miRTarBase - #MIRT662235 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PGBD4   
Synonyms -
Description piggyBac transposable element derived 4
Transcript NM_152595   
Expression
Putative miRNA Targets on PGBD4
3'UTR of PGBD4
(miRNA target sites are highlighted)
>PGBD4|NM_152595|3'UTR
   1 ATACCGATCATCATACACATCTGTTCCATTAGGATTAGAGACAAGTTCTGTTTAGAAATAACTCCAAGATTGGGAGGCCG
  81 ACCTGGGTGGATCACCTGAGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGG-UAACAG--UGUGAGGu 5'
             |:||| ||  ||  |||| :| 
Target 5' ---ATACCGATCATCATACACATCt 3'
1 - 22 109.00 -10.60
2
miRNA  3' guUUGUGGUAA--CAGUG-UGAGGu 5'
            |:: |::||  |  |: ||||| 
Target 5' caAGTTCTGTTTAGAAATAACTCCa 3'
42 - 66 102.00 -9.30
3
miRNA  3' guUUGUGGUAAC--AGUGUGAggu 5'
            :|| : : ||  |||| ||   
Target 5' ccGACCTGGGTGGATCAC-CTgag 3'
78 - 100 62.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30481435 13 COSMIC
COSN30459200 80 COSMIC
COSN28566334 105 COSMIC
COSN15625832 424 COSMIC
COSN21114782 445 COSMIC
COSN22332279 577 COSMIC
COSN29724281 776 COSMIC
COSN15625834 825 COSMIC
COSN15625835 1066 COSMIC
COSN26551205 1145 COSMIC
COSN26641663 1664 COSMIC
COSN26642695 1681 COSMIC
COSN32040198 2126 COSMIC
COSN24015108 2134 COSMIC
COSN23846590 2361 COSMIC
COSN28217482 2609 COSMIC
COSN19346276 2694 COSMIC
COSN26143992 2830 COSMIC
COSN29385613 3072 COSMIC
COSN8172724 3383 COSMIC
COSN23507748 3653 COSMIC
COSN29281373 4024 COSMIC
COSN15299763 4025 COSMIC
COSN16160867 4037 COSMIC
COSN29643765 4051 COSMIC
COSN6271168 4259 COSMIC
rs9972552 424 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs939045397 2 dbSNP
rs1359419705 4 dbSNP
rs759305834 6 dbSNP
rs772013199 7 dbSNP
rs1455503527 11 dbSNP
rs1396578140 15 dbSNP
rs775396137 17 dbSNP
rs774021041 23 dbSNP
rs1243178979 26 dbSNP
rs1365508696 27 dbSNP
rs760811326 31 dbSNP
rs746323883 34 dbSNP
rs1222736205 41 dbSNP
rs370727329 43 dbSNP
rs374109895 46 dbSNP
rs765463051 47 dbSNP
rs1248891107 51 dbSNP
rs919392475 56 dbSNP
rs545715424 59 dbSNP
rs1049761047 71 dbSNP
rs888063994 77 dbSNP
rs143215981 80 dbSNP
rs769515401 81 dbSNP
rs1354974122 82 dbSNP
rs911643983 84 dbSNP
rs944186139 85 dbSNP
rs1296487831 86 dbSNP
rs1432557546 94 dbSNP
rs1372915169 101 dbSNP
rs976934191 117 dbSNP
rs1388554072 120 dbSNP
rs918774828 130 dbSNP
rs1462623262 132 dbSNP
rs1372709600 135 dbSNP
rs1186929030 144 dbSNP
rs531220148 163 dbSNP
rs1254040391 165 dbSNP
rs1049157064 171 dbSNP
rs549791588 172 dbSNP
rs138143662 181 dbSNP
rs1197018815 185 dbSNP
rs1339493891 186 dbSNP
rs888415282 189 dbSNP
rs997521211 192 dbSNP
rs1225764169 199 dbSNP
rs1349725569 207 dbSNP
rs775071841 208 dbSNP
rs1303850025 212 dbSNP
rs948039574 219 dbSNP
rs1045152748 223 dbSNP
rs1391983120 227 dbSNP
rs906631279 227 dbSNP
rs1395874708 229 dbSNP
rs1166890249 230 dbSNP
rs1004062033 237 dbSNP
rs1395959510 239 dbSNP
rs547995886 244 dbSNP
rs62014728 247 dbSNP
rs1221820557 250 dbSNP
rs1365998221 251 dbSNP
rs892331605 261 dbSNP
rs540108112 264 dbSNP
rs956720492 269 dbSNP
rs1479270264 291 dbSNP
rs1198010467 298 dbSNP
rs1486431394 298 dbSNP
rs1412088430 301 dbSNP
rs1342633530 302 dbSNP
rs1022175305 307 dbSNP
rs1009425412 311 dbSNP
rs1022618547 314 dbSNP
rs953009016 314 dbSNP
