miRTarBase - #MIRT659260 -
pre-miRNA Information
pre-miRNA hsa-mir-15a   
Genomic Coordinates chr13: 50049119 - 50049201
Synonyms MIRN15A, hsa-mir-15a, miRNA15A, MIR15A
Description Homo sapiens miR-15a stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-15a-5p
Sequence 14| UAGCAGCACAUAAUGGUUUGUG |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1355089203 8 dbSNP
rs753467375 11 dbSNP
rs923737993 12 dbSNP
rs766120172 20 dbSNP
rs1359939022 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CUL3   
Synonyms CUL-3, PHA2E
Description cullin 3
Transcript NM_003590   
Expression
Putative miRNA Targets on CUL3
3'UTR of CUL3
(miRNA target sites are highlighted)
>CUL3|NM_003590|3'UTR
   1 AATGCGTTCAGAAATTTGATTTATTCTTGGACTGTACTCTTCGCATGGACTGGGAAGTTCTTTTAAATCATTAAATATTA
  81 AGACGACCATCTCTTCTATTAAATTACAGTACATGTTCTAGACCATTGAGATCAAGCCTTTACTCCCTTTGAGAGTTTCC
 161 AACATCAGTTGATTGAGCTTCAGGCTTTACAACGTTTATCCCTGTAGAGATCATCTTTACAGTTCCTCGGGAAAATGTGA
 241 ATGTGCTGCGTTTTGTTTTCTTTACTGTATGAAAACAGGAAAATAAAAGAGAAATTTAGAAAATACAGCTCATTACAATA
 321 AAATTGTTGGATTTCATTTCCCCAGGTCTTCAGTGTTGATGTAAATGTGTTTTGTAGTGTTGCTTAGCACTTTGCGCATT
 401 GTGTAAGTTGGGTAACAAAAATGGCAAAAGAAATGCAGATTTCCCAGTTATCTTGCTCTGAAGACATTTCTTTAGCTAGT
 481 CTTATTTAATTTTAAAGGTTTGATAAATATACAAAGACCCAAGCATACAATTTGAGCATGCTGTATTCTACCACTTGCAC
 561 TTACTCATCTTCTAGCCTTATGACCAGGAACCTTTGTTTTGGGCTCAAGTACACATCCTGATTTGGTTTCTCCCTGTTGT
 641 AATTTGAGATTTCCCAAATTAAGTCTTATAATGATTAGGTTTTGTTCTGAGTTATTTCTAGAGAAAGAAAGTATTTTAGT
 721 ATGTGTAAATTGTACAATAATTTTTTTGCTGTTGTACTCACTGCTAATAGTGGATTGTATAGGGTGGTGTTTTTATTTCA
 801 TTTATTGTAGACAAAAATAATGAATTTAGTATACACATACCCACTAATTCAAGTATGTCAGAGCACAAAGTTGGCAGCTG
 881 GTTATATTTAATTCAGCCCCTCTGAAAAGCACATACAGTCTATACTTTGTTTATAAATACCCTAGGTCCTCCCTGCCCCT
 961 AAATATATATTTTGGTGAAGCTGTGGTGCACTATTAATTTTCTGTTTCAAAATGCAATCTAAAGATGCAATAAATATGAT
1041 GACCTTGATAGTTTTAATGAAATCTTCAATTCTTGCAGCTGTGTTTTGGAAAGTGATTAAGCAATATTTCTCAAACCTGA
1121 TGATTCTTGGATATTTAGCTATTGTCCTCCAAAGAGTCATCGTTTCACGTTTTCAAACATGTGCTTTGTGCTGAAGATTC
1201 TTGTCAGATATCCTGTGCTTCCAGAGTATTTTTATCTTCAATTTTATTTAATTTTGTTTCATTTTGTTTTCATAAGACAA
1281 TGTTTCAGATATGTAATGGGGCAAACCACTATAGATTTCTGTTGGATAGAAAAATGAAATGTTACTAATAAGTTTAAATT
1361 GACCCTTCGTTGACTATCAGTACTGTTGATACATTTATTAGAATGTATGTCTCAGAAGATGGTTTCTGTTTAAATTTATG
1441 GTCAAGTTACAACAACTGAATTCTAATATGGATTAAAAACTCCACATAAATATTTTTCCCCATGCGTCTTGGGTTATAAT
1521 TTTCCTTTTAGACTTGCAAATATGCTTTTATTGCAATTTTGTCTCCATCTGTACTGTAGAATTACAAGCCTTGTGCTCTT
1601 TATCTCTACATTTTCCACTTCTACATGATGCAATTAAGATGCCAATGAAAAGTATTGTGAACATTATTCTCAGGACACTT
1681 TTACCATACTTGAGTAGTACTAAGTCAGGTGTAACATGGAAAGCTAAGGGTTTCACCTTCTGATTTTGACATAATTGGAA
1761 ATTTTCTATAATGGTAAGATGTTTATAGGAAAGTAATGGTAGTTCATGTTTGAGAATTTTTTTATTGCTTTCATTTCCCA
1841 GTTAAATGATATTTAACACCTGGGAAAACAGGACAGCTCAGATTGTCGAGTTAGTAAACATGAGCGATGTAAAAACTTTA
1921 TTTGAAATCTCCTAAGTGAGACATTAAACATTTTAGTGCTAGTTTAAGCCATTAAAAGTAAAGTTTAAGTTTACGTCATT
2001 GTCTCAAGTGTGGCTGTAAAAATCAGATCTAGAGTTTAGAGACATACTTGTTAACTTTGGAGCACAGGTTTGATATTTAT
2081 GCTTCTAAATACATTAAAACATTTCTGAATTGCAGTTGAATGGTTGGAGATTGCTGGCGATGTGATGCTGCACTGAAAAA
2161 ACTGGTCACACAAAATGTTTATATGTTTGACTGCATAAGTATTATTTTAGGTCATAAAGGTTATAACAAAATACATTTAA
2241 CATTGCTTTCTTTTTAGCAAGAGGTCACAGATGCTATTTTTTCTCAGTTTTTAATGCTTTAATTTGAAAGAAAAATGCAT
2321 CCTAACCATTCCATCCTGTTGGTGCAGAGAAATTTTGGTGATTTATTAGAAGACTTTTAAGGAGGGTGGATACATAGTTT
2401 TTCAACTGCAAAAATCATGTCATCTCTTCAGTAACTGTTAAAGTGTAATTCTCTGCCTTCATTATCAAGTCCAGGACAGT
2481 GTTTATTTTGAATCGTTAACATTATTTAAAGACTGAAAATTCATTGCAATTAGGGAACGCACAGCCTCACAAAAAGTGGT
2561 TGTGATTGCAAGGATTCTTTATGTCAGTGAACTTAAAAAGGGAATGGGGGAAGAGATGCATGCCTTTCTAAAGGTATGCT
2641 AGAGTCACCTGTGTAGCATTGTAATTATGTACTATCAAACCCCCAAGATGCTGATGATAGGCCTTCTCTGTAAGAATCCT
2721 TCTCATAGTGAAGCACTGTTGATGTTTTGTTCACCGGATATGTTGGGTAGCAGAAAAGGCCTAGAACCAGTTTTAAGATT
2801 ATGCCTACATCTCTAGAAGACTAGTACACTGGCATCATCTTAGGTTTCTAAATATTATTTAATTCCTTAATTTGGAAAGC
2881 AGTTTTAATGTTTACAGTTTAAGATACTCATTTTCAGTAACTAGTGTTAAAGATTTTTATCTTTGCCTGTCTACTGTAAC
2961 TTAAGACTTTCATAGAATAATTTTTTATAGAGTATATGGTATATTGTGTCAATCTTGGAAGGAAAGCTGTTGCATATCAA
3041 TTGTAGGTCATGTATTTTACTATATGTTGCATAGTATTTTGCATTCTGTAAATACGAATGTTAAAACATTTCAGGTCAGC
3121 AAAATTAGAAGTCATTTCTAGTCCTCAAAGCAGAAATAATTAGAAATGTTAACATTTAAGTGCTTATCATATGCCAGATA
3201 CTATTCTGAATATTTTATGTATATTCATTCATTTAGTTGTCATATTGGCTTTATGTGACATAACTGTCATTATACCAGTG
3281 TTGTCCAAGGTTGCTAGCAGGAAATGGCAGAGCCAGGAGTTGGACCTAGGTTTAATCCTATCCATATTCCATGTTACAAA
3361 TTGACATGATTTTCCATATTAAAAAATTTTCATTTATTTTGTACCTCATTCACATGAATAGTAATGTGACAAACTAAAGT
3441 TAATACATGAAGCATTGCAATATGGAATTTTGCACATTTTTGTTAGCTTTACATTATTTGCTGATACCAACTTTTGGTAG
3521 GAAGGAAAACAGGGAAGGTGATTGCTGCTATTCTGGAATGTGTCCATTGAAAAGAAAATAGGCGCTTTGTCTCCTACAAT
3601 CTTAGAGAAAGTTTTACATACTTAAGTGGGTACCACAGATAGGCATGTACCTTAAATTCAAATCTACAGTTTTACAAAAT
3681 GTTTTCCTTTGTGTGCCTTTCCTATGTCAAATTAGCCAGAAGGAAGAAGAGACGTTAAGAATGGCAGATAAATTTAACAG
3761 GTAATGATACAGAGATTGGCCATTACGCCAGCTCTCAGGAGAAAAACAACTAGGATGTCTTGAAACCCGTGCATTTAATT
3841 TTAGAAATGGCAAATTTGTAAGCGTGTCATTTAAGTAATTTGATGCTCAGTTTTAGGGTCTAAGTTGACCTCGAGTGAGC
3921 CATGCAAAAATAGCTTTAAAATTATACATGAGCAGCTCAAAGTAAACGTGTATTTTTTAGTAACAATGAAATTGTCAAAT
4001 TTCAAGATTTTAATAACAGGACAGTTCAACTAATAAACTTTATTGCATACAAGATTTATTGCAATGTGGGAAAATTAAAA
4081 TTCTCAGTCTCAGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' gugUUUGGUAAUACACGACGAu 5'
             ::|  :| || ||||||| 
Target 5' cagGGAAGGTGAT-TGCTGCTa 3'
3530 - 3550 146.00 -10.70
2
miRNA  3' gugUUUGGUA-AUACACGACGau 5'
             ||| ::|  |||||||||  
Target 5' gggAAAATGTGAATGTGCTGCgt 3'
229 - 251 143.00 -12.50
3
miRNA  3' guGUUUG---GUAAUA-CACGACGAu 5'
            :|||:   : ||:| |||:|||| 
Target 5' tgTAAATGTGTTTTGTAGTGTTGCTt 3'
360 - 385 140.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
898277 84 ClinVar
334625 89 ClinVar
897116 124 ClinVar
334624 207 ClinVar
334623 270 ClinVar
334622 294 ClinVar
897115 496 ClinVar
897114 499 ClinVar
897113 527 ClinVar
897112 540 ClinVar
334621 545 ClinVar
896654 664 ClinVar
896653 736 ClinVar
896652 782 ClinVar
896651 784 ClinVar
896650 790 ClinVar
334620 896 ClinVar
334619 905 ClinVar
895226 915 ClinVar
334618 940 ClinVar
334617 1250 ClinVar
334616 1403 ClinVar
334615 1457 ClinVar
334614 1483 ClinVar
334613 1498 ClinVar
334612 1506 ClinVar
334611 1518 ClinVar
334610 1774 ClinVar
334609 1872 ClinVar
899315 1883 ClinVar
334608 1938 ClinVar
899314 1943 ClinVar
899313 2008 ClinVar
334607 2038 ClinVar
334606 2073 ClinVar
334605 2093 ClinVar
334604 2118 ClinVar
334603 2130 ClinVar
334602 2192 ClinVar
334601 2193 ClinVar
334600 2195 ClinVar
334599 2272 ClinVar
