTTGAAAAGGAAAAGAAAGCTTCATT
2001 ATGGAAATGACAATATTGAATATGACAGATAAGTTTATTTGCTTCTGTTTTAACTGCAGTTAATAGTACTAGACAACTTT
2081 AAGTGGAAAGCATTTAGTTTATTTCTTCACTTATTTGTAGAGTGAACAAATGATTCACAATTCTACAAGTAATTCCACTT
2161 AGGTAACTTACAGTTGTTAGGTTTGACAATAAAGATCTACTATGAGAGGAGAAGAATTTATGGGTTTTGGGTGGAAGGAA
2241 TTTCTCAAAGAAATAAAAAATGTTCTTTGCCCTTGATACTGCAAACCCACTGATACAAGTGCCTTGAATTTATTATTATT
2321 ATTATTTTTTATTTTTTTGAGATGGAGTTTCACTCTTGTCTCCCAGGCTGGAGTGCAATGGCGCGATCTTGGCTCACTGC
2401 AACCTCCGCTCGCTGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCGGAGTAGCTGGGATTACAG
2481 GCACCTGCCACCAAGCACGGCTAATTTTTGTATTTTTAGTAGAAACGGGGTTTCGCCATGTTGGCCAGGCTGGTCTCGAA
2561 CTCCTGACCTCAGATGATCCACTCACCCCAGCCTCCCAAAGTGCTGGGATTACAGACGTGAGCCACTGCGCCCGGCGCAA
2641 GTCTTTGTTAAAAGTAGAGATGGAGGCCAGGCGCAGTGGCTCACTCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCAGG
2721 CAGATCACGAGGTCAGGAGATCGAGACCATCTTGGCTAACACGGTGAAACCCCGTCTCTACTGAAAATACAAAAAATTAG
2801 CCGGGCAGGGTGGCGGGCGCCTGTAGTCCCAGCTACTCCGAGGCTGAAGCAGGAGAATGGCGTCAAGCGGCGAGGCGGAG
2881 CTTGCGGTGAGCCGAGATCATGCCGCTGCACTCCAGCCTGGGCAACAGAGCAAGACTCCATCTCAAAAAGAAAAAAAAAG
2961 TAGAGATGGGATCTCTAGCCTCCTAAGTTAATTTAGCCTCCCAAATGCCAGACAAAGAATCTAACATAAAATTTACCTTG
3041 AATAAGATATATGATATTGATTCTGAGCTGCTTTGTATTTTTTCTGACTTTGGCATCTGTATCTTGGTGCTTTCTGTTAG
3121 ACTGGTAGAGTTTAAGAACCTAAGGAGTATGCATTGTACTTCAGTGCTAACTTTTTTCTTCATTTACTTTCTGTGTATAT
3201 AGGCAGCATATTTTTTTTGTAGAACATTAACCCAGATTGCTAATAGCTTCATGTTACGGCATTCTTCCACACAGTCCAGA
3281 TTGATTTAAGGAAAAGCAGAAATGGAAGTCAAAGTGTGTTATAAATTGAGACTGAAAAACATGCTTTAAAAAATAGATTT
3361 AATTTCTTACACTGTGAATAGCCATTGTATTGTTTTGTTTCTGATAAATCAGTTGTTTTGGGCCCCTATTTTTGAACTGT
3441 TAAAAAATTTTGATGCTTTTCGTGGATAAAAGTAGTGCCTCTCTTTATACAACTGATGGGGTTTTAAAAAGTGTAAATTG
3521 CCTTTTTTGTTAAACTTATTTTAAATGCTTTAGTATTTAAAGGGTGTATGTTATTAATTAATCTGCATATTTGTAACGCA
3601 AATAACTACTTCCTGATTTACATCTCAATATATTCTTCTTTCATTTGCCCAATTTAAAAAATACGTAGTCTCTATTGTTG
3681 CTGTTTACTAATAGTTTTAGATCCCAATGTGTATTAGAATTATAGCTACAAAAAGTTGCAAGTAAAATTTAGCAATTTCC
3761 TATTCAAACAGGATCTCATTAGTATGTTTTTTAATGTGTAGAATTAACACTTTAAAATAAACAGGTGTGAAAATTATAAA
3841 GGAATATATATGACAATTATTTTCTGTACATTAATGTCTAAACATTATACTTACTTTTTCATAATAAAGGAAATTTTGGA
3921 ACCAAATTTGCTGAGTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUA--ACAGUGUGAGGu 5'
            :| |:|||   | ::|||||| 
Target 5' ccGAGATCATGCCGCTGCACTCCa 3'
2892 - 2915 138.00 -16.80
2
miRNA  3' guuUGUGGUAACA----GUGUGAGGu 5'
             ||: |||| |    |||| ||| 
Target 5' gttACGGCATTCTTCCACACAGTCCa 3'
3253 - 3278 129.00 -14.60
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ||||| :|| ||||| ||: 
Target 5' acAACACAGTT-TCACAGTCTa 3'
1040 - 1060 127.00 -14.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM6649091 5 COSMIC
COSN31557876 14 COSMIC
COSN26974128 24 COSMIC
COSN30186027 79 COSMIC
COSN31525042 92 COSMIC
