miRTarBase - #MIRT662544 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MTAP   
Synonyms BDMF, DMSFH, DMSMFH, HEL-249, LGMBF, MSAP, c86fus
Description methylthioadenosine phosphorylase
Transcript NM_002451   
Putative miRNA Targets on MTAP
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ||:  ||:| |   ||||||| 
3413 - 3433 147.00 -11.70
            |||||: |  ||  |||||:| 
2294 - 2316 141.00 -15.90
              | |: ||| || |||||:| 
3236 - 3259 138.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
915053 16 ClinVar
366252 18 ClinVar
366253 103 ClinVar
366255 250 ClinVar
915054 255 ClinVar
366256 259 ClinVar
366257 260 ClinVar
912323 304 ClinVar
366258 329 ClinVar
366259 379 ClinVar
366260 394 ClinVar
912324 396 ClinVar
366261 537 ClinVar
366262 607 ClinVar
366263 658 ClinVar
366264 708 ClinVar
913449 731 ClinVar
366265 769 ClinVar
913450 796 ClinVar
366266 798 ClinVar
366267 805 ClinVar
366268 885 ClinVar
366269 896 ClinVar
913831 913 ClinVar
366270 1039 ClinVar
366271 1066 ClinVar
913832 1094 ClinVar
366272 1104 ClinVar
366273 1141 ClinVar
366274 1182 ClinVar
366275 1198 ClinVar
366276 1226 ClinVar
366277 1342 ClinVar
366278 1385 ClinVar
915080 1400 ClinVar
915081 1454 ClinVar
366279 1483 ClinVar
915082 1559 ClinVar
366280 1608 ClinVar
366281 1609 ClinVar
366282 1609 ClinVar
366283 1644 ClinVar
915083 1669 ClinVar
366284 1730 ClinVar
366285 1761 ClinVar
366286 1832 ClinVar
912372 1837 ClinVar
366287 1937 ClinVar
912373 2034 ClinVar
366288 2086 ClinVar
912374 2112 ClinVar
366289 2172 ClinVar
913498 2184 ClinVar
913499 2189 ClinVar
366290 2239 ClinVar
366291 2256 ClinVar
913500 2270 ClinVar
366292 2280 ClinVar
913501 2287 ClinVar
913879 2334 ClinVar
366293 2337 ClinVar
366294 2366 ClinVar
366295 2384 ClinVar
913880 2482 ClinVar
366296 2523 ClinVar
366297 2540 ClinVar
366298 2607 ClinVar
366299 2639 ClinVar
366300 2652 ClinVar
915128 2661 ClinVar
915129 2694 ClinVar
915130 2741 ClinVar
366301 2838 ClinVar
366302 2874 ClinVar
366303 2913 ClinVar
912430 2938 ClinVar
366304 2969 ClinVar
366305 3053 ClinVar
912431 3058 ClinVar
912432 3061 ClinVar
366306 3073 ClinVar
366307 3094 ClinVar
366308 3145 ClinVar
913542 3161 ClinVar
366309 3207 ClinVar
913543 3277 ClinVar
366310 3308 ClinVar
366311 3362 ClinVar
366312 3390 ClinVar
913544 3502 ClinVar
913545 3657 ClinVar
913925 3693 ClinVar
366313 3767 ClinVar
913926 3775 ClinVar
366314 3830 ClinVar
366315 3852 ClinVar
366316 3863 ClinVar
366317 3917 ClinVar
366318 3944 ClinVar
366319 3947 ClinVar
COSN30192563 60 COSMIC
COSN31960149 117 COSMIC
COSN30518165 154 COSMIC
COSN31594392 217 COSMIC
COSN28870388 258 COSMIC
COSN14695181 259 COSMIC
COSN28842727 259 COSMIC
COSN24692886 478 COSMIC
COSN27836157 628 COSMIC
COSN14697974 885 COSMIC
COSN21089358 1094 COSMIC
COSN27944319 1626 COSMIC
COSN32065727 1627 COSMIC
COSN31483898 1648 COSMIC
COSN31590031 1724 COSMIC
COSN26566144 1775 COSMIC
COSN21697786 1935 COSMIC
COSN5700063 1977 COSMIC
COSN14698461 2086 COSMIC
COSN14683291 2366 COSMIC
COSN14694352 2523 COSMIC
COSN20091902 2550 COSMIC
COSN9705609 2587 COSMIC
COSN19124017 2603 COSMIC
COSN14935705 3094 COSMIC
COSN22446967 3194 COSMIC
COSN23824882 3262 COSMIC
COSN31591796 3510 COSMIC
COSN31535342 3582 COSMIC
COSN31495943 3633 COSMIC
COSN30159201 3669 COSMIC
COSN31515411 3677 COSMIC
COSN31546699 3717 COSMIC
COSN30159389 3735 COSMIC
COSN31552708 3750 COSMIC