898209 2341 ClinVar
334598 2424 ClinVar
334597 2431 ClinVar
334596 2469 ClinVar
898208 2553 ClinVar
334595 2584 ClinVar
334594 2653 ClinVar
896581 2689 ClinVar
334593 2756 ClinVar
334592 2766 ClinVar
896580 2851 ClinVar
334591 2854 ClinVar
334590 2863 ClinVar
334589 2868 ClinVar
334588 2912 ClinVar
334587 2923 ClinVar
334586 2945 ClinVar
334585 2950 ClinVar
334584 3026 ClinVar
334583 3096 ClinVar
895162 3134 ClinVar
334582 3148 ClinVar
334581 3156 ClinVar
334580 3367 ClinVar
334579 3392 ClinVar
334578 3463 ClinVar
334577 3533 ClinVar
899257 3596 ClinVar
334576 3665 ClinVar
334575 3672 ClinVar
334574 3737 ClinVar
334573 3753 ClinVar
334572 3766 ClinVar
334571 3786 ClinVar
334570 3789 ClinVar
898157 3810 ClinVar
898156 3922 ClinVar
898155 3958 ClinVar
898154 3973 ClinVar
334569 3991 ClinVar
334568 4088 ClinVar
COSN13974203 5 COSMIC
COSN13974202 6 COSMIC
COSN13974201 18 COSMIC
COSN31503830 18 COSMIC
COSN31517688 26 COSMIC
COSN30466796 42 COSMIC
COSN30130232 43 COSMIC
COSN30105286 60 COSMIC
COSN31488837 84 COSMIC
COSN30535902 96 COSMIC
COSN30523652 128 COSMIC
COSN31519237 296 COSMIC
COSN31481407 345 COSMIC
COSN4990365 360 COSMIC
COSN31485878 490 COSMIC
COSN31516392 492 COSMIC
COSN31532017 672 COSMIC
COSN31601083 740 COSMIC
COSN31546531 743 COSMIC
COSN28684149 774 COSMIC
COSN31593869 775 COSMIC
COSN31588970 789 COSMIC
COSN31540383 802 COSMIC
COSN22499333 815 COSMIC
COSN31589875 827 COSMIC
COSN28649673 940 COSMIC
COSN31484104 985 COSMIC
COSN31516982 1161 COSMIC
COSN31488258 1172 COSMIC
COSN15089815 1325 COSMIC
COSN7236623 1867 COSMIC
COSN24469181 2606 COSMIC
COSN8986363 2642 COSMIC
COSN23987494 3027 COSMIC
COSN26099589 3054 COSMIC
COSN15799620 3315 COSMIC
COSN16744573 3500 COSMIC
COSN22849359 3607 COSMIC
COSN1828378 3641 COSMIC
COSN29872400 3650 COSMIC
COSN20120031 3659 COSMIC
COSN26308187 3933 COSMIC
COSN9995006 4015 COSMIC
rs13016316 1774 GWAS
rs4674908 3367 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs922838946 1 dbSNP
rs775442743 4 dbSNP
rs769508278 5 dbSNP
rs138318320 6 dbSNP
rs1178456407 7 dbSNP
rs776234290 8 dbSNP
rs770398946 9 dbSNP
rs1020657340 11 dbSNP
rs1314299427 14 dbSNP
rs1053271536 19 dbSNP
rs752437469 31 dbSNP
rs1484062513 35 dbSNP
rs9668 39 dbSNP
rs1203900430 41 dbSNP
rs747521839 42 dbSNP
rs778211584 43 dbSNP
rs1355072081 45 dbSNP
rs758776467 47 dbSNP
rs748444450 51 dbSNP
rs923565278 55 dbSNP
rs1189879334 58 dbSNP
rs979161829 60 dbSNP
rs1487135074 67 dbSNP
rs1361250682 68 dbSNP
rs896117823 68 dbSNP
rs968196250 84 dbSNP
rs760583226 85 dbSNP
rs182225110 88 dbSNP
rs192166927 89 dbSNP
rs1270805974 91 dbSNP
rs775258233 94 dbSNP
rs1362578549 96 dbSNP
rs547491595 98 dbSNP
rs1049203594 106 dbSNP
rs994049843 113 dbSNP
rs1223798534 118 dbSNP
rs186807043 124 dbSNP
rs1459666676 130 dbSNP
rs898066518 137 dbSNP
rs1210056243 138 dbSNP
rs1379797879 160 dbSNP
rs1017345045 162 dbSNP
rs1294962370 166 dbSNP
rs1185285896 169 dbSNP
rs1427750514 178 dbSNP
rs560202733 179 dbSNP
rs779809602 192 dbSNP
rs1358905669 193 dbSNP
rs1427501310 194 dbSNP
rs77123441 205 dbSNP
rs1458958073 206 dbSNP
rs886055694 207 dbSNP
rs745363747 212 dbSNP
rs1028431609 219 dbSNP
rs998238208 221 dbSNP
rs773916110 222 dbSNP
rs944707920 225 dbSNP
rs758246089 228 dbSNP
rs1347268304 232 dbSNP
rs771284114 243 dbSNP
rs1282318913 246 dbSNP
rs546244355 249 dbSNP
rs1225096547 250 dbSNP
rs1284429405 256 dbSNP
rs1801827 260 dbSNP
rs113271056 267 dbSNP
rs986228251 269 dbSNP
rs527449132 270 dbSNP
rs1419189693 279 dbSNP
rs776027227 283 dbSNP
rs1267142426 285 dbSNP
rs1190569072 287 dbSNP
rs1473729295 289 dbSNP
rs1477023835 291 dbSNP
rs532967850 294 dbSNP
rs564205966 306 dbSNP
rs1486565060 309 dbSNP
rs1166951578 311 dbSNP
rs925131144 312 dbSNP
rs1367369201 321 dbSNP
rs1405415439 335 dbSNP
rs979672720 336 dbSNP
rs966686066 340 dbSNP
rs1021298294 341 dbSNP
rs778072232 342 dbSNP
rs1220167639 343 dbSNP
rs544531630 346 dbSNP
rs181626188 352 dbSNP
rs939089245 353 dbSNP
rs960378237 367 dbSNP
rs1277817893 368 dbSNP
rs1382922040 369 dbSNP
rs772518058 374 dbSNP
rs1182921907 377 dbSNP
rs1232553517 377 dbSNP
rs1001935585 378 dbSNP
rs561591751 384 dbSNP
rs1183680000 389 dbSNP
rs748563005 395 dbSNP
rs961276335 396 dbSNP
rs1162820875 420 dbSNP
rs1016879346 423 dbSNP
rs887528034 424 dbSNP
rs1411477423 427 dbSNP
rs1329257135 432 dbSNP
rs1353566464 434 dbSNP
rs1439497222 435 dbSNP
rs376961030 436 dbSNP
rs1027814917 438 dbSNP
rs1316612539 443 dbSNP
rs1382883682 444 dbSNP
rs1245950020 447 dbSNP
rs781259483 451 dbSNP
rs897955766 461 dbSNP
rs541625442 462 dbSNP
rs755297097 466 dbSNP
rs998185840 481 dbSNP
rs1205800897 485 dbSNP
rs1243863124 493 dbSNP
rs1444067843 496 dbSNP
rs1181781848 502 dbSNP
rs572958976 504 dbSNP
rs1383345459 508 dbSNP
rs1423277337 518 dbSNP
rs901305339 521 dbSNP
rs1168296800 522 dbSNP
rs1041045216 523 dbSNP
rs1171555841 527 dbSNP
rs1407928300 540 dbSNP
rs886055693 545 dbSNP
rs369378295 550 dbSNP
rs115972743 558 dbSNP
rs1050399787 562 dbSNP
rs1451319086 565 dbSNP
rs751530025 575 dbSNP
rs1328717526 578 dbSNP
rs1468503496 586 dbSNP
rs1254835720 592 dbSNP
rs1196612144 598 dbSNP
rs1337816014 600 dbSNP
rs553445597 605 dbSNP
rs1264016131 606 dbSNP
rs1317072280 609 dbSNP
rs745531588 614 dbSNP
rs1251736008 618 dbSNP
rs904756720 620 dbSNP
rs539421515 632 dbSNP
rs1299420994 636 dbSNP
rs1440291765 640 dbSNP
rs1371746958 655 dbSNP
rs577196781 656 dbSNP
rs1193808537 662 dbSNP
rs778642011 664 dbSNP
rs1474316138 665 dbSNP
rs1468912201 669 dbSNP
rs147054027 669 dbSNP
rs1173703434 676 dbSNP
rs945204111 679 dbSNP
rs1386484395 681 dbSNP
rs1299143977 692 dbSNP
rs1318219865 694 dbSNP
rs1463822705 702 dbSNP
rs1407182807 705 dbSNP
rs1284257248 707 dbSNP
rs1375603896 707 dbSNP
rs1323108676 709 dbSNP
rs894773973 710 dbSNP
rs1174852821 712 dbSNP
rs1351456441 712 dbSNP
rs1454340193 714 dbSNP
rs913710776 719 dbSNP
rs1260992793 722 dbSNP
rs1176228692 723 dbSNP
rs1269312090 730 dbSNP
rs1173477080 731 dbSNP
rs1365083157 734 dbSNP
rs531395316 736 dbSNP
rs1157443887 737 dbSNP
rs1383446913 748 dbSNP
rs1427048011 751 dbSNP
rs537781010 751 dbSNP
rs1345269372 753 dbSNP
rs1403381312 756 dbSNP
rs992495920 757 dbSNP
rs568774589 758 dbSNP
rs1251118952 760 dbSNP
rs960597314 761 dbSNP
rs1238426076 763 dbSNP
rs1258978776 779 dbSNP
rs926333413 782 dbSNP
rs1224616813 784 dbSNP
rs939079424 787 dbSNP
rs980398909 790 dbSNP
rs762720877 792 dbSNP
rs1252271627 797 dbSNP
rs1419235739 803 dbSNP
rs548761621 807 dbSNP
rs1377937689 809 dbSNP
rs1447050055 814 dbSNP
rs927731743 817 dbSNP