COSN30164879 98 COSMIC
COSN29269646 177 COSMIC
COSN31515571 316 COSMIC
COSN31600268 346 COSMIC
COSN8111839 413 COSMIC
COSN9689087 545 COSMIC
COSN26217126 881 COSMIC
COSN6370804 1154 COSMIC
COSN31962988 1726 COSMIC
COSN16465345 2160 COSMIC
COSN8291232 2485 COSMIC
COSN5692675 2815 COSMIC
COSN25498601 2841 COSMIC
COSN16079393 3207 COSMIC
COSN9689088 3419 COSMIC
COSN9689089 3478 COSMIC
COSN17567631 3501 COSMIC
COSN21099512 3843 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1288134212 4 dbSNP
rs774551976 6 dbSNP
rs1450178102 8 dbSNP
rs759527888 11 dbSNP
rs1372355351 14 dbSNP
rs1432588572 15 dbSNP
rs1422216159 19 dbSNP
rs894786610 20 dbSNP
rs767605566 22 dbSNP
rs752503177 27 dbSNP
rs755997812 30 dbSNP
rs1268050141 31 dbSNP
rs763745771 32 dbSNP
rs753438010 33 dbSNP
rs1300388902 37 dbSNP
rs757001978 38 dbSNP
rs778273090 51 dbSNP
rs573528300 60 dbSNP
rs542151712 65 dbSNP
rs1308379375 66 dbSNP
rs999404758 82 dbSNP
rs1297939832 84 dbSNP
rs1367743856 89 dbSNP
rs1031230753 92 dbSNP
rs1295892226 114 dbSNP
rs1382099174 117 dbSNP
rs1368925053 121 dbSNP
rs918208747 152 dbSNP
rs958007398 161 dbSNP
rs1242009702 172 dbSNP
rs1365168766 175 dbSNP
rs1254078736 177 dbSNP
rs1169513193 184 dbSNP
rs1431899681 192 dbSNP
rs989773214 194 dbSNP
rs1200163138 199 dbSNP
rs966951099 203 dbSNP
rs1346081175 210 dbSNP
rs1269442353 222 dbSNP
rs562319582 223 dbSNP
rs765278420 227 dbSNP
rs1188924866 235 dbSNP
rs925442941 239 dbSNP
rs911243361 243 dbSNP
rs1274775030 255 dbSNP
rs1206794902 257 dbSNP
rs964002677 271 dbSNP
rs111481640 272 dbSNP
rs1272849600 278 dbSNP
rs1227246041 280 dbSNP
rs1038758694 290 dbSNP
rs183306323 297 dbSNP
rs185823273 313 dbSNP
rs1308742492 314 dbSNP
rs1047249977 322 dbSNP
rs532227845 324 dbSNP
rs1380185277 325 dbSNP
rs1167090843 330 dbSNP
rs1466400829 335 dbSNP
rs1051374911 337 dbSNP
rs1173818166 344 dbSNP
rs1432543801 354 dbSNP
rs1251836510 355 dbSNP
rs941635396 367 dbSNP
rs1055931496 382 dbSNP
rs145783705 391 dbSNP
rs1481867265 397 dbSNP
rs894820961 406 dbSNP
rs1195571300 407 dbSNP
rs1346203712 409 dbSNP
rs1011902249 414 dbSNP
rs1231651592 417 dbSNP
rs1323454219 419 dbSNP
rs1289058963 433 dbSNP
rs1172739539 436 dbSNP
rs1348831141 443 dbSNP
rs73697038 444 dbSNP
rs898971610 445 dbSNP
rs906303316 448 dbSNP
rs999667434 454 dbSNP
rs1443886905 456 dbSNP
rs1330143468 457 dbSNP
rs112200058 474 dbSNP
rs1033796509 480 dbSNP
rs764724061 504 dbSNP
rs958085193 522 dbSNP
rs1393125228 530 dbSNP
rs1443812049 531 dbSNP
rs1258637447 535 dbSNP
rs959438056 547 dbSNP
rs1013632565 550 dbSNP
rs1024942752 554 dbSNP
rs966961203 560 dbSNP
rs1279057442 576 dbSNP
rs1010828664 580 dbSNP
rs1018172662 585 dbSNP
rs140757704 587 dbSNP
rs866607284 587 dbSNP
rs1310308086 591 dbSNP
rs1451723985 595 dbSNP
rs766022399 597 dbSNP