COSN24302806 3768 COSMIC
COSN30115138 3782 COSMIC
COSN14993495 3830 COSMIC
COSN8520413 3916 COSMIC
COSN31591351 3941 COSMIC
COSN14704071 3947 COSMIC
COSN4887861 4075 COSMIC
COSN14993324 4301 COSMIC
COSN14684395 4488 COSMIC
COSN32063693 4727 COSMIC
COSN5700064 4874 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1243657195 2 dbSNP
rs1262467541 5 dbSNP
rs367743939 6 dbSNP
rs1204390852 7 dbSNP
rs766558829 8 dbSNP
rs754086497 16 dbSNP
rs553057304 18 dbSNP
rs750844480 18 dbSNP
rs929426361 23 dbSNP
rs747905013 27 dbSNP
rs983997486 28 dbSNP
rs370980390 31 dbSNP
rs375541397 38 dbSNP
rs746554053 45 dbSNP
rs770464905 46 dbSNP
rs1470807025 47 dbSNP
rs368840669 49 dbSNP
rs752127232 57 dbSNP
rs971166805 59 dbSNP
rs375813031 80 dbSNP
rs369244310 82 dbSNP
rs1428764733 83 dbSNP
rs1260529248 91 dbSNP
rs1184598054 92 dbSNP
rs755040797 103 dbSNP
rs572882647 106 dbSNP
rs541896368 115 dbSNP
rs1221704265 118 dbSNP
rs555725472 119 dbSNP
rs1039301225 120 dbSNP
rs538983344 143 dbSNP
rs1228170444 144 dbSNP
rs1307138688 151 dbSNP
rs924313816 153 dbSNP
rs767735914 155 dbSNP
rs1221315321 171 dbSNP
rs1346584916 178 dbSNP
rs1302919888 179 dbSNP
rs111350457 182 dbSNP
rs1403702900 186 dbSNP
rs575907260 193 dbSNP
rs1299392254 197 dbSNP
rs1462019483 208 dbSNP
rs915374568 211 dbSNP
rs544925331 213 dbSNP
rs999293435 219 dbSNP
rs1429817767 220 dbSNP
rs946887125 221 dbSNP
rs1050644886 222 dbSNP
rs1479422662 224 dbSNP
rs1252496460 226 dbSNP
rs1196487963 233 dbSNP
rs564730053 235 dbSNP
rs1480320915 237 dbSNP
rs1256192190 245 dbSNP
rs752812608 246 dbSNP
rs1034758965 250 dbSNP
rs1205888049 250 dbSNP
rs886063782 250 dbSNP
rs1040343065 251 dbSNP
rs896322861 252 dbSNP
rs897835622 255 dbSNP
rs3208969 258 dbSNP
rs1012071118 259 dbSNP
rs1308283928 259 dbSNP
rs15735 259 dbSNP
rs78195856 260 dbSNP
rs1465879770 261 dbSNP
rs1171818603 265 dbSNP
rs1175447105 265 dbSNP
rs1402928682 268 dbSNP
rs749100975 270 dbSNP
rs1182496356 276 dbSNP
rs951886861 280 dbSNP
rs113189258 282 dbSNP
rs1022830835 294 dbSNP
rs971134192 303 dbSNP
rs140440868 304 dbSNP
rs1202200418 306 dbSNP
rs561546447 309 dbSNP
rs1397824981 321 dbSNP
rs924241686 328 dbSNP
rs150414950 329 dbSNP
rs988381158 330 dbSNP
rs974915284 332 dbSNP
rs1383110217 337 dbSNP
rs1335613952 347 dbSNP
rs1467881220 354 dbSNP
rs550473354 357 dbSNP
rs922138897 358 dbSNP
rs947005919 365 dbSNP
rs915465043 367 dbSNP
rs1361927240 372 dbSNP
rs1165587648 376 dbSNP
rs886063783 379 dbSNP
rs1445264114 380 dbSNP
rs111943869 381 dbSNP
rs902163066 382 dbSNP
rs78389853 394 dbSNP
rs1050551130 396 dbSNP
rs1294534222 397 dbSNP
rs1247560897 405 dbSNP
rs910752890 408 dbSNP
rs944755876 411 dbSNP
rs896251056 412 dbSNP
rs1381404567 415 dbSNP
rs1358576297 419 dbSNP
rs1040437218 420 dbSNP
rs897805972 421 dbSNP
rs993920136 428 dbSNP
rs1049090787 433 dbSNP
rs1256494532 447 dbSNP
rs887674987 448 dbSNP
rs539329583 449 dbSNP
rs1012876864 452 dbSNP
rs1373791797 453 dbSNP
rs1134869 455 dbSNP
rs1192957024 462 dbSNP
rs1022796723 465 dbSNP
rs546315547 467 dbSNP
rs1445590286 476 dbSNP
rs1271468192 484 dbSNP
rs1254946214 486 dbSNP
rs745840665 488 dbSNP
rs898377741 491 dbSNP
rs1195407363 500 dbSNP
rs1426183487 501 dbSNP
rs995424960 521 dbSNP
rs971227374 525 dbSNP
rs1170233322 526 dbSNP
rs184317031 527 dbSNP
rs1005325374 529 dbSNP
rs950743636 529 dbSNP
rs1405540310 530 dbSNP
rs1002585858 533 dbSNP
rs552592697 536 dbSNP
rs1134870 537 dbSNP