rs1365400325 823 dbSNP
rs972547647 826 dbSNP
rs561931113 840 dbSNP
rs1397500028 841 dbSNP
rs1027821171 843 dbSNP
rs1305038186 850 dbSNP
rs993238973 852 dbSNP
rs1385038439 853 dbSNP
rs962536296 854 dbSNP
rs1305792774 856 dbSNP
rs1315668405 857 dbSNP
rs1358597221 859 dbSNP
rs1019099657 868 dbSNP
rs1009587078 884 dbSNP
rs748891299 890 dbSNP
rs141660429 896 dbSNP
rs1050450410 899 dbSNP
rs954101790 902 dbSNP
rs764172604 905 dbSNP
rs1028279146 910 dbSNP
rs760530227 915 dbSNP
rs566417398 916 dbSNP
rs1393520059 917 dbSNP
rs765213850 918 dbSNP
rs965421693 918 dbSNP
rs1301898829 922 dbSNP
rs1435018456 925 dbSNP
rs1376875672 927 dbSNP
rs904483934 928 dbSNP
rs3768897 940 dbSNP
rs946122467 941 dbSNP
rs1453509184 943 dbSNP
rs1438503394 944 dbSNP
rs1364338661 945 dbSNP
rs1381966375 952 dbSNP
rs1297546205 959 dbSNP
rs968883678 960 dbSNP
rs1226303070 962 dbSNP
rs1022220466 966 dbSNP
rs1183831009 981 dbSNP
rs1421839469 993 dbSNP
rs1203767542 994 dbSNP
rs189573396 1013 dbSNP
rs1482600993 1017 dbSNP
rs562838096 1018 dbSNP
rs1385226450 1027 dbSNP
rs370849340 1030 dbSNP
rs913751477 1032 dbSNP
rs1262923501 1034 dbSNP
rs767009642 1034 dbSNP
rs1054789794 1037 dbSNP
rs1003240593 1043 dbSNP
rs1470394157 1043 dbSNP
rs879260680 1043 dbSNP
rs906265406 1059 dbSNP
rs939307487 1062 dbSNP
rs1036759180 1064 dbSNP
rs1362513963 1068 dbSNP
rs147917693 1068 dbSNP
rs1276003399 1069 dbSNP
rs184325409 1072 dbSNP
rs980619529 1078 dbSNP
rs530668812 1081 dbSNP
rs1282698976 1092 dbSNP
rs920247016 1104 dbSNP
rs1261856568 1110 dbSNP
rs561655789 1117 dbSNP
rs143366779 1123 dbSNP
rs1485788235 1124 dbSNP
rs921207950 1131 dbSNP
rs773711465 1136 dbSNP
rs1801826 1138 dbSNP
rs770467988 1141 dbSNP
rs1019569966 1151 dbSNP
rs1402550884 1154 dbSNP
rs1009061660 1159 dbSNP
rs924625568 1160 dbSNP
rs953491360 1161 dbSNP
rs1029250578 1162 dbSNP
rs1000424316 1165 dbSNP
rs1347122639 1178 dbSNP
rs977497292 1179 dbSNP
rs1273901491 1181 dbSNP
rs149216096 1184 dbSNP
rs748826614 1192 dbSNP
rs1365003267 1195 dbSNP
rs1224968100 1200 dbSNP
rs1284280926 1202 dbSNP
rs1415750118 1205 dbSNP
rs1215082521 1211 dbSNP
rs904534225 1215 dbSNP
rs1294452754 1219 dbSNP
rs1490610517 1220 dbSNP
rs1020268235 1223 dbSNP
rs1222156515 1223 dbSNP
rs559571280 1224 dbSNP
rs1471244042 1225 dbSNP
rs1399635364 1226 dbSNP
rs1177910183 1228 dbSNP
rs1407340489 1229 dbSNP
rs1439048809 1234 dbSNP
rs1384967994 1236 dbSNP
rs1021794807 1240 dbSNP
rs1159791024 1245 dbSNP
rs144788294 1250 dbSNP
rs546312224 1250 dbSNP
rs895895651 1256 dbSNP
rs1443909617 1258 dbSNP
rs1375479630 1259 dbSNP
rs1456383786 1260 dbSNP
rs1057454883 1261 dbSNP
rs958932141 1262 dbSNP
rs1228116855 1264 dbSNP
rs1288149678 1272 dbSNP
rs1439842109 1275 dbSNP
rs1367795728 1278 dbSNP
rs1188438653 1280 dbSNP
rs1035970076 1295 dbSNP
rs1232419160 1295 dbSNP
rs1003145714 1299 dbSNP
rs577158030 1300 dbSNP
rs939191433 1301 dbSNP
rs145426375 1302 dbSNP
rs1387018233 1312 dbSNP
rs1259901812 1313 dbSNP
rs1445103621 1319 dbSNP
rs906170434 1326 dbSNP
rs1036702018 1348 dbSNP
rs1411343996 1349 dbSNP
rs1329093292 1356 dbSNP
rs1399037293 1365 dbSNP
rs1285123845 1368 dbSNP
rs181211410 1369 dbSNP
rs1044975403 1376 dbSNP
rs773659113 1389 dbSNP
rs1244691962 1399 dbSNP
rs1282830508 1401 dbSNP
rs1341878975 1402 dbSNP
rs575153722 1403 dbSNP
rs4586622 1407 dbSNP
rs1257701538 1412 dbSNP
rs1316224416 1417 dbSNP
rs1205661224 1419 dbSNP
rs1243808853 1422 dbSNP
rs932500233 1439 dbSNP
rs1443003253 1447 dbSNP
rs555324518 1449 dbSNP
rs1234312359 1450 dbSNP
rs1186715110 1452 dbSNP
rs940468653 1456 dbSNP
rs756120079 1457 dbSNP
rs1476283871 1463 dbSNP
rs1168246348 1473 dbSNP
rs79297951 1483 dbSNP
rs1429672190 1484 dbSNP
rs886055692 1498 dbSNP
rs1326642976 1500 dbSNP
rs1319776248 1501 dbSNP
rs943963464 1502 dbSNP
rs1406131731 1505 dbSNP
rs886055691 1506 dbSNP
rs1332791137 1509 dbSNP
rs953544115 1512 dbSNP
rs886055690 1518 dbSNP
rs1431937061 1519 dbSNP
rs1029135923 1525 dbSNP
rs977866651 1529 dbSNP
rs1338790090 1531 dbSNP
rs770296361 1536 dbSNP
rs1225580472 1540 dbSNP
rs1263878414 1543 dbSNP
rs1344373292 1554 dbSNP
rs1165499404 1565 dbSNP
rs150067001 1566 dbSNP
rs376210064 1569 dbSNP
rs968825379 1574 dbSNP
rs1168301363 1575 dbSNP
rs979036647 1581 dbSNP
rs1194137719 1585 dbSNP
rs968976974 1588 dbSNP
rs1167100013 1592 dbSNP
rs1201104485 1593 dbSNP
rs1475240510 1594 dbSNP
rs1020740666 1595 dbSNP
rs1010248349 1596 dbSNP
rs991655001 1599 dbSNP
rs958837720 1600 dbSNP
rs1252941756 1602 dbSNP
rs1387793014 1604 dbSNP
rs188403358 1608 dbSNP
rs1214795525 1609 dbSNP
rs1338861412 1610 dbSNP
rs1407049785 1616 dbSNP
rs895768011 1622 dbSNP
rs1284191216 1623 dbSNP
rs1035756960 1625 dbSNP
rs183689329 1633 dbSNP
rs1035873670 1642 dbSNP
rs372944870 1644 dbSNP
rs570455233 1645 dbSNP
rs1352825206 1647 dbSNP
rs981656184 1649 dbSNP
rs1339709610 1656 dbSNP
rs905065320 1663 dbSNP
rs1224383639 1674 dbSNP
rs1267616498 1681 dbSNP
rs531497775 1686 dbSNP
rs1369532430 1687 dbSNP
rs748442342 1697 dbSNP
rs1015251675 1700 dbSNP
rs1004313564 1704 dbSNP
rs930602096 1705 dbSNP
rs1326504116 1706 dbSNP
rs1443097479 1711 dbSNP
rs888183683 1716 dbSNP
rs550118925 1727 dbSNP
rs1435704509 1728 dbSNP
rs560363718 1735 dbSNP
rs193116009 1738 dbSNP
rs940371027 1742 dbSNP
rs911523534 1748 dbSNP
rs1169815117 1749 dbSNP
rs987231072 1750 dbSNP
rs931705945 1751 dbSNP
rs903143790 1752 dbSNP
rs1247916059 1759 dbSNP
rs922116019 1763 dbSNP
rs1394630466 1765 dbSNP
rs567982837 1768 dbSNP
rs947399928 1771 dbSNP
rs13016316 1774 dbSNP
rs969259704 1783 dbSNP
rs937415943 1788 dbSNP
rs1446915210 1793 dbSNP
rs1020539731 1798 dbSNP
rs1166007286 1815 dbSNP
rs989445669 1819 dbSNP
rs528258386 1823 dbSNP
rs960083275 1825 dbSNP
rs1456622034 1841 dbSNP
rs1035642786 1846 dbSNP
rs1401248374 1848 dbSNP
rs559538784 1851 dbSNP
rs970113661 1852 dbSNP
rs1438698843 1853 dbSNP
rs1374648818 1854 dbSNP
rs1454506053 1855 dbSNP
rs962275502 1855 dbSNP
rs1320867136 1861 dbSNP
rs1242278142 1863 dbSNP
rs1015613899 1868 dbSNP
rs1318093047 1869 dbSNP
rs140669610 1872 dbSNP
rs1198302688 1878 dbSNP
rs532598594 1879 dbSNP
rs190478338 1883 dbSNP
rs1303580245 1886 dbSNP
rs952451189 1887 dbSNP
rs1182920855 1890 dbSNP
rs377157866 1892 dbSNP
rs1026656474 1895 dbSNP
rs1374621930 1896 dbSNP
rs1278834285 1899 dbSNP
rs1422465389 1902 dbSNP
rs898954615 1905 dbSNP
rs1424617779 1906 dbSNP
rs996510322 1911 dbSNP
rs780174465 1915 dbSNP
rs1442681758 1916 dbSNP
rs1355994057 1919 dbSNP
rs1467565337 1921 dbSNP
rs1331946215 1922 dbSNP
rs1303382343 1924 dbSNP
rs543811208 1933 dbSNP