rs1473821095 326 dbSNP
rs1007198470 348 dbSNP
rs1376275312 349 dbSNP
rs1018620934 350 dbSNP
rs536570432 350 dbSNP
rs972264481 350 dbSNP
rs568306409 352 dbSNP
rs918756313 352 dbSNP
rs78013925 354 dbSNP
rs1406355852 355 dbSNP
rs558492143 357 dbSNP
rs768354451 358 dbSNP
rs1179369497 359 dbSNP
rs1325975617 359 dbSNP
rs1257694820 362 dbSNP
rs370738215 379 dbSNP
rs375375080 380 dbSNP
rs1286055695 381 dbSNP
rs910156336 387 dbSNP
rs1328379367 395 dbSNP
rs569991998 400 dbSNP
rs1235143992 401 dbSNP
rs1352476219 402 dbSNP
rs1356192893 415 dbSNP
rs62014729 420 dbSNP
rs9972552 424 dbSNP
rs919037059 426 dbSNP
rs939447210 434 dbSNP
rs1319364093 439 dbSNP
rs1457097825 444 dbSNP
rs1349644862 447 dbSNP
rs1228634155 450 dbSNP
rs929452938 452 dbSNP
rs1293700925 453 dbSNP
rs1489688936 460 dbSNP
rs182491941 461 dbSNP
rs909453504 465 dbSNP
rs1221291493 467 dbSNP
rs865990665 468 dbSNP
rs1039269106 483 dbSNP
rs901822082 484 dbSNP
rs1251906818 496 dbSNP
rs1439109266 502 dbSNP
rs767253036 505 dbSNP
rs933340682 511 dbSNP
rs1464278494 512 dbSNP
rs541159348 516 dbSNP
rs1335506390 518 dbSNP
rs1289203413 524 dbSNP
rs1226729664 529 dbSNP
rs1271058171 530 dbSNP
rs1434738778 538 dbSNP
rs891906072 547 dbSNP
rs1043599280 552 dbSNP
rs1165794029 557 dbSNP
rs773166147 558 dbSNP
rs531780306 561 dbSNP
rs1009805036 566 dbSNP
rs1163449692 579 dbSNP
rs760541327 581 dbSNP
rs903698316 584 dbSNP
rs1168854634 585 dbSNP
rs765313304 586 dbSNP
rs1002095010 587 dbSNP
rs1007455252 592 dbSNP
rs1018563669 599 dbSNP
rs1246112747 600 dbSNP
rs1033616229 620 dbSNP
rs1309336802 626 dbSNP
rs553515501 627 dbSNP
rs993228970 632 dbSNP
rs141254131 648 dbSNP
rs1026475206 649 dbSNP
rs1316814196 650 dbSNP
rs984304258 653 dbSNP
rs1357099937 658 dbSNP
rs545654138 661 dbSNP
rs867038997 662 dbSNP
rs1274955048 666 dbSNP
rs969612403 667 dbSNP
rs981061533 671 dbSNP
rs1308219852 672 dbSNP
rs1428672567 672 dbSNP
rs909348238 679 dbSNP
rs758613511 683 dbSNP
rs927980686 697 dbSNP
rs1433625731 705 dbSNP
rs1424293323 709 dbSNP
rs943552383 719 dbSNP
rs564218094 723 dbSNP
rs1481628875 724 dbSNP
rs939358412 729 dbSNP
rs1249223322 731 dbSNP
rs974941790 732 dbSNP
rs113330715 733 dbSNP
rs933309267 740 dbSNP
rs1241669713 749 dbSNP
rs763549648 755 dbSNP
rs543029106 757 dbSNP
rs114357977 758 dbSNP
rs1043527680 766 dbSNP
rs888987471 766 dbSNP
rs1226010527 767 dbSNP
rs1374749430 777 dbSNP
rs1374963699 778 dbSNP
rs1288405819 790 dbSNP
rs528948049 792 dbSNP
rs1368311841 794 dbSNP
rs1040275150 806 dbSNP
rs947463084 811 dbSNP
rs1043549364 814 dbSNP
rs1403010866 826 dbSNP
rs1358383575 830 dbSNP
rs1173815356 834 dbSNP
rs903667038 835 dbSNP
rs1420770008 845 dbSNP
rs564986198 852 dbSNP
rs1002062519 858 dbSNP
rs1471656150 862 dbSNP
rs1033583661 863 dbSNP
rs901469555 869 dbSNP
rs896439271 874 dbSNP
rs1013667922 889 dbSNP
rs1483106585 890 dbSNP
rs1380282079 901 dbSNP
rs150757872 911 dbSNP
rs1298085227 912 dbSNP
rs1318035011 912 dbSNP
rs1288342455 914 dbSNP
rs950441668 920 dbSNP
rs1026032998 923 dbSNP
rs1250261832 941 dbSNP
rs1345181210 944 dbSNP
rs548409461 947 dbSNP
rs1396277886 969 dbSNP
rs764445075 974 dbSNP
rs566230231 979 dbSNP
rs1261858643 985 dbSNP
rs1300838560 986 dbSNP
rs964829499 991 dbSNP
rs1389207713 993 dbSNP