rs1301104356 538 dbSNP
rs990203390 539 dbSNP
rs1167605877 545 dbSNP
rs1374929100 551 dbSNP
rs1431987600 552 dbSNP
rs1400794297 557 dbSNP
rs966120134 560 dbSNP
rs1480399602 565 dbSNP
rs775048311 573 dbSNP
rs1213518545 588 dbSNP
rs1273064572 592 dbSNP
rs1194943898 596 dbSNP
rs138199699 596 dbSNP
rs986351481 599 dbSNP
rs149596897 602 dbSNP
rs566061531 607 dbSNP
rs922106038 614 dbSNP
rs944893102 620 dbSNP
rs968648439 622 dbSNP
rs1444266865 630 dbSNP
rs1313875332 633 dbSNP
rs976107614 640 dbSNP
rs1230978374 653 dbSNP
rs34242904 654 dbSNP
rs1254842320 656 dbSNP
rs146095448 658 dbSNP
rs540910800 660 dbSNP
rs376943479 662 dbSNP
rs929432962 663 dbSNP
rs1487793041 669 dbSNP
rs370287942 670 dbSNP
rs1423479482 671 dbSNP
rs887818524 672 dbSNP
rs1426321498 675 dbSNP
rs1470798156 676 dbSNP
rs917644746 677 dbSNP
rs948610482 682 dbSNP
rs1456172201 684 dbSNP
rs527909017 686 dbSNP
rs1204083238 687 dbSNP
rs907012677 689 dbSNP
rs1322607104 692 dbSNP
rs1420349482 694 dbSNP
rs947821351 706 dbSNP
rs1373950684 707 dbSNP
rs138936486 708 dbSNP
rs1358844452 714 dbSNP
rs1430358509 715 dbSNP
rs1385293768 717 dbSNP
rs1293827817 724 dbSNP
rs562605512 725 dbSNP
rs1369478686 730 dbSNP
rs1031531828 731 dbSNP
rs1300540860 734 dbSNP
rs891536221 747 dbSNP
rs1011358555 759 dbSNP
rs554729662 766 dbSNP
rs1241670866 769 dbSNP
rs58147941 769 dbSNP
rs995786891 769 dbSNP
rs1157557511 775 dbSNP
rs1046967199 776 dbSNP
rs887031802 779 dbSNP
rs1183862628 784 dbSNP
rs1283349658 786 dbSNP
rs1004847319 788 dbSNP
rs776205000 790 dbSNP
rs530638084 793 dbSNP
rs1317482370 796 dbSNP
rs58555715 798 dbSNP
rs996247544 799 dbSNP
rs1489690165 801 dbSNP
rs142144597 805 dbSNP
rs968239399 806 dbSNP
rs567115304 811 dbSNP
rs966297017 814 dbSNP
rs528647010 817 dbSNP
rs1440910046 821 dbSNP
rs976204207 824 dbSNP
rs1254691818 825 dbSNP
rs1296943591 826 dbSNP
rs546871376 828 dbSNP
rs1378552402 830 dbSNP
rs1427077516 833 dbSNP
rs1400280311 838 dbSNP
rs35095228 843 dbSNP
rs189433334 849 dbSNP
rs1163650803 850 dbSNP
rs1422893366 856 dbSNP
rs1165774011 860 dbSNP
rs919475039 861 dbSNP
rs1486099263 863 dbSNP
rs929376129 865 dbSNP
rs1214442624 867 dbSNP
rs1490815511 868 dbSNP
rs1134871 885 dbSNP
rs41270137 896 dbSNP
rs1325044737 900 dbSNP
rs74717791 903 dbSNP
rs1134872 905 dbSNP
rs1044308478 911 dbSNP
rs1215364858 914 dbSNP
rs1306386581 921 dbSNP
rs1372010946 923 dbSNP
rs1361750529 924 dbSNP
rs1276695980 931 dbSNP
rs1407362242 932 dbSNP
rs1366672000 934 dbSNP
rs1228496919 936 dbSNP
rs907100974 937 dbSNP
rs558430761 941 dbSNP
rs1456924796 945 dbSNP
rs548341826 947 dbSNP
rs1347587291 951 dbSNP
rs938619287 952 dbSNP
rs1291540755 953 dbSNP
rs1428740012 960 dbSNP
rs767958210 988 dbSNP
rs1319604274 1003 dbSNP
rs1422726202 1006 dbSNP
rs1191163674 1015 dbSNP
rs1481377710 1018 dbSNP
rs1219805754 1020 dbSNP
rs1273021553 1027 dbSNP
rs796616619 1029 dbSNP
rs796351216 1030 dbSNP
rs112211340 1031 dbSNP
rs111342676 1033 dbSNP
rs919702929 1038 dbSNP
rs180861815 1039 dbSNP
rs1256576187 1042 dbSNP
rs1021390461 1044 dbSNP
rs887005850 1045 dbSNP
rs889420004 1046 dbSNP
rs187215052 1066 dbSNP
rs1364958028 1069 dbSNP
rs867565748 1071 dbSNP
rs1299369184 1072 dbSNP
rs1134873 1079 dbSNP
rs1008159598 1080 dbSNP
rs1041010365 1082 dbSNP
rs1168305438 1084 dbSNP
rs1047150061 1103 dbSNP
rs1019265486 1104 dbSNP
rs200216058 1104 dbSNP
rs886063784 1104 dbSNP
rs966265805 1106 dbSNP
rs1134874 1110 dbSNP