rs899633662 1934 dbSNP
rs1340811434 1938 dbSNP
rs533374759 1938 dbSNP
rs1005178146 1942 dbSNP
rs1019400494 1943 dbSNP
rs890153682 1943 dbSNP
rs1008046079 1944 dbSNP
rs1375054201 1949 dbSNP
rs1210156377 1958 dbSNP
rs903083473 1959 dbSNP
rs1042003568 1961 dbSNP
rs1264342168 1971 dbSNP
rs1477639990 1986 dbSNP
rs1191750101 1987 dbSNP
rs751347016 1987 dbSNP
rs574916134 1994 dbSNP
rs750546745 1995 dbSNP
rs1175367410 1997 dbSNP
rs1358520082 1998 dbSNP
rs1177072266 2001 dbSNP
rs893092876 2003 dbSNP
rs1360898840 2007 dbSNP
rs1055802710 2008 dbSNP
rs185186023 2008 dbSNP
rs1235028275 2009 dbSNP
rs1209159050 2016 dbSNP
rs1311024203 2029 dbSNP
rs1042791188 2031 dbSNP
rs947600979 2037 dbSNP
rs770315174 2038 dbSNP
rs1214853124 2039 dbSNP
rs1271326327 2051 dbSNP
rs1280556967 2058 dbSNP
rs564393478 2063 dbSNP
rs913363674 2066 dbSNP
rs1212433273 2067 dbSNP
rs1423151726 2068 dbSNP
rs928733060 2069 dbSNP
rs10498161 2073 dbSNP
rs1380790599 2074 dbSNP
rs1418868611 2079 dbSNP
rs886055689 2093 dbSNP
rs146425747 2095 dbSNP
rs1436741025 2102 dbSNP
rs1292475273 2103 dbSNP
rs1364848426 2105 dbSNP
rs1224337014 2106 dbSNP
rs572505388 2118 dbSNP
rs1353533512 2120 dbSNP
rs1238450543 2122 dbSNP
rs1294386797 2125 dbSNP
rs928679389 2129 dbSNP
rs555995940 2130 dbSNP
rs1221073614 2132 dbSNP
rs1245111341 2138 dbSNP
rs559063682 2139 dbSNP
rs1481673839 2142 dbSNP
rs1250580675 2145 dbSNP
rs952330414 2148 dbSNP
rs1355101871 2161 dbSNP
rs1313660376 2162 dbSNP
rs538867247 2163 dbSNP
rs1027029303 2166 dbSNP
rs995971909 2167 dbSNP
rs1415653913 2172 dbSNP
rs1436671672 2173 dbSNP
rs144017210 2174 dbSNP
rs1211377806 2177 dbSNP
rs975085747 2180 dbSNP
rs77211302 2181 dbSNP
rs963255245 2182 dbSNP
rs1007952561 2188 dbSNP
rs1376888563 2190 dbSNP
rs1410774116 2190 dbSNP
rs3768898 2192 dbSNP
rs73993899 2193 dbSNP
rs1011869070 2194 dbSNP
rs886055688 2195 dbSNP
rs1484686953 2197 dbSNP
rs1241073969 2198 dbSNP
rs548070553 2202 dbSNP
rs752490582 2207 dbSNP
rs1318704178 2208 dbSNP
rs759079023 2214 dbSNP
rs1199410320 2217 dbSNP
rs1051459959 2218 dbSNP
rs1055790529 2220 dbSNP
rs995847804 2227 dbSNP
rs900147779 2230 dbSNP
rs1239080995 2232 dbSNP
rs1473021130 2236 dbSNP
rs1287598793 2256 dbSNP
rs528431659 2266 dbSNP
rs907220370 2270 dbSNP
rs1466853610 2271 dbSNP
rs556914502 2272 dbSNP
rs1398884707 2273 dbSNP
rs913424704 2275 dbSNP
rs1416923248 2276 dbSNP
rs1360117264 2283 dbSNP
rs1447773971 2298 dbSNP
rs1288413988 2302 dbSNP
rs907994985 2312 dbSNP
rs552315813 2317 dbSNP
rs930885446 2327 dbSNP
rs1163335450 2328 dbSNP
rs922239893 2332 dbSNP
rs1202207824 2336 dbSNP
rs938971844 2341 dbSNP
rs1419117499 2345 dbSNP
rs1442875767 2354 dbSNP
rs928898870 2372 dbSNP
rs980283111 2377 dbSNP
rs571674995 2379 dbSNP
rs1426423115 2384 dbSNP
rs1255132997 2390 dbSNP
rs193201485 2390 dbSNP
rs986480608 2401 dbSNP
rs1260574057 2403 dbSNP
rs1476575444 2405 dbSNP
rs1173756554 2415 dbSNP
rs761267638 2416 dbSNP
rs1332652327 2417 dbSNP
rs919897722 2422 dbSNP
rs886055687 2424 dbSNP
rs187337418 2426 dbSNP
rs1020534501 2427 dbSNP
rs1338620652 2429 dbSNP
rs10498160 2431 dbSNP
rs957497747 2437 dbSNP
rs1251073804 2439 dbSNP
rs1199777150 2440 dbSNP
rs1014797206 2451 dbSNP
rs1277987051 2461 dbSNP
rs1489163115 2462 dbSNP
rs1034243226 2466 dbSNP
rs1262029926 2468 dbSNP
rs886055686 2469 dbSNP
rs80094091 2479 dbSNP
rs907166643 2482 dbSNP
rs1478014857 2483 dbSNP
rs954491699 2494 dbSNP
rs1468853576 2495 dbSNP
rs1045762895 2501 dbSNP
rs1297909242 2503 dbSNP
rs1358929475 2508 dbSNP
rs768228838 2509 dbSNP
rs1005372662 2511 dbSNP
rs561315332 2515 dbSNP
rs1030273891 2520 dbSNP
rs1295072753 2522 dbSNP
rs996067230 2523 dbSNP
rs541072655 2526 dbSNP
rs572656280 2530 dbSNP
rs1021693768 2532 dbSNP
rs772571352 2538 dbSNP
rs1348144120 2539 dbSNP
rs558999959 2542 dbSNP
rs891532887 2549 dbSNP
rs1440895219 2553 dbSNP
rs1450569826 2570 dbSNP
rs1395830023 2573 dbSNP
rs1240587110 2583 dbSNP
rs1440833244 2583 dbSNP
rs886055685 2584 dbSNP
rs938854323 2586 dbSNP
rs1362393233 2587 dbSNP
rs565900258 2600 dbSNP
rs67993962 2601 dbSNP
rs1164075604 2614 dbSNP
rs182650154 2616 dbSNP
rs1044640951 2617 dbSNP
rs1379105032 2618 dbSNP
rs1447381579 2619 dbSNP
rs1170641290 2627 dbSNP
rs1429776561 2628 dbSNP
rs1392790782 2630 dbSNP
rs948960113 2636 dbSNP
rs919960756 2641 dbSNP
rs576254295 2642 dbSNP
rs913003991 2648 dbSNP
rs1355138691 2650 dbSNP
rs762436305 2652 dbSNP
rs3768899 2653 dbSNP
rs1259423968 2669 dbSNP
rs769028958 2669 dbSNP
rs957198902 2671 dbSNP
rs1178547220 2678 dbSNP
rs908626377 2679 dbSNP
rs986882927 2686 dbSNP
rs1248975644 2689 dbSNP
rs1480158861 2699 dbSNP
rs1188604319 2701 dbSNP
rs1034190826 2702 dbSNP
rs954541908 2703 dbSNP
rs979975786 2704 dbSNP
rs1401090507 2710 dbSNP
rs1465121703 2716 dbSNP
rs971340704 2717 dbSNP
rs1205575286 2724 dbSNP
rs1397575606 2725 dbSNP
rs1030159453 2727 dbSNP
rs1301404443 2736 dbSNP
rs974683215 2741 dbSNP
rs1024302381 2742 dbSNP
rs1279598375 2745 dbSNP
rs1004916559 2749 dbSNP
rs1372407197 2750 dbSNP
rs1250136853 2755 dbSNP
rs886055684 2756 dbSNP
rs964620984 2758 dbSNP
rs1255864264 2763 dbSNP
rs747359530 2766 dbSNP
rs1424551082 2774 dbSNP
rs1011667681 2776 dbSNP
rs1352749445 2778 dbSNP
rs766303885 2778 dbSNP
rs1373214042 2781 dbSNP
rs1303253332 2783 dbSNP
rs891422805 2798 dbSNP
rs1412647102 2799 dbSNP
rs944957097 2801 dbSNP
rs780267969 2807 dbSNP
rs533879256 2815 dbSNP
rs945708001 2816 dbSNP
rs1314538212 2819 dbSNP
rs764228714 2821 dbSNP
rs912901233 2822 dbSNP
rs989881411 2828 dbSNP
rs935737024 2832 dbSNP
rs1178704210 2850 dbSNP
rs772430576 2854 dbSNP
rs1264185421 2860 dbSNP
rs536790634 2863 dbSNP
rs997049760 2865 dbSNP
rs886055683 2868 dbSNP
rs1427317508 2871 dbSNP
rs745940459 2872 dbSNP
rs1044523198 2879 dbSNP
rs949010422 2880 dbSNP
rs1024253505 2882 dbSNP
rs898732172 2885 dbSNP
rs1432661401 2891 dbSNP
rs983794780 2895 dbSNP
rs950720096 2904 dbSNP
rs1360822867 2908 dbSNP
rs567860520 2912 dbSNP
rs994893998 2917 dbSNP
rs73077720 2923 dbSNP
rs1386784529 2924 dbSNP
rs1303359299 2926 dbSNP
rs1346284965 2929 dbSNP
rs1242831770 2931 dbSNP
rs1412026778 2932 dbSNP
rs1353345142 2935 dbSNP
rs1353211604 2939 dbSNP
rs41529948 2945 dbSNP
rs1009050298 2947 dbSNP
rs886055682 2950 dbSNP
rs890641407 2959 dbSNP
rs372269552 2963 dbSNP
rs1434811723 2972 dbSNP
rs934048318 2973 dbSNP
rs1160274349 2974 dbSNP
rs1399842567 2980 dbSNP
rs1156504645 2982 dbSNP
rs923140895 2987 dbSNP
rs1457991470 2989 dbSNP
rs529233653 2990 dbSNP
rs1324610581 2997 dbSNP
rs1369482740 2999 dbSNP
rs371707415 3001 dbSNP
rs1010241063 3003 dbSNP