rs1158356342 1000 dbSNP
rs1455667994 1013 dbSNP
rs974909234 1015 dbSNP
rs1188384301 1017 dbSNP
rs923515910 1023 dbSNP
rs1005995430 1026 dbSNP
rs1189559542 1035 dbSNP
rs1017113984 1045 dbSNP
rs1264316749 1049 dbSNP
rs367740043 1067 dbSNP
rs1207413982 1071 dbSNP
rs1192832488 1075 dbSNP
rs1266662655 1079 dbSNP
rs186818346 1080 dbSNP
rs1481490369 1084 dbSNP
rs1174403812 1088 dbSNP
rs1403748607 1089 dbSNP
rs1383650543 1092 dbSNP
rs1035686052 1095 dbSNP
rs913205441 1096 dbSNP
rs947396443 1117 dbSNP
rs781653247 1118 dbSNP
rs55816157 1119 dbSNP
rs1163897076 1131 dbSNP
rs1457528986 1132 dbSNP
rs1043130223 1142 dbSNP
rs1366868584 1147 dbSNP
rs927392385 1147 dbSNP
rs937819791 1167 dbSNP
rs1450423547 1173 dbSNP
rs1247830562 1175 dbSNP
rs960718062 1179 dbSNP
rs552043939 1187 dbSNP
rs192395576 1188 dbSNP
rs946799574 1189 dbSNP
rs1224771816 1198 dbSNP
rs1355058301 1202 dbSNP
rs979520132 1203 dbSNP
rs1013469212 1205 dbSNP
rs1048119841 1219 dbSNP
rs1230203299 1225 dbSNP
rs1280838046 1225 dbSNP
rs1296571320 1229 dbSNP
rs1323381184 1232 dbSNP
rs1209913864 1235 dbSNP
rs943207344 1237 dbSNP
rs373658769 1239 dbSNP
rs537774277 1240 dbSNP
rs576982772 1253 dbSNP
rs1204754341 1258 dbSNP
rs371780346 1259 dbSNP
rs1389832628 1276 dbSNP
rs1015951965 1292 dbSNP
rs1167081725 1297 dbSNP
rs1455902194 1300 dbSNP
rs901769262 1303 dbSNP
rs1378664031 1306 dbSNP
rs1198810022 1307 dbSNP
rs1450500305 1308 dbSNP
rs1197287995 1315 dbSNP
rs746379071 1324 dbSNP
rs114785009 1325 dbSNP
rs1483172425 1327 dbSNP
rs996297363 1334 dbSNP
rs567665206 1348 dbSNP
rs1030415949 1349 dbSNP
rs779780005 1354 dbSNP
rs955060797 1355 dbSNP
rs887492567 1356 dbSNP
rs1365300682 1360 dbSNP
rs1290264245 1362 dbSNP
rs1005969117 1367 dbSNP
rs989055928 1370 dbSNP
rs913501048 1374 dbSNP
rs1183710318 1377 dbSNP
rs1306405381 1377 dbSNP
rs1371008326 1377 dbSNP
rs147210066 1377 dbSNP
rs398057585 1377 dbSNP
rs543545054 1377 dbSNP
rs559589772 1377 dbSNP
rs56874167 1377 dbSNP
rs572389275 1377 dbSNP
rs1365760782 1378 dbSNP
rs199660470 1379 dbSNP
rs867084651 1383 dbSNP
rs1472636105 1388 dbSNP
rs66517123 1393 dbSNP
rs968737112 1395 dbSNP
rs979205754 1397 dbSNP
rs1491180744 1398 dbSNP
rs927359642 1398 dbSNP
rs56834847 1399 dbSNP
rs905323341 1410 dbSNP
rs1443887415 1425 dbSNP
rs937371493 1426 dbSNP
rs748803722 1428 dbSNP
rs1406408434 1439 dbSNP
rs1279030321 1440 dbSNP
rs1199707392 1450 dbSNP
rs1342766750 1456 dbSNP
rs1270007585 1462 dbSNP
rs1002392818 1463 dbSNP
rs768246556 1464 dbSNP
rs547115024 1469 dbSNP
rs1286643158 1475 dbSNP
rs553061942 1479 dbSNP
rs988435097 1491 dbSNP
rs1344396310 1497 dbSNP
rs1333908566 1500 dbSNP
rs886382992 1511 dbSNP
rs115499630 1523 dbSNP
rs1037366066 1526 dbSNP
rs1391386555 1551 dbSNP
rs1160570600 1554 dbSNP
rs1309852636 1567 dbSNP
rs1315476702 1569 dbSNP
rs1238714550 1577 dbSNP
rs771859981 1579 dbSNP
rs1361773800 1586 dbSNP
rs968028839 1588 dbSNP
rs1473561984 1589 dbSNP
rs1268249097 1591 dbSNP
rs979445500 1593 dbSNP
rs1440485549 1601 dbSNP
rs1249746464 1604 dbSNP
rs910653321 1604 dbSNP
rs995846735 1605 dbSNP
rs1328445058 1617 dbSNP
rs1177682107 1623 dbSNP
rs1030057714 1626 dbSNP
rs890612301 1631 dbSNP
rs1266296295 1638 dbSNP
rs541028745 1640 dbSNP
rs923151362 1644 dbSNP