rs752786511 1122 dbSNP
rs554403309 1123 dbSNP
rs1252824638 1128 dbSNP
rs1177797714 1129 dbSNP
rs1163861460 1130 dbSNP
rs1457488085 1136 dbSNP
rs886063785 1141 dbSNP
rs1400781981 1143 dbSNP
rs1029046737 1144 dbSNP
rs1467076865 1155 dbSNP
rs1319188912 1157 dbSNP
rs1308519983 1158 dbSNP
rs1329268148 1161 dbSNP
rs1391419596 1166 dbSNP
rs1026865064 1168 dbSNP
rs192008760 1169 dbSNP
rs756210582 1170 dbSNP
rs1375725934 1171 dbSNP
rs1328936962 1180 dbSNP
rs182505150 1182 dbSNP
rs1134875 1190 dbSNP
rs1134876 1191 dbSNP
rs909313615 1192 dbSNP
rs1134877 1193 dbSNP
rs886063786 1198 dbSNP
rs1464496877 1199 dbSNP
rs562560093 1205 dbSNP
rs1365401064 1211 dbSNP
rs956899603 1214 dbSNP
rs1439214523 1216 dbSNP
rs754017326 1225 dbSNP
rs556119629 1226 dbSNP
rs1232306094 1231 dbSNP
rs1461930524 1232 dbSNP
rs1255917052 1235 dbSNP
rs1134878 1239 dbSNP
rs1199020598 1242 dbSNP
rs1134879 1243 dbSNP
rs1487153378 1251 dbSNP
rs980094667 1253 dbSNP
rs1261772002 1259 dbSNP
rs1293000946 1266 dbSNP
rs201026343 1276 dbSNP
rs1352396353 1277 dbSNP
rs1306453866 1285 dbSNP
rs1247793284 1288 dbSNP
rs576166324 1290 dbSNP
rs1025220479 1298 dbSNP
rs1394027944 1306 dbSNP
rs1256678815 1309 dbSNP
rs1289413301 1316 dbSNP
rs969019293 1317 dbSNP
rs980852877 1322 dbSNP
rs532790150 1323 dbSNP
rs938545304 1324 dbSNP
rs1165484202 1331 dbSNP
rs111408881 1342 dbSNP
rs1368071620 1350 dbSNP
rs931074497 1354 dbSNP
rs913030453 1361 dbSNP
rs185814873 1365 dbSNP
rs947252904 1366 dbSNP
rs1482367605 1368 dbSNP
rs1187531049 1369 dbSNP
rs982606761 1377 dbSNP
rs1283280404 1380 dbSNP
rs908357426 1381 dbSNP
rs1356652058 1383 dbSNP
rs755911467 1385 dbSNP
rs1242122458 1397 dbSNP
rs1478663053 1408 dbSNP
rs1168333418 1410 dbSNP
rs1399336258 1411 dbSNP
rs889516785 1421 dbSNP
rs766183001 1422 dbSNP
rs1405972758 1427 dbSNP
rs1330935705 1431 dbSNP
rs1390075076 1433 dbSNP
rs1161723577 1439 dbSNP
rs563988268 1444 dbSNP
rs1374054589 1448 dbSNP
rs1040682280 1449 dbSNP
rs900857318 1452 dbSNP
rs376550911 1453 dbSNP
rs753610558 1454 dbSNP
rs533103796 1455 dbSNP
rs745716141 1456 dbSNP
rs1200987798 1460 dbSNP
rs1335539892 1460 dbSNP
rs758433801 1467 dbSNP
rs1288523924 1475 dbSNP
rs1356942433 1478 dbSNP
rs540167560 1481 dbSNP
rs560361151 1483 dbSNP
rs1342029486 1491 dbSNP
rs758303748 1497 dbSNP
rs1016882863 1498 dbSNP
rs970122504 1500 dbSNP
rs528904756 1508 dbSNP
rs1285164950 1515 dbSNP
rs1437074136 1524 dbSNP
rs1321658827 1526 dbSNP
rs1330671240 1526 dbSNP
rs1339229375 1532 dbSNP
rs903910171 1541 dbSNP
rs1401221881 1548 dbSNP
rs928581219 1553 dbSNP
rs1464347180 1556 dbSNP
rs190669521 1558 dbSNP
rs989103885 1559 dbSNP
rs1245637014 1571 dbSNP
rs1196047349 1575 dbSNP
rs1439222267 1576 dbSNP
rs112977652 1579 dbSNP
rs1025146752 1587 dbSNP
rs969614196 1590 dbSNP
rs1219804737 1597 dbSNP
rs1344149169 1606 dbSNP
rs1210312082 1607 dbSNP
rs1264144363 1608 dbSNP
rs886063787 1608 dbSNP
rs11358276 1609 dbSNP
rs1177165123 1609 dbSNP
rs1311303749 1609 dbSNP
rs1330991191 1609 dbSNP
rs1408833311 1609 dbSNP
rs1444420006 1609 dbSNP
rs56935102 1609 dbSNP
rs980440033 1609 dbSNP
rs1414403935 1617 dbSNP
rs1027079245 1622 dbSNP
rs75578506 1622 dbSNP
rs1170318504 1623 dbSNP
rs1489427809 1626 dbSNP
rs943075285 1627 dbSNP
rs947313996 1628 dbSNP
rs1380339565 1633 dbSNP
rs1177700395 1639 dbSNP
rs79546636 1644 dbSNP
rs911090061 1645 dbSNP
rs1210483955 1652 dbSNP
rs1241310026 1656 dbSNP
rs942421832 1657 dbSNP