rs368320818 3006 dbSNP
rs1054567683 3012 dbSNP
rs1156292856 3014 dbSNP
rs935726832 3016 dbSNP
rs974566823 3017 dbSNP
rs1180450883 3021 dbSNP
rs1467132115 3021 dbSNP
rs1364280254 3025 dbSNP
rs748865811 3026 dbSNP
rs914477515 3034 dbSNP
rs990059616 3038 dbSNP
rs1405562638 3040 dbSNP
rs1474077826 3042 dbSNP
rs1163668085 3047 dbSNP
rs565937250 3048 dbSNP
rs1466680142 3049 dbSNP
rs1332635442 3056 dbSNP
rs1354421123 3057 dbSNP
rs1440492669 3062 dbSNP
rs1286296483 3063 dbSNP
rs866374810 3065 dbSNP
rs1255690010 3066 dbSNP
rs1380215058 3071 dbSNP
rs1232891115 3079 dbSNP
rs1187412583 3082 dbSNP
rs867636678 3084 dbSNP
rs886055681 3096 dbSNP
rs1258421224 3109 dbSNP
rs1203439920 3114 dbSNP
rs1002601401 3126 dbSNP
rs1202234544 3128 dbSNP
rs1261784813 3133 dbSNP
rs552216335 3134 dbSNP
rs917085039 3141 dbSNP
rs17479770 3148 dbSNP
rs182663889 3150 dbSNP
rs950696252 3151 dbSNP
rs1419483401 3153 dbSNP
rs78383940 3156 dbSNP
rs530172153 3166 dbSNP
rs1039042009 3173 dbSNP
rs1381124847 3175 dbSNP
rs1004457219 3180 dbSNP
rs754752284 3187 dbSNP
rs1414480951 3190 dbSNP
rs887133977 3190 dbSNP
rs1017618818 3191 dbSNP
rs1342558347 3191 dbSNP
rs542923278 3195 dbSNP
rs934098011 3200 dbSNP
rs561379094 3219 dbSNP
rs1459684871 3226 dbSNP
rs1280577062 3232 dbSNP
rs1485878841 3233 dbSNP
rs1416983956 3234 dbSNP
rs1254985783 3236 dbSNP
rs1165357584 3245 dbSNP
rs1193327743 3245 dbSNP
rs1475684995 3246 dbSNP
rs1370381767 3247 dbSNP
rs1191155338 3248 dbSNP
rs921357301 3257 dbSNP
rs1446452349 3258 dbSNP
rs1039771851 3260 dbSNP
rs1174837255 3261 dbSNP
rs943216256 3264 dbSNP
rs1263060692 3266 dbSNP
rs1434515511 3268 dbSNP
rs1172143967 3271 dbSNP
rs1362738674 3272 dbSNP
rs1400835279 3274 dbSNP
rs954841560 3295 dbSNP
rs1211051457 3297 dbSNP
rs568777981 3306 dbSNP
rs751323426 3313 dbSNP
rs1009817426 3319 dbSNP
rs990500704 3323 dbSNP
rs1054112178 3334 dbSNP
rs1273004335 3340 dbSNP
rs999884114 3342 dbSNP
rs955964040 3343 dbSNP
rs1260532600 3344 dbSNP
rs1444815230 3352 dbSNP
rs924319837 3354 dbSNP
rs547732777 3357 dbSNP
rs755517300 3360 dbSNP
rs1234248382 3362 dbSNP
rs4674908 3367 dbSNP
rs565549043 3368 dbSNP
rs1267999376 3375 dbSNP
rs1188203242 3376 dbSNP
rs1044142933 3381 dbSNP
rs971000542 3383 dbSNP
rs1326437327 3386 dbSNP
rs1158217197 3391 dbSNP
rs886055680 3392 dbSNP
rs1321970264 3393 dbSNP
rs1012643482 3396 dbSNP
rs1407177022 3398 dbSNP
rs762658155 3399 dbSNP
rs917051460 3400 dbSNP
rs1393609403 3401 dbSNP
rs963234818 3412 dbSNP
rs1440072075 3418 dbSNP
rs545410048 3418 dbSNP
rs796981751 3423 dbSNP
rs1378849717 3429 dbSNP
rs929233188 3437 dbSNP
rs1259811326 3440 dbSNP
rs920537279 3443 dbSNP
rs1348078564 3444 dbSNP
rs1406834508 3444 dbSNP
rs1004913876 3447 dbSNP
rs887361909 3451 dbSNP
rs1393174305 3454 dbSNP
rs1051315140 3458 dbSNP
rs781170359 3461 dbSNP
rs76433087 3463 dbSNP
rs1199834497 3470 dbSNP
rs1390935811 3472 dbSNP
rs1473879349 3474 dbSNP
rs562788492 3475 dbSNP
rs1190571878 3497 dbSNP
rs1459883255 3498 dbSNP
rs1039822576 3500 dbSNP
rs139247052 3501 dbSNP
rs1252876321 3502 dbSNP
rs1214732572 3506 dbSNP
rs914413627 3507 dbSNP
rs1054292471 3511 dbSNP
rs1010177252 3514 dbSNP
rs934605106 3530 dbSNP
rs10612010 3533 dbSNP
rs1293468414 3534 dbSNP
rs749918111 3535 dbSNP
rs1211235105 3542 dbSNP
rs905496426 3545 dbSNP
rs924536991 3550 dbSNP
rs981283535 3554 dbSNP
rs1444401625 3560 dbSNP
rs757151773 3570 dbSNP
rs1188936065 3579 dbSNP
rs949738072 3584 dbSNP
rs764772276 3596 dbSNP
rs1370195535 3599 dbSNP
rs537457130 3601 dbSNP
rs929155648 3604 dbSNP
rs899010687 3607 dbSNP
rs1297453282 3608 dbSNP
rs1394088185 3609 dbSNP
rs1438361883 3613 dbSNP
rs1037545969 3614 dbSNP
rs1230975835 3618 dbSNP
rs1308668772 3620 dbSNP
rs1333696714 3620 dbSNP
rs1227324451 3623 dbSNP
rs1250061522 3625 dbSNP
rs1484444235 3640 dbSNP
rs991671820 3642 dbSNP
rs1484798367 3644 dbSNP
rs574153874 3646 dbSNP
rs969747965 3652 dbSNP
rs1427936236 3653 dbSNP
rs1169665735 3661 dbSNP
rs374191606 3665 dbSNP
rs982979231 3668 dbSNP
rs2396092 3672 dbSNP
rs1029939029 3673 dbSNP
rs933404090 3675 dbSNP
rs1290176831 3684 dbSNP
rs1362054842 3691 dbSNP
rs1395026791 3693 dbSNP
rs1192217734 3701 dbSNP
rs1314401236 3704 dbSNP
rs1479290014 3712 dbSNP
rs913996416 3713 dbSNP
rs571981348 3725 dbSNP
rs1032521345 3733 dbSNP
rs899861706 3734 dbSNP
rs5839066 3737 dbSNP
rs1208126121 3742 dbSNP
rs969670556 3746 dbSNP
rs1018269280 3750 dbSNP
rs558805673 3753 dbSNP
rs541115656 3754 dbSNP
rs1432567963 3756 dbSNP
rs1220943551 3760 dbSNP
rs893881920 3763 dbSNP
rs1452452995 3766 dbSNP
rs886055679 3766 dbSNP
rs1373920269 3769 dbSNP
rs1278779882 3770 dbSNP
rs1442612912 3774 dbSNP
rs1369247900 3775 dbSNP
rs1052912068 3786 dbSNP
rs886055678 3786 dbSNP
rs1310026199 3787 dbSNP
rs4234054 3789 dbSNP
rs1374998618 3790 dbSNP
rs902999581 3791 dbSNP
rs1045634838 3796 dbSNP
rs949953803 3797 dbSNP
rs868308694 3799 dbSNP
rs1026460390 3804 dbSNP
rs915618253 3808 dbSNP
rs991165537 3809 dbSNP
rs1178672678 3810 dbSNP
rs940993118 3810 dbSNP
rs191987903 3813 dbSNP
rs909635981 3814 dbSNP
rs993267933 3817 dbSNP
rs898953115 3822 dbSNP
rs549963856 3828 dbSNP
rs1325863440 3829 dbSNP
rs982916176 3846 dbSNP
rs536464065 3847 dbSNP
rs567732119 3848 dbSNP
rs1029824675 3850 dbSNP
rs977025239 3854 dbSNP
rs547601761 3863 dbSNP
rs1237606856 3864 dbSNP
rs1018725074 3865 dbSNP
rs1010912351 3867 dbSNP
rs893757131 3872 dbSNP
rs933292242 3878 dbSNP
rs1232705675 3883 dbSNP
rs1272491301 3887 dbSNP
rs1467065969 3889 dbSNP
rs1206409506 3894 dbSNP
rs562201390 3895 dbSNP
rs1031102069 3903 dbSNP
rs999536214 3912 dbSNP
rs903050266 3913 dbSNP
rs1045541323 3915 dbSNP
rs1475262207 3916 dbSNP
rs1163557000 3917 dbSNP
rs1416390600 3921 dbSNP
rs1330869232 3931 dbSNP
rs146239785 3932 dbSNP
rs1354328377 3943 dbSNP
rs1440384770 3945 dbSNP
rs776066073 3947 dbSNP
rs1315042492 3948 dbSNP
rs1356277388 3960 dbSNP
rs1291209644 3964 dbSNP
rs913918600 3967 dbSNP
rs950007162 3967 dbSNP
rs187193598 3973 dbSNP
rs1216273144 3979 dbSNP
rs925441859 3979 dbSNP
rs980971232 3987 dbSNP
rs12470077 3991 dbSNP
rs1259242930 3992 dbSNP
rs1343970054 3995 dbSNP
rs1485778045 3999 dbSNP
rs1318175940 4003 dbSNP
rs941055464 4006 dbSNP
rs576731629 4008 dbSNP
rs531838524 4013 dbSNP
rs1163207752 4014 dbSNP
rs1408591541 4017 dbSNP
rs1474703761 4018 dbSNP
rs1414021226 4019 dbSNP
rs1376333232 4022 dbSNP
rs1046840609 4023 dbSNP
rs959939189 4038 dbSNP
rs1025980836 4048 dbSNP
rs1328285057 4051 dbSNP
rs1431526471 4052 dbSNP
rs1270719645 4056 dbSNP
rs1361158897 4059 dbSNP
rs183842884 4076 dbSNP
rs922804160 4083 dbSNP