rs929209586 1648 dbSNP
rs1020528443 1653 dbSNP
rs1158030345 1665 dbSNP
rs1047676475 1671 dbSNP
rs1385640310 1672 dbSNP
rs760661787 1675 dbSNP
rs1321762173 1676 dbSNP
rs79257844 1680 dbSNP
rs576242368 1683 dbSNP
rs941680981 1686 dbSNP
rs1364386357 1698 dbSNP
rs1442357134 1699 dbSNP
rs1044146418 1706 dbSNP
rs905625784 1713 dbSNP
rs1442507068 1715 dbSNP
rs753533527 1725 dbSNP
rs1299418745 1729 dbSNP
rs1321918610 1731 dbSNP
rs1371734207 1734 dbSNP
rs1002653094 1741 dbSNP
rs867144033 1742 dbSNP
rs1316162224 1747 dbSNP
rs1452271175 1750 dbSNP
rs139068414 1753 dbSNP
rs1344627960 1754 dbSNP
rs958707107 1757 dbSNP
rs561499525 1766 dbSNP
rs1363632027 1772 dbSNP
rs1295802229 1785 dbSNP
rs917345541 1786 dbSNP
rs1349981383 1794 dbSNP
rs149881179 1797 dbSNP
rs1391699800 1798 dbSNP
rs1168989059 1802 dbSNP
rs1448649667 1803 dbSNP
rs754572996 1806 dbSNP
rs541086101 1821 dbSNP
rs1206655210 1825 dbSNP
rs983722603 1835 dbSNP
rs967996727 1846 dbSNP
rs1246168372 1849 dbSNP
rs1000833630 1863 dbSNP
rs559480986 1866 dbSNP
rs147554542 1867 dbSNP
rs976229229 1870 dbSNP
rs1204797533 1872 dbSNP
rs1340493898 1873 dbSNP
rs551658196 1877 dbSNP
rs563938962 1882 dbSNP
rs1446277017 1883 dbSNP
rs1181341472 1886 dbSNP
rs1402636733 1903 dbSNP
rs1371953263 1905 dbSNP
rs140272932 1908 dbSNP
rs931674621 1910 dbSNP
rs763066087 1911 dbSNP
rs7182085 1919 dbSNP
rs909149001 1926 dbSNP
rs1197356258 1941 dbSNP
rs941649607 1954 dbSNP
rs548445127 1955 dbSNP
rs147954291 1956 dbSNP
rs1181754627 1958 dbSNP
rs1479837891 1969 dbSNP
rs1258116883 1973 dbSNP
rs1211340436 1974 dbSNP
rs530635991 1988 dbSNP
rs551926816 1989 dbSNP
rs1020832281 1996 dbSNP
rs904698922 1997 dbSNP
rs1351823550 2002 dbSNP
rs1450859328 2003 dbSNP
rs1408803802 2004 dbSNP
rs926969678 2010 dbSNP
rs1000421144 2013 dbSNP
rs534691210 2014 dbSNP
rs1358435092 2018 dbSNP
rs1056890051 2023 dbSNP
rs958676309 2030 dbSNP
rs1458841670 2035 dbSNP
rs1412830247 2036 dbSNP
rs570615423 2037 dbSNP
rs1258616963 2039 dbSNP
rs992857054 2044 dbSNP
rs1024384914 2045 dbSNP
rs1197913822 2046 dbSNP
rs1182741920 2050 dbSNP
rs896607411 2052 dbSNP
rs1009754918 2067 dbSNP
rs546639489 2071 dbSNP
rs1330476957 2072 dbSNP
rs1268180826 2077 dbSNP
rs951584208 2078 dbSNP
rs1199196170 2082 dbSNP
rs757484158 2096 dbSNP
rs183460810 2101 dbSNP
rs1378196500 2102 dbSNP
rs904099055 2104 dbSNP
rs1201492135 2120 dbSNP
rs1001094936 2121 dbSNP
rs907665260 2125 dbSNP
rs1187954882 2126 dbSNP
rs1416741728 2130 dbSNP
rs1427447750 2133 dbSNP
rs1176560502 2142 dbSNP
rs1408876099 2153 dbSNP
rs1468426593 2154 dbSNP
rs1165778618 2170 dbSNP
rs1423560494 2182 dbSNP
rs1176372093 2189 dbSNP
rs1017554708 2201 dbSNP
rs1468712700 2207 dbSNP
rs1336409868 2225 dbSNP
rs941880241 2228 dbSNP
rs964712604 2231 dbSNP
rs1203969147 2234 dbSNP
rs1484612450 2236 dbSNP
rs997977690 2249 dbSNP
rs187435996 2250 dbSNP
rs921883599 2251 dbSNP
rs931643709 2262 dbSNP
rs1312631127 2263 dbSNP
rs1230427002 2270 dbSNP
rs1319828969 2275 dbSNP
rs983319089 2282 dbSNP
rs530903093 2291 dbSNP
rs879699356 2291 dbSNP
rs140586174 2292 dbSNP
rs1433138900 2292 dbSNP
rs1457576926 2298 dbSNP
rs1268691033 2301 dbSNP
rs1051908604 2310 dbSNP
rs1361325028 2313 dbSNP
rs909075820 2313 dbSNP
rs1450484492 2320 dbSNP