rs1174266797 1660 dbSNP
rs1225374539 1662 dbSNP
rs982917968 1664 dbSNP
rs1308608872 1667 dbSNP
rs1238264216 1668 dbSNP
rs1040775189 1669 dbSNP
rs1303822701 1670 dbSNP
rs1447693337 1674 dbSNP
rs1422393258 1677 dbSNP
rs1320895179 1678 dbSNP
rs900824487 1679 dbSNP
rs1380444435 1691 dbSNP
rs993862276 1707 dbSNP
rs1158772784 1709 dbSNP
rs1437442581 1714 dbSNP
rs1415463682 1727 dbSNP
rs182527165 1730 dbSNP
rs1397758841 1733 dbSNP
rs551447344 1737 dbSNP
rs1235492287 1740 dbSNP
rs1326236249 1757 dbSNP
rs1006918061 1758 dbSNP
rs886063788 1761 dbSNP
rs1437760199 1764 dbSNP
rs746516143 1767 dbSNP
rs1043010162 1769 dbSNP
rs368402831 1769 dbSNP
rs1227921148 1770 dbSNP
rs925257728 1771 dbSNP
rs1035787983 1772 dbSNP
rs1233643940 1775 dbSNP
rs1360380175 1780 dbSNP
rs1297082239 1781 dbSNP
rs371236112 1783 dbSNP
rs988808615 1785 dbSNP
rs1020745266 1808 dbSNP
rs1404391880 1819 dbSNP
rs187028661 1824 dbSNP
rs1356039484 1828 dbSNP
rs534366145 1831 dbSNP
rs886063789 1832 dbSNP
rs1478124840 1834 dbSNP
rs142060987 1835 dbSNP
rs1191386023 1836 dbSNP
rs768066844 1837 dbSNP
rs1266102658 1841 dbSNP
rs1221182351 1851 dbSNP
rs1451995519 1868 dbSNP
rs1200783308 1870 dbSNP
rs767524999 1880 dbSNP
rs1219594889 1881 dbSNP
rs747833481 1894 dbSNP
rs1046565759 1895 dbSNP
rs1407263689 1899 dbSNP
rs1251031629 1907 dbSNP
rs554187625 1926 dbSNP
rs1027258879 1932 dbSNP
rs952477616 1935 dbSNP
rs117552951 1937 dbSNP
rs1381642799 1939 dbSNP
rs1417430417 1946 dbSNP
rs1422611377 1948 dbSNP
rs1168527678 1955 dbSNP
rs922343716 1956 dbSNP
rs1268168211 1959 dbSNP
rs1190622170 1961 dbSNP
rs1487648808 1966 dbSNP
rs929740719 1970 dbSNP
rs1015316457 1971 dbSNP
rs1199483347 1984 dbSNP
rs1046717903 1985 dbSNP
rs888117991 1997 dbSNP
rs942256462 1998 dbSNP
rs1313230029 2010 dbSNP
rs1406299396 2014 dbSNP
rs536532045 2018 dbSNP
rs556182836 2019 dbSNP
rs771371029 2020 dbSNP
rs921088727 2022 dbSNP
rs953926832 2027 dbSNP
rs547939395 2034 dbSNP
rs1440824803 2042 dbSNP
rs1001687769 2054 dbSNP
rs1404248933 2058 dbSNP
rs925928078 2060 dbSNP
rs936635167 2062 dbSNP
rs1052387842 2063 dbSNP
rs1175485267 2065 dbSNP
rs1431564814 2066 dbSNP
rs1382216290 2067 dbSNP
rs1179568968 2070 dbSNP
rs1457476228 2072 dbSNP
rs1035881888 2076 dbSNP
rs1236747189 2077 dbSNP
rs895897241 2078 dbSNP
rs1279153304 2081 dbSNP
rs913963877 2082 dbSNP
rs10117507 2086 dbSNP
rs1020251944 2088 dbSNP
rs747684514 2094 dbSNP
rs1345196570 2100 dbSNP
rs969128339 2101 dbSNP
rs371475082 2105 dbSNP
rs978627850 2106 dbSNP
rs1467934631 2107 dbSNP
rs1018160963 2111 dbSNP
rs963959595 2116 dbSNP
rs1375616290 2117 dbSNP
rs976537793 2121 dbSNP
rs760018815 2136 dbSNP
rs1347329536 2139 dbSNP
rs527567173 2142 dbSNP
rs929706260 2145 dbSNP
rs1402621827 2162 dbSNP
rs1302234241 2169 dbSNP
rs982940882 2170 dbSNP
rs886063790 2172 dbSNP
rs909526336 2179 dbSNP
rs1362602220 2180 dbSNP
rs1159269445 2182 dbSNP
rs117300281 2189 dbSNP
rs905348704 2190 dbSNP
rs1189851827 2191 dbSNP
rs1255895276 2194 dbSNP
rs1424798597 2194 dbSNP
rs549225798 2206 dbSNP
rs1199298476 2207 dbSNP
rs1489522845 2208 dbSNP
rs1287544387 2218 dbSNP
rs539632850 2221 dbSNP
rs1352561056 2225 dbSNP
rs1416760858 2225 dbSNP
rs1180534386 2226 dbSNP
rs941033951 2230 dbSNP
rs1340913117 2231 dbSNP
rs150727017 2239 dbSNP
rs906093832 2244 dbSNP
rs1165296194 2248 dbSNP
rs1392754531 2250 dbSNP
rs1298906792 2251 dbSNP
rs1461333649 2253 dbSNP
rs888711312 2254 dbSNP