rs976788912 599 dbSNP
rs1389263345 602 dbSNP
rs958255675 616 dbSNP
rs1233726079 618 dbSNP
rs534958192 627 dbSNP
rs1325968292 631 dbSNP
rs191120407 633 dbSNP
rs114211825 636 dbSNP
rs141229483 639 dbSNP
rs1444444057 640 dbSNP
rs910070615 640 dbSNP
rs1051386373 641 dbSNP
rs556723301 643 dbSNP
rs1445786818 644 dbSNP
rs940620566 646 dbSNP
rs1037645648 652 dbSNP
rs1432915715 653 dbSNP
rs1210580675 661 dbSNP
rs1177283994 668 dbSNP
rs1263952025 681 dbSNP
rs991608521 682 dbSNP
rs1244936479 687 dbSNP
rs916200664 689 dbSNP
rs950282378 697 dbSNP
rs1046076507 699 dbSNP
rs906162800 703 dbSNP
rs183315668 716 dbSNP
rs1169325351 721 dbSNP
rs1400478121 727 dbSNP
rs1463074396 733 dbSNP
rs866060687 738 dbSNP
rs757557313 739 dbSNP
rs188049527 746 dbSNP
rs553372293 748 dbSNP
rs1430025696 759 dbSNP
rs1024996452 768 dbSNP
rs1190914224 772 dbSNP
rs902492704 774 dbSNP
rs1199647065 775 dbSNP
rs1242104884 775 dbSNP
rs1453442943 783 dbSNP
rs1130289 786 dbSNP
rs1289727656 786 dbSNP
rs999916459 786 dbSNP
rs192145120 790 dbSNP
rs182862704 796 dbSNP
rs188686551 801 dbSNP
rs958529019 807 dbSNP
rs536561966 811 dbSNP
rs192571416 812 dbSNP
rs545353253 828 dbSNP
rs954473992 828 dbSNP
rs998092369 828 dbSNP
rs184963826 852 dbSNP
rs1302001457 856 dbSNP
rs1409984270 862 dbSNP
rs1372094521 885 dbSNP
rs1217101273 888 dbSNP
rs1257667730 889 dbSNP
rs1170862177 902 dbSNP
rs1408622107 908 dbSNP
rs1419389760 915 dbSNP
rs544852449 920 dbSNP
rs1479304189 926 dbSNP
rs951437432 937 dbSNP
rs754715188 938 dbSNP
rs1206741154 943 dbSNP
rs189075279 945 dbSNP
rs1436971142 948 dbSNP
rs753121539 950 dbSNP
rs1017467517 952 dbSNP
rs962822543 956 dbSNP
rs1321338463 958 dbSNP
rs532289597 972 dbSNP
rs545567823 997 dbSNP
rs574297363 1011 dbSNP
rs1351926627 1021 dbSNP
rs937217204 1030 dbSNP
rs1441069319 1032 dbSNP
rs1354264673 1039 dbSNP
rs1335293764 1042 dbSNP
rs1416593565 1043 dbSNP
rs1170338009 1048 dbSNP
rs1055645595 1058 dbSNP
rs1175768107 1061 dbSNP
rs950315359 1065 dbSNP
rs1414317430 1066 dbSNP
rs528027665 1088 dbSNP
rs1429727508 1089 dbSNP
rs981635488 1102 dbSNP
rs1480436239 1135 dbSNP
rs1162130929 1147 dbSNP
rs1349202184 1161 dbSNP
rs1212054327 1162 dbSNP
rs927653688 1165 dbSNP
rs191426715 1172 dbSNP
rs1358313401 1189 dbSNP
rs574897039 1193 dbSNP
rs1046541104 1205 dbSNP
rs1399174745 1216 dbSNP
rs537496960 1222 dbSNP
rs1304269215 1223 dbSNP
rs1362954549 1225 dbSNP
rs184676623 1239 dbSNP
rs1032717011 1242 dbSNP
rs35658347 1246 dbSNP
rs146945916 1247 dbSNP
rs1404515971 1256 dbSNP
rs1039588945 1266 dbSNP
rs1321628549 1276 dbSNP
rs996801903 1281 dbSNP
rs899641074 1282 dbSNP
rs998123474 1289 dbSNP
rs1418708718 1292 dbSNP
rs1223974400 1295 dbSNP
rs1183348221 1300 dbSNP
rs1442597786 1301 dbSNP
rs954896698 1302 dbSNP
rs1029955461 1310 dbSNP
rs1466201260 1322 dbSNP