rs1390036937 2321 dbSNP
rs890131329 2324 dbSNP
rs1268798314 2336 dbSNP
rs762243698 2338 dbSNP
rs1209962611 2339 dbSNP
rs945752592 2341 dbSNP
rs534754631 2360 dbSNP
rs71119932 2360 dbSNP
rs796797907 2362 dbSNP
rs557635141 2366 dbSNP
rs1225116477 2371 dbSNP
rs547309079 2371 dbSNP
rs904666755 2374 dbSNP
rs1000388264 2377 dbSNP
rs376919668 2379 dbSNP
rs576208698 2379 dbSNP
rs113896496 2389 dbSNP
rs1239963293 2396 dbSNP
rs1430743466 2398 dbSNP
rs894762848 2399 dbSNP
rs74956322 2403 dbSNP
rs1468006773 2410 dbSNP
rs1378789056 2416 dbSNP
rs1198874515 2423 dbSNP
rs28376576 2429 dbSNP
rs1183938604 2434 dbSNP
rs1479740905 2435 dbSNP
rs951420183 2444 dbSNP
rs1483202468 2445 dbSNP
rs1004674848 2452 dbSNP
rs1193920585 2461 dbSNP
rs936914800 2462 dbSNP
rs1017044176 2464 dbSNP
rs78841228 2468 dbSNP
rs1256520398 2471 dbSNP
rs750816209 2472 dbSNP
rs963170400 2479 dbSNP
rs1343745923 2483 dbSNP
rs1176410728 2486 dbSNP
rs756728781 2503 dbSNP
rs1410629216 2511 dbSNP
rs1335445184 2517 dbSNP
rs1402850440 2524 dbSNP
rs900464833 2531 dbSNP
rs1403466425 2536 dbSNP
rs997546866 2537 dbSNP
rs1030805847 2543 dbSNP
rs1426551346 2544 dbSNP
rs541022549 2545 dbSNP
rs777628307 2546 dbSNP
rs1405801077 2551 dbSNP
rs921851667 2555 dbSNP
rs754250414 2560 dbSNP
rs559415772 2568 dbSNP
rs963241706 2570 dbSNP
rs577796470 2579 dbSNP
rs754547986 2582 dbSNP
rs1270067323 2583 dbSNP
rs911520239 2587 dbSNP
rs1274222797 2601 dbSNP
rs1278019396 2605 dbSNP
rs1351349266 2626 dbSNP
rs1225210307 2627 dbSNP
rs1341477820 2634 dbSNP
rs1281901371 2635 dbSNP
rs1451073386 2640 dbSNP
rs1391547985 2643 dbSNP
rs550001506 2646 dbSNP
rs1400785150 2647 dbSNP
rs1406711572 2652 dbSNP
rs1352440213 2660 dbSNP
rs1156464537 2661 dbSNP
rs545103120 2662 dbSNP
rs1222856613 2664 dbSNP
rs1270397810 2668 dbSNP
rs1473630881 2668 dbSNP
rs1182808966 2669 dbSNP
rs1209376204 2669 dbSNP
rs1230210336 2669 dbSNP
rs1314783951 2669 dbSNP
rs1357389330 2669 dbSNP
rs1368796537 2669 dbSNP
rs1446524774 2669 dbSNP
rs60502890 2669 dbSNP
rs68176283 2669 dbSNP
rs1489667026 2671 dbSNP
rs1244324692 2678 dbSNP
rs945751853 2687 dbSNP
rs1367890317 2688 dbSNP
rs1299007859 2689 dbSNP
rs1430755974 2690 dbSNP
rs1198741442 2691 dbSNP
rs1344118703 2691 dbSNP
rs148155436 2693 dbSNP
rs925802373 2694 dbSNP
rs1471456283 2695 dbSNP
rs35445881 2695 dbSNP
rs202073733 2696 dbSNP
rs1407793776 2700 dbSNP
rs1365871695 2702 dbSNP
rs1425517353 2703 dbSNP
rs868627256 2703 dbSNP
rs866110312 2704 dbSNP
rs925720409 2709 dbSNP
rs936145934 2712 dbSNP
rs1189178141 2714 dbSNP
rs568439215 2715 dbSNP
rs1475066680 2716 dbSNP
rs1056013339 2719 dbSNP
rs1223947871 2721 dbSNP
rs116316084 2724 dbSNP
rs1291326997 2725 dbSNP
rs959944014 2727 dbSNP
rs1336216158 2729 dbSNP
rs1014478336 2735 dbSNP
rs1444298040 2737 dbSNP
rs34044919 2756 dbSNP
rs531146213 2756 dbSNP
rs992492893 2757 dbSNP
rs1360549353 2760 dbSNP
rs549353559 2767 dbSNP
rs1375952843 2775 dbSNP
rs887081926 2781 dbSNP
rs1422473990 2787 dbSNP
rs184844431 2787 dbSNP
rs1372145140 2797 dbSNP
rs538189263 2799 dbSNP
rs1170946165 2809 dbSNP
rs1356868176 2812 dbSNP
rs1330174880 2814 dbSNP
rs528788700 2819 dbSNP
rs1268384702 2821 dbSNP
rs1197572140 2826 dbSNP
rs371960458 2836 dbSNP
rs1484179881 2837 dbSNP
rs1275770089 2840 dbSNP