rs976910710 4084 dbSNP
rs556849083 4088 dbSNP
rs1348221737 4092 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' gugUUUGGUAAUACACGACGau 5'
             ::|  :| || ||||||  
Target 5' cagGGAAGGUGAU-UGCUGC-- 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000264414.4 | 3UTR | AACAGGGAAGGUGAUUGCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.789 1.8e-5 0.835 2.3e-6 20 Click to see details
GSE21032 Prostate cancer 0.324 1.4e-3 0.233 1.7e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.447 1.6e-2 -0.339 5.7e-2 23 Click to see details
GSE19536 Breast cancer 0.208 1.9e-2 0.175 4.1e-2 100 Click to see details
GSE28260 Renal cortex and medulla -0.559 2.4e-2 -0.396 9.0e-2 13 Click to see details
GSE19783 ER- ER- breast cancer 0.222 2.5e-2 0.169 6.8e-2 79 Click to see details
GSE21687 Ependynoma primary tumors 0.227 3.6e-2 0.229 3.4e-2 64 Click to see details
GSE14794 Lymphoblastoid cells -0.156 7.1e-2 -0.201 2.9e-2 90 Click to see details
GSE21849 B cell lymphoma 0.223 1.2e-1 0.229 1.2e-1 29 Click to see details
GSE17498 Multiple myeloma 0.176 1.4e-1 0.079 3.1e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.333 1.5e-1 0.427 8.3e-2 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.187 1.9e-1 0.205 1.6e-1 25 Click to see details
GSE28544 Breast cancer -0.139 2.6e-1 -0.383 3.2e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.111 3.0e-1 0.131 2.7e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.108 3.0e-1 -0.045 4.2e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.131 3.1e-1 0.094 3.6e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer -0.112 3.2e-1 -0.054 4.1e-1 20 Click to see details
GSE17306 Multiple myeloma 0.039 4.0e-1 0.036 4.0e-1 49 Click to see details
GSE38226 Liver fibrosis -0.051 4.1e-1 0.114 3.1e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.021 4.5e-1 0.166 1.8e-1 32 Click to see details
GSE32688 Pancreatic cancer -0.021 4.5e-1 0.166 1.8e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.824 0.09 1.000 0.5 4 Click to see details
LIHC -0.191 0.09 -0.165 0.13 49 Click to see details
STAD 0.231 0.1 0.151 0.2 32 Click to see details
KICH -0.246 0.12 -0.170 0.21 25 Click to see details
LUAD 0.37 0.12 0.448 0.07 12 Click to see details
KIRC -0.145 0.12 -0.141 0.13 68 Click to see details
HNSC 0.172 0.14 0.182 0.12 42 Click to see details
PRAD 0.14 0.17 0.221 0.06 50 Click to see details
KIRP -0.163 0.19 -0.308 0.04 32 Click to see details
COAD 0.337 0.21 0.238 0.29 8 Click to see details
CHOL 0.246 0.26 0.017 0.48 9 Click to see details
CESC 0.575 0.31 0.500 0.33 3 Click to see details
LUSC 0.078 0.32 0.172 0.15 38 Click to see details
PCPG -0.476 0.34 -0.500 0.33 3 Click to see details
THCA 0.054 0.34 0.056 0.34 59 Click to see details
BRCA 0.041 0.36 -0.058 0.3 84 Click to see details
BLCA -0.065 0.4 -0.302 0.11 18 Click to see details
ESCA -0.047 0.45 -0.100 0.38 11 Click to see details
UCEC -0.018 0.47 -0.091 0.36 19 Click to see details
UCEC -0.018 0.47 -0.091 0.36 19 Click to see details
UCEC -0.018 0.47 -0.091 0.36 19 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
691 hsa-miR-15a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000280 BMI1 BMI1 proto-oncogene, polycomb ring finger 5 3
MIRT000282 WNT3A Wnt family member 3A 3 2
MIRT000283 MYB MYB proto-oncogene, transcription factor 5 3
MIRT000284 CDC25A cell division cycle 25A 3 3
MIRT000285 CCND2 cyclin D2 3 5
MIRT000804 RAB9B RAB9B, member RAS oncogene family 1 1
MIRT000806 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT000808 TPI1 triosephosphate isomerase 1 1 1
MIRT000810 PDCD4 programmed cell death 4 3 2
MIRT000812 RAB21 RAB21, member RAS oncogene family 2 1
MIRT000815 BCL2 BCL2, apoptosis regulator 6 13
MIRT000817 WT1 Wilms tumor 1 2 1
MIRT000819 ASXL2 additional sex combs like 2, transcriptional regulator 2 1
MIRT000823 TMEM251 transmembrane protein 251 2 1
MIRT000825 CARD8 caspase recruitment domain family member 8 2 1
MIRT000827 CDC14B cell division cycle 14B 2 1
MIRT000829 CENPJ centromere protein J 2 1
MIRT000831 CEP63 centrosomal protein 63 2 1
MIRT000833 CREBL2 cAMP responsive element binding protein like 2 3 3
MIRT000835 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 1
MIRT000847 GOLGA5 golgin A5 2 1
MIRT000849 GOLPH3L golgi phosphoprotein 3 like 2 1
MIRT000851 GTF2H1 general transcription factor IIH subunit 1 2 1
MIRT000853 H3F3B H3 histone family member 3B 2 1
MIRT000855 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 1
MIRT000857 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 1
MIRT000859 HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 2 1
MIRT000863 HRSP12 reactive intermediate imine deaminase A homolog 2 1
MIRT000865 HSDL2 hydroxysteroid dehydrogenase like 2 2 1
MIRT000866 HSPA1A heat shock protein family A (Hsp70) member 1A 2 1
MIRT000868 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 1
MIRT000878 MCL1 MCL1, BCL2 family apoptosis regulator 2 1
MIRT000880 MSH2 mutS homolog 2 2 1
MIRT000884 OMA1 OMA1 zinc metallopeptidase 2 1
MIRT000886 OSGEPL1 O-sialoglycoprotein endopeptidase like 1 2 1
MIRT000888 PDCD6IP programmed cell death 6 interacting protein 2 1
MIRT000890 PHKB phosphorylase kinase regulatory subunit beta 2 1
MIRT000892 PMS1 PMS1 homolog 1, mismatch repair system component 2 1
MIRT000894 PNN pinin, desmosome associated protein 2 1
MIRT000896 PRIM1 DNA primase subunit 1 2 1
MIRT000898 RAD51C RAD51 paralog C 2 1
MIRT000900 RHOT1 ras homolog family member T1 2 1
MIRT000902 RNASEL ribonuclease L 2 1
MIRT000906 SLC35A1 solute carrier family 35 member A1 2 1
MIRT000908 SLC35B3 solute carrier family 35 member B3 2 1
MIRT000910 TIA1 TIA1 cytotoxic granule associated RNA binding protein 2 1
MIRT000914 UGDH UDP-glucose 6-dehydrogenase 2 1
MIRT000916 UGP2 UDP-glucose pyrophosphorylase 2 2 1
MIRT000922 ZNF559 zinc finger protein 559 2 1
MIRT001227 CCND1 cyclin D1 5 7
MIRT001228 CCNE1 cyclin E1 6 8
MIRT001802 BACE1 beta-secretase 1 2 1
MIRT002946 DMTF1 cyclin D binding myb like transcription factor 1 3 3
MIRT003333 BRCA1 BRCA1, DNA repair associated 2 2
MIRT003334 AKT3 AKT serine/threonine kinase 3 2 4
MIRT003872 WIPF1 WAS/WASL interacting protein family member 1 2 1
MIRT003873 VPS45 vacuolar protein sorting 45 homolog 2 1
MIRT003874 HSP90B1 heat shock protein 90 beta family member 1 2 1
MIRT003875 SKAP2 src kinase associated phosphoprotein 2 3 1
MIRT003876 NT5DC1 5'-nucleotidase domain containing 1 2 1