rs79020697 2256 dbSNP
rs190876521 2259 dbSNP
rs1458587511 2262 dbSNP
rs1403134017 2264 dbSNP
rs760747427 2270 dbSNP
rs529226542 2280 dbSNP
rs1479108419 2286 dbSNP
rs1264470422 2289 dbSNP
rs1193552292 2292 dbSNP
rs1306452691 2296 dbSNP
rs1487701600 2302 dbSNP
rs1281520587 2303 dbSNP
rs1211327933 2312 dbSNP
rs1356541822 2316 dbSNP
rs1010284389 2317 dbSNP
rs965072980 2323 dbSNP
rs1231171785 2327 dbSNP
rs1042214406 2332 dbSNP
rs904494541 2335 dbSNP
rs62556501 2336 dbSNP
rs1230337229 2337 dbSNP
rs1325537904 2337 dbSNP
rs397972510 2337 dbSNP
rs878884146 2337 dbSNP
rs77838805 2338 dbSNP
rs1000140684 2349 dbSNP
rs1341285993 2350 dbSNP
rs569934092 2356 dbSNP
rs1247281506 2360 dbSNP
rs1477120565 2362 dbSNP
rs1018254339 2363 dbSNP
rs10117550 2366 dbSNP
rs139085157 2368 dbSNP
rs925825036 2373 dbSNP
rs1479651979 2376 dbSNP
rs531289707 2379 dbSNP
rs988072144 2383 dbSNP
rs886063791 2384 dbSNP
rs551514279 2406 dbSNP
rs949410562 2407 dbSNP
rs951308222 2408 dbSNP
rs982523332 2413 dbSNP
rs145096878 2417 dbSNP
rs909607625 2418 dbSNP
rs1375272294 2420 dbSNP
rs1324190093 2421 dbSNP
rs1449279113 2426 dbSNP
rs962513345 2427 dbSNP
rs1401556090 2428 dbSNP
rs754014188 2431 dbSNP
rs1408718653 2433 dbSNP
rs1427821923 2436 dbSNP
rs1173647066 2440 dbSNP
rs1478091921 2441 dbSNP
rs1376570697 2447 dbSNP
rs1297612546 2453 dbSNP
rs1458771458 2454 dbSNP
rs926310068 2474 dbSNP
rs1238562796 2481 dbSNP
rs937544830 2482 dbSNP
rs1057396655 2487 dbSNP
rs1048557338 2488 dbSNP
rs1311260194 2495 dbSNP
rs1355120136 2499 dbSNP
rs1400368977 2501 dbSNP
rs917403648 2507 dbSNP
rs1305628794 2510 dbSNP
rs1301327434 2512 dbSNP
rs946222147 2513 dbSNP
rs940274365 2517 dbSNP
rs781590760 2519 dbSNP
rs3802394 2523 dbSNP
rs1309029900 2528 dbSNP
rs904588279 2532 dbSNP
rs1346541903 2533 dbSNP
rs1028043095 2539 dbSNP
rs10123713 2540 dbSNP
rs1374330587 2546 dbSNP
rs1171121418 2547 dbSNP
rs1039644456 2548 dbSNP
rs548006947 2553 dbSNP
rs1032857882 2557 dbSNP
rs568336698 2560 dbSNP
rs998034391 2563 dbSNP
rs1468448443 2574 dbSNP
rs1030006074 2576 dbSNP
rs1210810056 2577 dbSNP
rs1441714600 2580 dbSNP
rs1194833460 2585 dbSNP
rs1278291300 2588 dbSNP
rs1264299500 2589 dbSNP
rs951356826 2600 dbSNP
rs886063792 2607 dbSNP
rs1004432624 2609 dbSNP
rs1222276324 2612 dbSNP
rs567752938 2618 dbSNP
rs1285092645 2621 dbSNP
rs1436640362 2622 dbSNP
rs571668778 2630 dbSNP
rs147594760 2631 dbSNP
rs1375066985 2637 dbSNP
rs556394357 2639 dbSNP
rs538682615 2641 dbSNP
rs926239519 2643 dbSNP
rs1182164330 2645 dbSNP
rs1474858336 2646 dbSNP
rs569725867 2652 dbSNP
rs993069091 2656 dbSNP
rs78176424 2661 dbSNP
rs984642755 2673 dbSNP
rs1332808870 2681 dbSNP
rs73438585 2682 dbSNP
rs977990779 2683 dbSNP
rs940212708 2684 dbSNP
rs1228056720 2693 dbSNP
rs1333120143 2698 dbSNP
rs1280695599 2701 dbSNP
rs1401140363 2702 dbSNP
rs142122927 2705 dbSNP
rs1340659126 2710 dbSNP
rs1287721360 2713 dbSNP
rs1428225606 2718 dbSNP
rs1353888179 2719 dbSNP
rs1218353134 2723 dbSNP
rs1165250966 2727 dbSNP
rs1460775302 2741 dbSNP
rs796686618 2743 dbSNP
rs572530705 2760 dbSNP
rs1039780257 2764 dbSNP
rs1478071905 2766 dbSNP
rs1261130358 2769 dbSNP
rs1184814561 2774 dbSNP
rs899813879 2778 dbSNP
rs1247558741 2781 dbSNP
rs1213264916 2788 dbSNP
rs534299977 2791 dbSNP
rs1195919154 2793 dbSNP
rs933977686 2794 dbSNP
rs1051125652 2795 dbSNP
rs887022445 2802 dbSNP
rs1004165877 2803 dbSNP
rs1186355812 2817 dbSNP