rs1204336328 2842 dbSNP
rs1306263684 2843 dbSNP
rs1281351847 2862 dbSNP
rs1220407985 2865 dbSNP
rs778221693 2866 dbSNP
rs1282135439 2873 dbSNP
rs747852590 2875 dbSNP
rs1298532743 2880 dbSNP
rs962808716 2881 dbSNP
rs1352635058 2884 dbSNP
rs1178165969 2885 dbSNP
rs1273117242 2888 dbSNP
rs1428642334 2890 dbSNP
rs1439999183 2893 dbSNP
rs936846428 2899 dbSNP
rs11072947 2903 dbSNP
rs1028750180 2905 dbSNP
rs900768103 2911 dbSNP
rs1479869609 2914 dbSNP
rs953227242 2936 dbSNP
rs987771729 2938 dbSNP
rs911838019 2945 dbSNP
rs571325228 2959 dbSNP
rs886479396 2966 dbSNP
rs1004963392 2972 dbSNP
rs1330697157 2973 dbSNP
rs1307283551 2976 dbSNP
rs535799782 2983 dbSNP
rs977148703 2984 dbSNP
rs1304411264 2985 dbSNP
rs1453253790 2994 dbSNP
rs925689531 3000 dbSNP
rs935694474 3003 dbSNP
rs898975078 3008 dbSNP
rs1055559337 3012 dbSNP
rs1364540557 3017 dbSNP
rs201033050 3020 dbSNP
rs1158694547 3023 dbSNP
rs538721243 3025 dbSNP
rs1416382156 3029 dbSNP
rs1411578501 3032 dbSNP
rs1034624607 3037 dbSNP
rs959964571 3041 dbSNP
rs950263518 3044 dbSNP
rs1046393724 3047 dbSNP
rs1486576480 3049 dbSNP
rs1260903797 3055 dbSNP
rs148992518 3057 dbSNP
rs940015108 3058 dbSNP
rs1314589406 3060 dbSNP
rs1246525938 3076 dbSNP
rs978444528 3082 dbSNP
rs1312847631 3084 dbSNP
rs1038296900 3085 dbSNP
rs1385723659 3093 dbSNP
rs898509430 3096 dbSNP
rs1316932149 3097 dbSNP
rs996858644 3098 dbSNP
rs146555053 3112 dbSNP
rs368948481 3112 dbSNP
rs1028383847 3115 dbSNP
rs569709285 3128 dbSNP
rs1243624170 3136 dbSNP
rs569536410 3143 dbSNP
rs1383878869 3144 dbSNP
rs1008758939 3153 dbSNP
rs1429667150 3153 dbSNP
rs1261784658 3159 dbSNP
rs907837109 3170 dbSNP
rs1019270297 3176 dbSNP
rs540058832 3185 dbSNP
rs1222875484 3187 dbSNP
rs756524368 3188 dbSNP
rs1257926140 3191 dbSNP
rs1462181165 3197 dbSNP
rs977744104 3200 dbSNP
rs1205899587 3201 dbSNP
rs746774387 3206 dbSNP
rs1229493775 3212 dbSNP
rs1423450307 3215 dbSNP
rs1001641932 3228 dbSNP
rs537239301 3231 dbSNP
rs957037419 3236 dbSNP
rs1369933970 3239 dbSNP
rs1304006588 3243 dbSNP
rs1474495320 3246 dbSNP
rs1424382584 3247 dbSNP
rs143737363 3248 dbSNP
rs1364068046 3250 dbSNP
rs558333598 3256 dbSNP
rs577019570 3259 dbSNP
rs915686254 3259 dbSNP
rs1169051235 3262 dbSNP
rs1399403084 3267 dbSNP
rs770903487 3273 dbSNP
rs1490098951 3280 dbSNP
rs1266494694 3296 dbSNP
rs1020621249 3300 dbSNP
rs12440908 3308 dbSNP
rs1250708103 3323 dbSNP
rs776649292 3325 dbSNP
rs966996951 3329 dbSNP
rs981674497 3334 dbSNP
rs573958202 3349 dbSNP
rs908708253 3350 dbSNP
rs1343931514 3353 dbSNP
rs541127054 3354 dbSNP
rs559282907 3357 dbSNP
rs1331280662 3365 dbSNP
rs1392334479 3367 dbSNP
rs1396332248 3367 dbSNP
rs963748052 3367 dbSNP
rs1459989022 3370 dbSNP
rs1224565089 3373 dbSNP
rs759348888 3382 dbSNP
rs1479903706 3384 dbSNP
rs1218656449 3397 dbSNP
rs975608271 3411 dbSNP
rs1183650159 3427 dbSNP
rs189780765 3429 dbSNP
rs552969117 3432 dbSNP
rs1324828015 3434 dbSNP
rs577735288 3435 dbSNP
rs1261655340 3436 dbSNP
rs1483151290 3440 dbSNP
rs898478352 3442 dbSNP
rs1223048974 3448 dbSNP
rs1264062745 3452 dbSNP
rs932678510 3455 dbSNP
rs1445525062 3459 dbSNP
rs1049788258 3460 dbSNP
rs1430084996 3461 dbSNP
rs1327314377 3467 dbSNP
rs1480712783 3470 dbSNP
rs1178577280 3471 dbSNP