MIRT003877 FAM69A family with sequence similarity 69 member A 2 1
MIRT003878 C2orf74 chromosome 2 open reading frame 74 1 1
MIRT003879 FAM122C family with sequence similarity 122C 2 1
MIRT003880 PWWP2A PWWP domain containing 2A 2 1
MIRT003881 C17orf80 chromosome 17 open reading frame 80 2 1
MIRT003882 CCDC111 primase and DNA directed polymerase 2 1
MIRT003883 C2orf43 lipid droplet associated hydrolase 2 1
MIRT003884 C4orf27 histone PARylation factor 1 2 1
MIRT003885 NIPAL2 NIPA like domain containing 2 2 1
MIRT003886 TRMT13 tRNA methyltransferase 13 homolog 2 1
MIRT003887 ANAPC16 anaphase promoting complex subunit 16 2 1
MIRT003888 CADM1 cell adhesion molecule 1 3 1
MIRT003891 TMEM184B transmembrane protein 184B 2 1
MIRT003899 APP amyloid beta precursor protein 3 2
MIRT004046 UCP2 uncoupling protein 2 3 1
MIRT004275 VEGFA vascular endothelial growth factor A 6 11
MIRT004680 TSPYL2 TSPY like 2 2 1
MIRT004829 NFKB1 nuclear factor kappa B subunit 1 3 1
MIRT005552 CHUK conserved helix-loop-helix ubiquitous kinase 4 1
MIRT005763 TP53 tumor protein p53 1 1
MIRT006027 FGF7 fibroblast growth factor 7 2 1
MIRT006176 CLCN3 chloride voltage-gated channel 3 4 1
MIRT006177 CRKL CRK like proto-oncogene, adaptor protein 5 2
MIRT006181 MN1 MN1 proto-oncogene, transcriptional regulator 4 1
MIRT006658 Ccnd1 cyclin D1 1 1
MIRT006801 HMGA1 high mobility group AT-hook 1 4 2
MIRT006805 HMGA2 high mobility group AT-hook 2 3 1
MIRT006913 IFNG interferon gamma 2 1
MIRT006998 PURA purine rich element binding protein A 2 2
MIRT007090 RECK reversion inducing cysteine rich protein with kazal motifs 3 2
MIRT032077 DLK1 delta like non-canonical Notch ligand 1 2 1
MIRT051311 PLA2G2D phospholipase A2 group IID 1 1
MIRT051312 ACVR1B activin A receptor type 1B 1 1
MIRT051313 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 1 1
MIRT051314 GCLM glutamate-cysteine ligase modifier subunit 1 1
MIRT051315 PCF11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT051316 HIST1H2BK histone cluster 1 H2B family member k 1 1
MIRT051317 ODC1 ornithine decarboxylase 1 1 1
MIRT051318 CALD1 caldesmon 1 1 1
MIRT051319 RPP30 ribonuclease P/MRP subunit p30 1 1
MIRT051320 ASNSD1 asparagine synthetase domain containing 1 1 1
MIRT051321 CCNYL1 cyclin Y like 1 1 1
MIRT051322 RGPD5 RANBP2-like and GRIP domain containing 5 1 1
MIRT051323 PREB prolactin regulatory element binding 1 1
MIRT051324 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT051325 SNX6 sorting nexin 6 1 1
MIRT051326 CNN3 calponin 3 1 1
MIRT051327 KIF1A kinesin family member 1A 1 1
MIRT051328 NAB1 NGFI-A binding protein 1 1 1
MIRT051329 CCT6B chaperonin containing TCP1 subunit 6B 1 1
MIRT051330 CHD4 chromodomain helicase DNA binding protein 4 1 1
MIRT051331 CLCC1 chloride channel CLIC like 1 1 1
MIRT051332 GDI2 GDP dissociation inhibitor 2 1 1
MIRT051333 BRWD1 bromodomain and WD repeat domain containing 1 1 1
MIRT051334 MAPK6 mitogen-activated protein kinase 6 1 1
MIRT051335 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT051336 ATF2 activating transcription factor 2 1 1
MIRT051337 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT051338 FBXO3 F-box protein 3 1 1
MIRT051339 PRDX3 peroxiredoxin 3 1 1
MIRT051340 CABIN1 calcineurin binding protein 1 1 1
MIRT051341 FASN fatty acid synthase 1 3
MIRT051342 SEC63 SEC63 homolog, protein translocation regulator 1 1
MIRT051343 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 1 1
MIRT051344 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT051345 FOXO1 forkhead box O1 4 2
MIRT051346 TMEM214 transmembrane protein 214 1 1
MIRT051347 TRIM28 tripartite motif containing 28 1 1
MIRT051348 NOP2 NOP2 nucleolar protein 1 1
MIRT051349 MYBL1 MYB proto-oncogene like 1 1 1
MIRT051350 TTC1 tetratricopeptide repeat domain 1 1 1
MIRT051351 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 2
MIRT052930 REPIN1 replication initiator 1 2 1
MIRT053079 KLF4 Kruppel like factor 4 1 1
MIRT054283 YAP1 Yes associated protein 1 3 1
MIRT054424 CARM1 coactivator associated arginine methyltransferase 1 3 1
MIRT054895 SOX5 SRY-box 5 2 1
MIRT055421 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 6
MIRT055811 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT057514 CEP55 centrosomal protein 55 1 4
MIRT057729 ZDHHC16 zinc finger DHHC-type containing 16 1 1
MIRT057906 STXBP3 syntaxin binding protein 3 1 1
MIRT061005 C1ORF21 chromosome 1 open reading frame 21 1 3
MIRT061244 AMOTL1 angiomotin like 1 1 6
MIRT061529 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063394 ETNK1 ethanolamine kinase 1 1 1
MIRT065711 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 2
MIRT066291 MTFR1L mitochondrial fission regulator 1 like 1 1
MIRT066312 USP15 ubiquitin specific peptidase 15 1 1
MIRT068655 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071206 FCF1 FCF1, rRNA-processing protein 1 1
MIRT072822 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 1 3
MIRT074530 PAGR1 PAXIP1 associated glutamate rich protein 1 1 2
MIRT075249 SNTB2 syntrophin beta 2 1 2
MIRT075273 VPS4A vacuolar protein sorting 4 homolog A 1 4
MIRT075891 C16ORF72 chromosome 16 open reading frame 72 1 4
MIRT076791 GOSR1 golgi SNAP receptor complex member 1 1 1
MIRT077781 MINK1 misshapen like kinase 1 1 1
MIRT078282 RPS6KB1 ribosomal protein S6 kinase B1 1 1
MIRT079655 NAPG NSF attachment protein gamma 1 6
MIRT080011 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 2
MIRT082985 PNPLA6 patatin like phospholipase domain containing 6 1 1
MIRT083265 ZCCHC3 zinc finger CCHC-type containing 3 1 3
MIRT084462 SOWAHC sosondowah ankyrin repeat domain family member C 1 2
MIRT085215 CCNT2 cyclin T2 1 1
MIRT086005 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 1 1
MIRT087424 ZNRF3 zinc and ring finger 3 1 1
MIRT087554 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 1 1
MIRT088102 SEPT2 septin 2 1 1
MIRT089105 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 2
MIRT089206 ACTR2 ARP2 actin related protein 2 homolog 1 2
MIRT090446 CDV3 CDV3 homolog 1 1
MIRT090688 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091667 RARB retinoic acid receptor beta 1 3
MIRT092190 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092209 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093682 PI4K2B phosphatidylinositol 4-kinase type 2 beta 1 3
MIRT096234 CANX calnexin 1 1
MIRT098827 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT099631 E2F3 E2F transcription factor 3 1 1