rs749835683 1336 dbSNP
rs1242301570 1338 dbSNP
rs530695731 1342 dbSNP
rs962097106 1344 dbSNP
rs1321940577 1352 dbSNP
rs1476214409 1359 dbSNP
rs1291646111 1369 dbSNP
rs550409068 1370 dbSNP
rs1412523244 1376 dbSNP
rs1314804823 1378 dbSNP
rs1423890921 1385 dbSNP
rs1004658711 1386 dbSNP
rs1378428161 1397 dbSNP
rs116469718 1402 dbSNP
rs920222868 1405 dbSNP
rs1167118705 1406 dbSNP
rs1298623021 1409 dbSNP
rs1423007537 1409 dbSNP
rs1168999632 1412 dbSNP
rs962794635 1426 dbSNP
rs1451236647 1427 dbSNP
rs1259651063 1429 dbSNP
rs1345987659 1440 dbSNP
rs1185395899 1441 dbSNP
rs1488496200 1442 dbSNP
rs1247986099 1443 dbSNP
rs1012925127 1447 dbSNP
rs1023107133 1448 dbSNP
rs1291488626 1454 dbSNP
rs1229694050 1456 dbSNP
rs1309748495 1459 dbSNP
rs771406058 1463 dbSNP
rs971498109 1465 dbSNP
rs779024580 1467 dbSNP
rs57151588 1469 dbSNP
rs924891941 1473 dbSNP
rs779270371 1479 dbSNP
rs1368343858 1483 dbSNP
rs917152887 1492 dbSNP
rs750036861 1495 dbSNP
rs56323901 1497 dbSNP
rs1365248363 1498 dbSNP
rs1168981587 1502 dbSNP
rs772341363 1505 dbSNP
rs988236521 1511 dbSNP
rs924051000 1518 dbSNP
rs1426592564 1531 dbSNP
rs576784486 1533 dbSNP
rs1352194635 1539 dbSNP
rs148044018 1541 dbSNP
rs1039450428 1542 dbSNP
rs1481795129 1543 dbSNP
rs893775167 1565 dbSNP
rs765000509 1571 dbSNP
rs1313308918 1574 dbSNP
rs1448361251 1589 dbSNP
rs1221830933 1590 dbSNP
rs1050662870 1597 dbSNP
rs535449493 1601 dbSNP
rs1308913944 1603 dbSNP
rs890698845 1605 dbSNP
rs921103483 1609 dbSNP
rs761690355 1610 dbSNP
rs11025 1613 dbSNP
rs1050944203 1618 dbSNP
rs1184931528 1642 dbSNP
rs994968706 1643 dbSNP
rs141734801 1648 dbSNP
rs1004118216 1694 dbSNP
rs773107102 1701 dbSNP
rs898478132 1704 dbSNP
rs1236252340 1706 dbSNP
rs1439059879 1707 dbSNP
rs1183844336 1716 dbSNP
rs1027343213 1726 dbSNP
rs1409976248 1728 dbSNP
rs1412550848 1738 dbSNP
rs1012956067 1739 dbSNP
rs958639251 1743 dbSNP
rs1195644125 1752 dbSNP
rs150597016 1760 dbSNP
rs1130296 1764 dbSNP
rs1265580880 1769 dbSNP
rs558428682 1776 dbSNP
rs60193291 1797 dbSNP
rs545886072 1798 dbSNP
rs1241384055 1806 dbSNP
rs971301603 1826 dbSNP
rs138637117 1829 dbSNP
rs924410450 1839 dbSNP
rs1408181619 1840 dbSNP
rs1334551788 1847 dbSNP
rs935446974 1859 dbSNP
rs956518806 1860 dbSNP
rs1446774113 1865 dbSNP
rs1159807654 1867 dbSNP
rs750052018 1872 dbSNP
rs990390431 1874 dbSNP
rs1054302849 1880 dbSNP
rs915314137 1884 dbSNP
rs1280504840 1885 dbSNP
rs1245374339 1888 dbSNP
rs1353212228 1896 dbSNP
rs932016385 1898 dbSNP
rs914930761 1909 dbSNP
rs967668397 1921 dbSNP
rs1268839999 1922 dbSNP
rs1207043407 1926 dbSNP
rs1348771299 1940 dbSNP
rs1050380920 1957 dbSNP
rs764348417 1958 dbSNP
rs975169360 1965 dbSNP
rs1384675065 1967 dbSNP
rs1312649572 1971 dbSNP
rs1204991065 1972 dbSNP
rs528104448 1986 dbSNP
rs1365910754 1988 dbSNP
rs1036547516 2002 dbSNP