rs1375703950 3475 dbSNP
rs544729727 3476 dbSNP
rs1009143970 3477 dbSNP
rs1159974746 3482 dbSNP
rs1018741668 3488 dbSNP
rs1470333031 3490 dbSNP
rs1386598440 3492 dbSNP
rs151065163 3493 dbSNP
rs903021957 3494 dbSNP
rs575293909 3496 dbSNP
rs376067034 3498 dbSNP
rs1345668454 3499 dbSNP
rs908133319 3502 dbSNP
rs1032945245 3511 dbSNP
rs1436497130 3514 dbSNP
rs940949557 3523 dbSNP
rs1350307092 3526 dbSNP
rs1278144013 3532 dbSNP
rs1248633481 3537 dbSNP
rs1384107940 3542 dbSNP
rs1314998008 3560 dbSNP
rs957006917 3575 dbSNP
rs920632318 3576 dbSNP
rs1281984655 3577 dbSNP
rs1319778784 3583 dbSNP
rs991189031 3589 dbSNP
rs7167335 3590 dbSNP
rs561180275 3593 dbSNP
rs971133772 3594 dbSNP
rs981608405 3604 dbSNP
rs528729404 3617 dbSNP
rs1182943307 3619 dbSNP
rs1269685086 3625 dbSNP
rs1014524516 3626 dbSNP
rs940201973 3627 dbSNP
rs554831299 3629 dbSNP
rs1041608709 3642 dbSNP
rs1490876228 3644 dbSNP
rs1197394145 3647 dbSNP
rs1282441018 3649 dbSNP
rs192918138 3653 dbSNP
rs564890704 3654 dbSNP
rs1000094876 3656 dbSNP
rs1432530763 3665 dbSNP
rs1364776130 3669 dbSNP
rs920207596 3671 dbSNP
rs1271423176 3681 dbSNP
rs1430823956 3684 dbSNP
rs1325427694 3688 dbSNP
rs574360847 3693 dbSNP
rs762194573 3694 dbSNP
rs1406499265 3697 dbSNP
rs1365928049 3698 dbSNP
rs1365381758 3702 dbSNP
rs1417479545 3704 dbSNP
rs1049755001 3706 dbSNP
rs1162747796 3706 dbSNP
rs1157719755 3709 dbSNP
rs1365636037 3712 dbSNP
rs1425952872 3713 dbSNP
rs912555657 3716 dbSNP
rs574706300 3719 dbSNP
rs767819934 3720 dbSNP
rs996575260 3724 dbSNP
rs1168512766 3737 dbSNP
rs944102823 3738 dbSNP
rs1240537163 3748 dbSNP
rs1042877107 3764 dbSNP
rs1029829050 3781 dbSNP
rs750871369 3817 dbSNP
rs761147823 3819 dbSNP
rs1268615428 3823 dbSNP
rs532548960 3829 dbSNP
rs183489272 3831 dbSNP
rs893099778 3834 dbSNP
rs1292719215 3835 dbSNP
rs1361908753 3843 dbSNP
rs1220267181 3850 dbSNP
rs1264953835 3855 dbSNP
rs569329137 3859 dbSNP
rs1177778611 3862 dbSNP
rs1252367285 3863 dbSNP
rs150199302 3864 dbSNP
rs1015123412 3865 dbSNP
rs1177796653 3866 dbSNP
rs962285462 3867 dbSNP
rs1446084442 3871 dbSNP
rs1162017617 3872 dbSNP
rs1329497558 3883 dbSNP
rs199856169 3887 dbSNP
rs1421549808 3890 dbSNP
rs766613821 3895 dbSNP
rs973682762 3897 dbSNP
rs188218114 3902 dbSNP
rs1189779146 3903 dbSNP
rs937325628 3909 dbSNP
rs1462938214 3911 dbSNP
rs1233922979 3913 dbSNP
rs181796595 3916 dbSNP
rs112535526 3917 dbSNP
rs534887537 3918 dbSNP
rs961556005 3920 dbSNP
rs1224889078 3926 dbSNP
rs1323727345 3930 dbSNP
rs778545414 3954 dbSNP
rs553306163 3955 dbSNP
rs533810691 3957 dbSNP
rs1217224340 3959 dbSNP
rs1375219584 3960 dbSNP
rs1279975580 3961 dbSNP
rs920174721 3966 dbSNP
rs1316179811 3970 dbSNP
rs1041924823 3972 dbSNP
rs571221231 3977 dbSNP
rs1398113886 3979 dbSNP
rs1338700016 3982 dbSNP
rs1470349740 3983 dbSNP
rs1405557765 4000 dbSNP
rs903066525 4001 dbSNP
rs1421148470 4004 dbSNP
rs538626968 4005 dbSNP
rs1177048030 4008 dbSNP
rs752142121 4015 dbSNP
rs935913268 4033 dbSNP
rs554043679 4037 dbSNP
rs556710694 4038 dbSNP
rs954255818 4043 dbSNP
rs1054309920 4052 dbSNP
rs770103764 4054 dbSNP
rs1254946669 4070 dbSNP
rs775930129 4075 dbSNP
rs1207562328 4083 dbSNP
rs985684278 4087 dbSNP
rs1226879736 4090 dbSNP
rs1307440791 4094 dbSNP