rs553718497 2821 dbSNP
rs1317775336 2832 dbSNP
rs866257171 2834 dbSNP
rs1212250681 2836 dbSNP
rs566068002 2838 dbSNP
rs889503529 2849 dbSNP
rs898336035 2856 dbSNP
rs1249711052 2860 dbSNP
rs1392032898 2864 dbSNP
rs75664572 2874 dbSNP
rs1466102335 2878 dbSNP
rs895664321 2879 dbSNP
rs891624036 2880 dbSNP
rs1394573016 2882 dbSNP
rs1010056892 2886 dbSNP
rs1193304119 2890 dbSNP
rs1420485490 2907 dbSNP
rs775831366 2913 dbSNP
rs971288802 2916 dbSNP
rs1343694626 2918 dbSNP
rs960473239 2922 dbSNP
rs1313499136 2924 dbSNP
rs1303421323 2926 dbSNP
rs536527668 2938 dbSNP
rs1293950268 2942 dbSNP
rs1311212938 2943 dbSNP
rs1020659307 2945 dbSNP
rs1396585222 2951 dbSNP
rs1395463683 2954 dbSNP
rs553979688 2955 dbSNP
rs144453731 2958 dbSNP
rs1467513173 2963 dbSNP
rs1359831917 2964 dbSNP
rs1173014761 2965 dbSNP
rs1033674035 2966 dbSNP
rs554780978 2969 dbSNP
rs1377038895 2970 dbSNP
rs1418904905 2971 dbSNP
rs926098672 2973 dbSNP
rs1184122454 2977 dbSNP
rs769540853 2992 dbSNP
rs1304390399 2994 dbSNP
rs1280454246 2996 dbSNP
rs975579201 2998 dbSNP
rs921329172 3006 dbSNP
rs1345089428 3007 dbSNP
rs1287767469 3012 dbSNP
rs934130247 3014 dbSNP
rs1266410112 3016 dbSNP
rs972900180 3016 dbSNP
rs796531496 3019 dbSNP
rs542951740 3020 dbSNP
rs562736452 3021 dbSNP
rs1304527424 3024 dbSNP
rs879441545 3024 dbSNP
rs1397719119 3040 dbSNP
rs537103125 3041 dbSNP
rs1379754759 3049 dbSNP
rs557436260 3052 dbSNP
rs182636316 3053 dbSNP
rs1050459311 3054 dbSNP
rs1395393041 3056 dbSNP
rs887122969 3058 dbSNP
rs1179074073 3061 dbSNP
rs939894110 3068 dbSNP
rs371786906 3071 dbSNP
rs145619948 3072 dbSNP
rs768885564 3073 dbSNP
rs1396426761 3074 dbSNP
rs1014072672 3075 dbSNP
rs1033539238 3085 dbSNP
rs4977735 3094 dbSNP
rs1013373181 3095 dbSNP
rs1264688319 3100 dbSNP
rs1021007192 3104 dbSNP
rs966419898 3107 dbSNP
rs1205370697 3117 dbSNP
rs1349425828 3119 dbSNP
rs1401008337 3120 dbSNP
rs1443729383 3123 dbSNP
rs1246652774 3135 dbSNP
rs1296018565 3136 dbSNP
rs1292645055 3137 dbSNP
rs891551944 3144 dbSNP
rs148910202 3145 dbSNP
rs1318984314 3146 dbSNP
rs5896955 3147 dbSNP
rs1381893130 3151 dbSNP
rs111742315 3152 dbSNP
rs1045557581 3160 dbSNP
rs1228548595 3161 dbSNP
rs1033209233 3164 dbSNP
rs1417586177 3169 dbSNP
rs1337443379 3181 dbSNP
rs1479056912 3183 dbSNP
rs1425156804 3186 dbSNP
rs1193225923 3187 dbSNP
rs1001442356 3191 dbSNP
rs1034721104 3192 dbSNP
rs1211235891 3193 dbSNP
rs1468802627 3195 dbSNP
rs959393161 3196 dbSNP
rs1231382194 3200 dbSNP
rs886063793 3207 dbSNP
rs1206708037 3209 dbSNP
rs1270864592 3211 dbSNP
rs1231250228 3216 dbSNP
rs868801150 3221 dbSNP
rs975549723 3226 dbSNP
rs1182681206 3227 dbSNP
rs921466699 3229 dbSNP
rs1394221409 3233 dbSNP
rs1467674398 3234 dbSNP
rs775997252 3235 dbSNP
rs530194912 3238 dbSNP
rs1474820190 3239 dbSNP
rs1370843195 3240 dbSNP
rs761110703 3243 dbSNP
rs550078249 3251 dbSNP
rs1454404960 3254 dbSNP
rs769258001 3257 dbSNP
rs940050248 3263 dbSNP
rs1252176758 3265 dbSNP
rs1420350181 3271 dbSNP
rs188937833 3273 dbSNP
rs1038408600 3277 dbSNP
rs1195150025 3280 dbSNP
rs1337597756 3283 dbSNP
rs193056548 3284 dbSNP
rs1424248122 3285 dbSNP
rs143647446 3288 dbSNP
rs919823409 3295 dbSNP
rs972869078 3297 dbSNP
rs922751743 3303 dbSNP
rs955546017 3307 dbSNP
rs41270139 3308 dbSNP
rs1167631616 3309 dbSNP
rs1174925972 3312 dbSNP
rs185046346 3324 dbSNP
rs141238345 3328 dbSNP
rs1191323425 3333 dbSNP
rs145028875 3338 dbSNP
rs1233230342 3340 dbSNP