rs1380065150 2014 dbSNP
rs1383760972 2016 dbSNP
rs766403388 2022 dbSNP
rs1163425753 2028 dbSNP
rs933708479 2031 dbSNP
rs1426171858 2071 dbSNP
rs1387410233 2072 dbSNP
rs897966948 2074 dbSNP
rs1457259502 2079 dbSNP
rs79032546 2089 dbSNP
rs1027845863 2090 dbSNP
rs1195390340 2091 dbSNP
rs908339647 2110 dbSNP
rs1261168388 2119 dbSNP
rs1223418657 2120 dbSNP
rs939951169 2129 dbSNP
rs1435032612 2130 dbSNP
rs1012629109 2134 dbSNP
rs4338068 2144 dbSNP
rs573738085 2147 dbSNP
rs1245060223 2151 dbSNP
rs1342745045 2157 dbSNP
rs1271904515 2159 dbSNP
rs1190440873 2160 dbSNP
rs1023941554 2163 dbSNP
rs1323664256 2172 dbSNP
rs1406383445 2182 dbSNP
rs1428823864 2184 dbSNP
rs773920167 2185 dbSNP
rs1470455609 2195 dbSNP
rs1038250686 2202 dbSNP
rs779420592 2206 dbSNP
rs1424483714 2209 dbSNP
rs1420699595 2210 dbSNP
rs1170108289 2211 dbSNP
rs1474716399 2212 dbSNP
rs561345206 2235 dbSNP
rs1372516388 2241 dbSNP
rs1200302208 2247 dbSNP
rs1490900134 2250 dbSNP
rs971316145 2255 dbSNP
rs977313122 2266 dbSNP
rs1438132787 2271 dbSNP
rs1274889424 2283 dbSNP
rs1212679304 2285 dbSNP
rs758914997 2287 dbSNP
rs542557014 2296 dbSNP
rs1224864960 2297 dbSNP
rs1012903617 2303 dbSNP
rs1282193158 2304 dbSNP
rs753315946 2310 dbSNP
rs1355412578 2315 dbSNP
rs989989427 2316 dbSNP
rs915349029 2319 dbSNP
rs1396496066 2321 dbSNP
rs1044373405 2322 dbSNP
rs61259525 2325 dbSNP
rs10089823 2328 dbSNP
rs1032270645 2332 dbSNP
rs891942031 2339 dbSNP
rs1037047021 2346 dbSNP
rs570318027 2355 dbSNP
rs146309772 2356 dbSNP
rs1021853462 2358 dbSNP
rs930841410 2361 dbSNP
rs1205508594 2366 dbSNP
rs1320749990 2373 dbSNP
rs1269259175 2378 dbSNP
rs1480887101 2379 dbSNP
rs1282096553 2380 dbSNP
rs1201943396 2381 dbSNP
rs964953189 2383 dbSNP
rs975097093 2384 dbSNP
rs1027977606 2385 dbSNP
rs1440514120 2386 dbSNP
rs758619164 2387 dbSNP
rs547088710 2391 dbSNP
rs1403909733 2397 dbSNP
rs1471258193 2397 dbSNP
rs977774813 2397 dbSNP
rs1023995258 2407 dbSNP
rs908373919 2408 dbSNP
rs1410492751 2409 dbSNP
rs939834728 2412 dbSNP
rs1185276385 2413 dbSNP
rs1302929984 2424 dbSNP
rs1032038543 2425 dbSNP
rs1318317605 2429 dbSNP
rs1281765908 2451 dbSNP
rs1222869915 2453 dbSNP
rs1407133274 2455 dbSNP
rs957305802 2461 dbSNP
rs1316173339 2462 dbSNP
rs1339408825 2462 dbSNP
rs1227556723 2463 dbSNP
rs1336129351 2473 dbSNP
rs181895243 2479 dbSNP
rs1347063960 2487 dbSNP
rs1028077953 2488 dbSNP
rs1227604311 2496 dbSNP
rs1292398695 2498 dbSNP
rs1385571690 2499 dbSNP
rs1490794801 2504 dbSNP
rs535919505 2518 dbSNP
rs986156877 2519 dbSNP
rs1242496242 2523 dbSNP
rs1446592844 2525 dbSNP
rs1186570798 2527 dbSNP
rs1194010094 2528 dbSNP
rs1374799405 2535 dbSNP
rs185012763 2536 dbSNP
rs944740920 2539 dbSNP
rs972082692 2542 dbSNP
rs1386383352 2545 dbSNP
rs1312577325 2550 dbSNP
rs1215703252 2551 dbSNP