rs575282845 4114 dbSNP
rs1374492194 4124 dbSNP
rs758085124 4134 dbSNP
rs1453412938 4139 dbSNP
rs1308196875 4140 dbSNP
rs1301217099 4142 dbSNP
rs1205110045 4144 dbSNP
rs1455527745 4154 dbSNP
rs1252950676 4156 dbSNP
rs1158749233 4157 dbSNP
rs542376369 4160 dbSNP
rs944053030 4165 dbSNP
rs763173602 4167 dbSNP
rs1444617346 4172 dbSNP
rs924048110 4173 dbSNP
rs563623395 4181 dbSNP
rs1486608182 4185 dbSNP
rs1054252411 4188 dbSNP
rs115398043 4195 dbSNP
rs4780214 4196 dbSNP
rs962209866 4200 dbSNP
rs555825939 4202 dbSNP
rs1358712568 4203 dbSNP
rs1310655718 4210 dbSNP
rs1422030923 4211 dbSNP
rs1465576481 4226 dbSNP
rs141942299 4227 dbSNP
rs1288543688 4230 dbSNP
rs1398430337 4234 dbSNP
rs1027925398 4235 dbSNP
rs565227610 4259 dbSNP
rs780780381 4288 dbSNP
rs1446051660 4289 dbSNP
rs958707314 4290 dbSNP
rs1429793660 4291 dbSNP
rs1261943984 4292 dbSNP
rs1192438187 4304 dbSNP
rs1362945932 4305 dbSNP
rs1487131072 4320 dbSNP
rs991887317 4322 dbSNP
rs116558118 4330 dbSNP
rs1488078372 4331 dbSNP
rs1263625893 4333 dbSNP
rs1229652013 4342 dbSNP
rs1308121529 4362 dbSNP
rs1276388016 4366 dbSNP
rs950177596 4370 dbSNP
rs762281351 4371 dbSNP
rs1347696443 4375 dbSNP
rs1304065600 4379 dbSNP
rs1404738889 4386 dbSNP
rs1015336792 4387 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000397766.2 | 3UTR | AUGAGGCGGAGGUUGCAGUGAGCUGAGAUCACACCACUGCACUCCAGCCUGGGUGACAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.688 1.0e-4 -0.682 1.2e-4 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.463 9.9e-3 -0.445 1.3e-2 25 Click to see details
GSE17306 Multiple myeloma -0.259 3.6e-2 -0.099 2.5e-1 49 Click to see details
GSE21687 Ependynoma primary tumors 0.179 7.8e-2 0.176 8.2e-2 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.275 9.2e-2 -0.223 1.4e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.133 1.1e-1 0.179 4.6e-2 90 Click to see details
GSE27834 Pluripotent stem cells 0.326 1.1e-1 0.221 2.1e-1 16 Click to see details
GSE38226 Liver fibrosis 0.269 1.2e-1 0.043 4.3e-1 21 Click to see details
GSE19350 CNS germ cell tumors -0.312 1.6e-1 -0.150 3.2e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.265 1.9e-1 0.170 2.9e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.136 2.7e-1 -0.296 8.5e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.143 2.7e-1 -0.101 3.4e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.268 3.0e-1 0.314 2.7e-1 6 Click to see details
GSE32688 Pancreatic cancer -0.076 3.4e-1 0.068 3.6e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.074 3.7e-1 -0.067 3.8e-1 24 Click to see details
GSE21849 B cell lymphoma 0.044 4.1e-1 -0.024 4.5e-1 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.656 0.04 -0.643 0.04 8 Click to see details
KICH -0.595 0.06 -0.571 0.07 8 Click to see details
KIRP 0.428 0.13 0.617 0.04 9 Click to see details
CHOL 0.418 0.13 0.550 0.06 9 Click to see details
HNSC -0.747 0.23 -1.000 0.5 3 Click to see details
KIRC -0.139 0.24 -0.040 0.42 29 Click to see details
THCA -0.209 0.37 -0.200 0.37 5 Click to see details
LIHC -0.047 0.37 0.034 0.41 49 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
ESCA -0.021 0.49 -0.100 0.44 5 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*