MIRT100207 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 1 1
MIRT100364 HSPA1B heat shock protein family A (Hsp70) member 1B 2 5
MIRT100566 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 1 1
MIRT100896 CD2AP CD2 associated protein 1 1
MIRT102434 CALU calumenin 1 2
MIRT102632 UBN2 ubinuclein 2 1 6
MIRT102971 EN2 engrailed homeobox 2 1 3
MIRT103092 MAFK MAF bZIP transcription factor K 1 3
MIRT103856 FOXK1 forkhead box K1 1 2
MIRT104015 USP42 ubiquitin specific peptidase 42 1 3
MIRT106292 ZFHX4 zinc finger homeobox 4 1 3
MIRT106733 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 2
MIRT107218 ZBTB34 zinc finger and BTB domain containing 34 1 1
MIRT108983 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109240 ZNF275 zinc finger protein 275 1 1
MIRT110051 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 1 4
MIRT112969 LUZP1 leucine zipper protein 1 1 3
MIRT114923 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 1 1
MIRT117655 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT120680 PAK2 p21 (RAC1) activated kinase 2 1 1
MIRT127725 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 2
MIRT128798 UBE4A ubiquitination factor E4A 1 1
MIRT129055 ARCN1 archain 1 1 1
MIRT130380 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131097 TMEM138 transmembrane protein 138 1 1
MIRT132734 RASSF5 Ras association domain family member 5 1 1
MIRT132831 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133334 BCL7A BCL tumor suppressor 7A 1 1
MIRT133769 SKI SKI proto-oncogene 1 2
MIRT137517 RCOR1 REST corepressor 1 1 1
MIRT140146 SPRED1 sprouty related EVH1 domain containing 1 1 2
MIRT140820 SMAD3 SMAD family member 3 1 1
MIRT141243 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141279 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142237 DCTN5 dynactin subunit 5 1 5
MIRT144019 PSKH1 protein serine kinase H1 1 1
MIRT145377 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146014 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146351 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146496 SNX11 sorting nexin 11 1 1
MIRT148302 RNF138 ring finger protein 138 1 1
MIRT150354 IER2 immediate early response 2 1 1
MIRT152274 TNFSF9 TNF superfamily member 9 1 2
MIRT152503 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152736 KIF3B kinesin family member 3B 1 1
MIRT152922 NOL4L nucleolar protein 4 like 1 1
MIRT154043 RASSF2 Ras association domain family member 2 1 1
MIRT154392 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156452 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT158519 TNRC6B trinucleotide repeat containing 6B 1 3
MIRT158990 EPT1 selenoprotein I 1 1
MIRT159580 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160169 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163253 PRKCD protein kinase C delta 1 1
MIRT164260 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164952 TADA2B transcriptional adaptor 2B 1 1
MIRT165172 GRAMD3 GRAM domain containing 2B 1 2
MIRT165883 CREBRF CREB3 regulatory factor 1 2
MIRT168680 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169058 IRF4 interferon regulatory factor 4 1 1
MIRT170136 KLHDC10 kelch domain containing 10 1 1
MIRT170733 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171597 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172813 HMBOX1 homeobox containing 1 1 1
MIRT174781 RNF38 ring finger protein 38 1 1
MIRT175232 PSAT1 phosphoserine aminotransferase 1 1 4
MIRT175524 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179008 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 1 1
MIRT180909 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 4
MIRT186371 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT189760 CDADC1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT189961 AGO4 argonaute 4, RISC catalytic component 1 1
MIRT190184 GPR180 G protein-coupled receptor 180 1 3
MIRT191454 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT191625 SLC39A9 solute carrier family 39 member 9 1 3
MIRT194237 FAM103A1 family with sequence similarity 103 member A1 1 3
MIRT194903 RBBP6 RB binding protein 6, ubiquitin ligase 1 4
MIRT196275 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196450 TAOK1 TAO kinase 1 1 1
MIRT201456 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 1 4
MIRT204592 HSPE1-MOB4 HSPE1-MOB4 readthrough 1 4
MIRT204623 MOB4 MOB family member 4, phocein 1 4
MIRT204741 BZW1 basic leucine zipper and W2 domains 1 1 6
MIRT206020 NUP50 nucleoporin 50 1 4
MIRT211199 FGF2 fibroblast growth factor 2 1 2
MIRT211314 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 2
MIRT212604 RBPJ recombination signal binding protein for immunoglobulin kappa J region 1 4
MIRT217743 TBPL1 TATA-box binding protein like 1 1 2
MIRT223681 FZD6 frizzled class receptor 6 1 3
MIRT224965 BAG4 BCL2 associated athanogene 4 1 1
MIRT229343 ZNF449 zinc finger protein 449 1 1
MIRT229860 YIPF6 Yip1 domain family member 6 1 1
MIRT230120 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234342 MSL1 male specific lethal 1 homolog 1 4
MIRT245003 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246938 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247095 WEE1 WEE1 G2 checkpoint kinase 1 2
MIRT247236 ELK4 ELK4, ETS transcription factor 1 2
MIRT247368 GABARAPL1 GABA type A receptor associated protein like 1 1 3
MIRT248550 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248765 ATXN7L3B ataxin 7 like 3B 1 2
MIRT249449 ZNF691 zinc finger protein 691 1 2
MIRT251487 DYNLL2 dynein light chain LC8-type 2 1 2
MIRT255333 SRPRB SRP receptor beta subunit 1 3
MIRT256305 CDC42SE2 CDC42 small effector 2 1 1
MIRT258410 WIPI2 WD repeat domain, phosphoinositide interacting 2 1 2
MIRT265056 TBRG1 transforming growth factor beta regulator 1 1 1
MIRT265076 CHEK1 checkpoint kinase 1 1 2
MIRT267254 TMEM109 transmembrane protein 109 1 1
MIRT267527 C1ORF226 chromosome 1 open reading frame 226 1 1
MIRT270454 SIRT4 sirtuin 4 1 1
MIRT270552 SETD1B SET domain containing 1B 1 1
MIRT273665 HOXC8 homeobox C8 1 1
MIRT274741 RAB3IP RAB3A interacting protein 1 1
MIRT277504 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 1 2
MIRT282532 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT286968 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289625 CBX2 chromobox 2 1 1
MIRT294283 ZFP28 ZFP28 zinc finger protein 1 1
MIRT295810 CHMP4B charged multivesicular body protein 4B 1 1