rs1364086245 2552 dbSNP
rs919542335 2558 dbSNP
rs1296693743 2559 dbSNP
rs1383816500 2564 dbSNP
rs1382379307 2565 dbSNP
rs1304695833 2567 dbSNP
rs1319717872 2570 dbSNP
rs930872493 2577 dbSNP
rs569262676 2578 dbSNP
rs1185485808 2586 dbSNP
rs1416694791 2586 dbSNP
rs1490403421 2594 dbSNP
rs538544968 2596 dbSNP
rs1270661128 2616 dbSNP
rs1219831236 2618 dbSNP
rs1234580879 2619 dbSNP
rs536811400 2630 dbSNP
rs1309845370 2631 dbSNP
rs894622718 2634 dbSNP
rs1244578700 2635 dbSNP
rs1218134956 2637 dbSNP
rs1467843984 2641 dbSNP
rs1403370049 2644 dbSNP
rs1389659093 2646 dbSNP
rs948846933 2648 dbSNP
rs1463448539 2651 dbSNP
rs558446623 2652 dbSNP
rs1352733162 2658 dbSNP
rs1169319018 2660 dbSNP
rs1480452763 2667 dbSNP
rs1430835645 2668 dbSNP
rs1045536371 2669 dbSNP
rs1196752458 2683 dbSNP
rs1479914066 2702 dbSNP
rs1267094547 2706 dbSNP
rs906940884 2709 dbSNP
rs998964170 2723 dbSNP
rs1481887984 2724 dbSNP
rs1250173880 2730 dbSNP
rs1315698777 2740 dbSNP
rs1361458753 2743 dbSNP
rs1265081414 2748 dbSNP
rs1031293706 2749 dbSNP
rs1330798335 2753 dbSNP
rs893050118 2761 dbSNP
rs1237721449 2767 dbSNP
rs1330550499 2772 dbSNP
rs578140777 2775 dbSNP
rs1470262645 2784 dbSNP
rs1407581515 2786 dbSNP
rs1173708483 2798 dbSNP
rs1465231621 2800 dbSNP
rs1028133420 2801 dbSNP
rs565256424 2804 dbSNP
rs540436990 2805 dbSNP
rs1248901773 2811 dbSNP
rs1206014774 2815 dbSNP
rs953906520 2816 dbSNP
rs1201921634 2820 dbSNP
rs554327401 2823 dbSNP
rs1019021028 2824 dbSNP
rs966152199 2829 dbSNP
rs972478025 2831 dbSNP
rs1453270270 2839 dbSNP
rs919231817 2840 dbSNP
rs952414699 2841 dbSNP
rs1157241674 2843 dbSNP
rs985082625 2849 dbSNP
rs1451182110 2866 dbSNP
rs1454622826 2869 dbSNP
rs764492661 2870 dbSNP
rs916149587 2872 dbSNP
rs1399575059 2873 dbSNP
rs1186080879 2877 dbSNP
rs572899153 2878 dbSNP
rs1045929576 2880 dbSNP
rs139466355 2887 dbSNP
rs773176806 2891 dbSNP
rs1246496730 2895 dbSNP
rs1053209593 2900 dbSNP
rs1384582047 2904 dbSNP
rs1306200254 2905 dbSNP
rs746061006 2922 dbSNP
rs1326434218 2924 dbSNP
rs1319733138 2925 dbSNP
rs1011641446 2929 dbSNP
rs201618958 2936 dbSNP
rs1262757875 2938 dbSNP
rs889692139 2941 dbSNP
rs1387511009 2942 dbSNP
rs1343085953 2945 dbSNP
rs1008057422 2951 dbSNP
rs1161910699 2951 dbSNP
rs1472768167 2951 dbSNP
rs561357292 2952 dbSNP
rs1195504415 2956 dbSNP
rs1476947089 2959 dbSNP
rs1262803763 2960 dbSNP
rs1203136488 2961 dbSNP
rs1263769198 2964 dbSNP
rs1223527315 2966 dbSNP
rs1490767488 2967 dbSNP
rs1289328217 2972 dbSNP
rs1209107621 2975 dbSNP
rs1019369816 2976 dbSNP
rs1463050834 2980 dbSNP
rs1177386341 2983 dbSNP
rs1250413056 2988 dbSNP
rs966536526 3003 dbSNP
rs1406402634 3009 dbSNP
rs1367787471 3010 dbSNP
rs1420097901 3013 dbSNP
rs144304726 3018 dbSNP
rs1026797287 3027 dbSNP
rs1375598817 3032 dbSNP
rs1405286860 3043 dbSNP
rs952106857 3045 dbSNP
rs1169703544 3050 dbSNP
rs1468916077 3051 dbSNP
rs1464086480 3053 dbSNP
rs984779672 3057 dbSNP
rs745972003 3058 dbSNP
rs1407747773 3066 dbSNP
rs1197982996 3070 dbSNP
rs1463594478 3077 dbSNP
rs916205098 3079 dbSNP
rs530148015 3090 dbSNP
rs1316677724 3096 dbSNP
rs1263238758 3097 dbSNP
rs1224958030 3107 dbSNP
rs970258429 3109 dbSNP
rs1273413440 3123 dbSNP
rs1436270746 3137 dbSNP
rs981614975 3139 dbSNP
rs1336749921 3140 dbSNP
rs1297589905 3151 dbSNP
rs1373926659 3154 dbSNP
rs1464522464 3161 dbSNP
rs1399566155 3163 dbSNP
rs1177316864 3165 dbSNP
rs548132399 3188 dbSNP
rs1471073484 3198 dbSNP
rs1392951086 3203 dbSNP
rs928789638 3206 dbSNP
rs1052898084 3211 dbSNP
rs934425153 3211 dbSNP
rs1343885598 3213 dbSNP
rs1457309577 3219 dbSNP
rs914294197 3240 dbSNP
rs947107485 3243 dbSNP
rs1049384537 3248 dbSNP
rs1277418116 3253 dbSNP
rs758359988 3258 dbSNP
rs1325822360 3259 dbSNP
rs889705140 3265 dbSNP
rs1445196100 3267 dbSNP
rs1376897527 3268 dbSNP
rs28516448 3282 dbSNP
rs1454690597 3291 dbSNP
rs1357519739 3292 dbSNP
rs1251278513 3311 dbSNP
rs73697039 3315 dbSNP
rs200424559 3317 dbSNP
rs1409876544 3319 dbSNP
rs897008364 3339 dbSNP
rs1156686649 3341 dbSNP
rs1438979114 3348 dbSNP
rs1265631015 3349 dbSNP
rs1185373616 3356 dbSNP
rs1481968122 3367 dbSNP
rs747270339 3370 dbSNP
rs1236386940 3374 dbSNP
rs546503747 3377 dbSNP
rs190301341 3389 dbSNP
rs1238479229 3391 dbSNP
rs1430946666 3402 dbSNP
rs550104399 3411 dbSNP
rs1353588957 3423 dbSNP
rs1316284251 3427 dbSNP
rs1230559635 3429 dbSNP
rs1376994786 3439 dbSNP
rs1302396174 3445 dbSNP
rs1431747926 3453 dbSNP
rs1347218447 3456 dbSNP
rs1026430686 3458 dbSNP
rs768972942 3462 dbSNP
rs570057228 3463 dbSNP
rs1476578187 3465 dbSNP
rs1165323078 3466 dbSNP
rs1421998111 3473 dbSNP
rs1169084272 3484 dbSNP
rs952222745 3489 dbSNP
rs1476169524 3491 dbSNP
rs1355062882 3510 dbSNP
rs1215472189 3511 dbSNP
rs199748807 3512 dbSNP
rs377091395 3512 dbSNP
rs529406089 3522 dbSNP
rs549455778 3523 dbSNP
rs1320513052 3528 dbSNP
rs569276539 3536 dbSNP
rs1304028172 3538 dbSNP
rs1342480772 3540 dbSNP
rs538213895 3548 dbSNP
rs1347581353 3564 dbSNP
rs538933906 3589 dbSNP
rs1295125732 3596 dbSNP
rs1036335977 3599 dbSNP
rs956262374 3611 dbSNP
rs773197066 3616 dbSNP
rs1230345215 3633 dbSNP
rs1420876554 3643 dbSNP
rs552117449 3644 dbSNP
rs1480593909 3655 dbSNP
rs1270046723 3663 dbSNP
rs181183668 3665 dbSNP
rs557361052 3666 dbSNP
rs534503644 3668 dbSNP
rs554112238 3671 dbSNP
rs1265326197 3675 dbSNP
rs947100650 3682 dbSNP
rs1320014057 3701 dbSNP
rs574137177 3704 dbSNP
rs1223646669 3718 dbSNP
rs1256255186 3736 dbSNP
rs1218232051 3744 dbSNP
rs535180023 3745 dbSNP
rs796494925 3748 dbSNP
rs555019473 3749 dbSNP
rs574913042 3750 dbSNP
rs1484660831 3751 dbSNP
rs543840636 3751 dbSNP
rs564089396 3752 dbSNP
rs1366674281 3755 dbSNP
rs1040994212 3783 dbSNP
rs60370380 3790 dbSNP
rs1185442900 3794 dbSNP
rs897054338 3804 dbSNP
rs1397424395 3813 dbSNP
rs550377879 3814 dbSNP
rs1048664111 3824 dbSNP
rs79073746 3826 dbSNP
rs1425107249 3830 dbSNP
rs1006280070 3841 dbSNP
rs1431768479 3844 dbSNP
rs1267116240 3845 dbSNP
rs1178226893 3862 dbSNP
rs540510176 3867 dbSNP
rs1304682122 3878 dbSNP
rs1022989435 3879 dbSNP
rs1236425328 3882 dbSNP
rs1198130123 3883 dbSNP
rs560096265 3885 dbSNP
rs570884181 3888 dbSNP
rs1288509701 3893 dbSNP
rs1035980238 3899 dbSNP
rs1307454764 3902 dbSNP
rs1242223019 3914 dbSNP
rs1374625731 3926 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuugugguaaCAGUGUGAGGu 5'
                     | ::|||||| 
Target 5' -------ugccGCUGCACUCCa 3'
1 - 15
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000414645.2 | 3UTR | UGCCGCUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.648 4.1e-4 0.729 4.0e-5 23 Click to see details
GSE28260 Renal cortex and medulla 0.706 3.5e-3 0.643 8.9e-3 13 Click to see details
GSE38226 Liver fibrosis 0.238 1.5e-1 0.300 9.3e-2 21 Click to see details
GSE17306 Multiple myeloma 0.125 2.0e-1 0.132 1.8e-1 49 Click to see details
GSE14794 Lymphoblastoid cells 0.091 2.0e-1 -0.077 2.4e-1 90 Click to see details
GSE21687 Ependynoma primary tumors 0.105 2.0e-1 0.181 7.6e-2 64 Click to see details
GSE28544 Breast cancer -0.167 2.2e-1 -0.196 1.8e-1 24 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.155 2.3e-1 0.254 1.1e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.357 2.4e-1 0.371 2.3e-1 6 Click to see details
GSE27834 Pluripotent stem cells 0.164 2.7e-1 0.256 1.7e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.126 2.8e-1 0.136 2.6e-1 24 Click to see details
GSE21849 B cell lymphoma 0.092 3.2e-1 0.432 9.6e-3 29 Click to see details
GSE19350 CNS germ cell tumors 0.13 3.4e-1 0.206 2.6e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.063 3.7e-1 -0.098 3.0e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.067 3.8e-1 -0.042 4.2e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.063 4.0e-1 -0.186 2.2e-1 20 Click to see details
GSE17498 Multiple myeloma 0.032 4.2e-1 -0.004 4.9e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.537 0.07 0.400 0.14 9 Click to see details
LIHC 0.206 0.08 0.052 0.36 49 Click to see details
KIRC 0.208 0.14 0.164 0.2 29 Click to see details
ESCA -0.411 0.25 -0.500 0.2 5 Click to see details
HNSC 0.666 0.27 0.500 0.33 3 Click to see details
KIRP -0.226 0.28 -0.350 0.18 9 Click to see details
STAD 0.145 0.37 -0.143 0.37 8 Click to see details
THCA 0.168 0.39 0.600 0.14 5 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
KICH 0.002 0.5 -0.071 0.43 8 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*