rs1181015542 3349 dbSNP
rs761951729 3354 dbSNP
rs945811769 3360 dbSNP
rs138870323 3362 dbSNP
rs1211629296 3363 dbSNP
rs1413306937 3365 dbSNP
rs1278508723 3368 dbSNP
rs536422501 3372 dbSNP
rs1242586393 3381 dbSNP
rs187488692 3382 dbSNP
rs1374585959 3383 dbSNP
rs765432220 3390 dbSNP
rs576437051 3394 dbSNP
rs750657702 3396 dbSNP
rs1297740152 3406 dbSNP
rs1440658319 3414 dbSNP
rs1342731963 3428 dbSNP
rs142136256 3429 dbSNP
rs1414906963 3430 dbSNP
rs1270905823 3431 dbSNP
rs1307021661 3432 dbSNP
rs1171427148 3433 dbSNP
rs957610061 3439 dbSNP
rs1210977435 3440 dbSNP
rs1259862262 3441 dbSNP
rs762744548 3445 dbSNP
rs1028406957 3446 dbSNP
rs1468557240 3451 dbSNP
rs1259590355 3459 dbSNP
rs1484854853 3462 dbSNP
rs955586134 3463 dbSNP
rs987261166 3466 dbSNP
rs766120810 3469 dbSNP
rs564943870 3471 dbSNP
rs1263649866 3476 dbSNP
rs974068903 3479 dbSNP
rs1219093323 3480 dbSNP
rs919960196 3483 dbSNP
rs1284032019 3488 dbSNP
rs887696084 3490 dbSNP
rs937878749 3491 dbSNP
rs146379102 3493 dbSNP
rs1294507183 3497 dbSNP
rs917712966 3499 dbSNP
rs949232383 3502 dbSNP
rs1354284204 3505 dbSNP
rs541133469 3517 dbSNP
rs1418762238 3523 dbSNP
rs751463712 3524 dbSNP
rs1414519025 3528 dbSNP
rs1175036078 3540 dbSNP
rs1000604721 3546 dbSNP
rs1373234523 3553 dbSNP
rs1317170052 3556 dbSNP
rs1433715910 3558 dbSNP
rs1419756865 3559 dbSNP
rs754847337 3564 dbSNP
rs1474809165 3565 dbSNP
rs1415778489 3567 dbSNP
rs138317465 3585 dbSNP
rs1327409569 3587 dbSNP
rs900178560 3588 dbSNP
rs1241780835 3594 dbSNP
rs530252819 3599 dbSNP
rs1213899897 3606 dbSNP
rs865970654 3606 dbSNP
rs1268915371 3612 dbSNP
rs997030059 3614 dbSNP
rs1394968332 3615 dbSNP
rs1274135442 3617 dbSNP
rs1233213693 3621 dbSNP
rs994233230 3622 dbSNP
rs1290925872 3624 dbSNP
rs1029790324 3629 dbSNP
rs1235114451 3631 dbSNP
rs1282574592 3633 dbSNP
rs1215866155 3635 dbSNP
rs1345924076 3642 dbSNP
rs549991029 3643 dbSNP
rs1269301009 3645 dbSNP
rs1284649966 3648 dbSNP
rs577633090 3653 dbSNP
rs955843882 3656 dbSNP
rs1396432014 3659 dbSNP
rs1018488176 3664 dbSNP
rs1448489170 3667 dbSNP
rs1008377800 3668 dbSNP
rs1460888797 3669 dbSNP
rs1016216210 3671 dbSNP
rs752249935 3673 dbSNP
rs1392257334 3674 dbSNP
rs1172402258 3691 dbSNP
rs961478646 3692 dbSNP
rs1418873617 3693 dbSNP
rs1190817840 3701 dbSNP
rs989802832 3702 dbSNP
rs912881997 3705 dbSNP
rs945756142 3709 dbSNP
rs1213405497 3710 dbSNP
rs974164467 3720 dbSNP
rs1194884325 3721 dbSNP
rs1026950254 3723 dbSNP
rs959380668 3730 dbSNP
rs1392734955 3731 dbSNP
rs563525724 3732 dbSNP
rs928395765 3740 dbSNP
rs1453367135 3742 dbSNP
rs990846939 3744 dbSNP
rs1212450049 3757 dbSNP
rs1372677241 3762 dbSNP
rs1443672587 3763 dbSNP
rs149649469 3767 dbSNP
rs1439940952 3768 dbSNP
rs1386730525 3770 dbSNP
rs1462379923 3771 dbSNP
rs917821645 3772 dbSNP
rs949366316 3775 dbSNP
rs1395971711 3779 dbSNP
rs1316767371 3780 dbSNP
rs887673792 3789 dbSNP
rs1345050714 3793 dbSNP
rs977943898 3796 dbSNP
rs923778025 3798 dbSNP
rs936384968 3802 dbSNP
rs1053484801 3803 dbSNP
rs111359917 3810 dbSNP
rs970366865 3812 dbSNP
rs1480555894 3814 dbSNP
rs1250303910 3816 dbSNP
rs1202350346 3820 dbSNP
rs1305659206 3828 dbSNP
rs6475592 3830 dbSNP
rs1280678537 3838 dbSNP
rs796443063 3842 dbSNP
rs773081239 3846 dbSNP
rs1233091324 3850 dbSNP
rs76751525 3852 dbSNP
rs891375408 3856 dbSNP
rs534675057 3857 dbSNP
rs1008931604 3860 dbSNP
rs560167088 3863 dbSNP
rs897319177 3865 dbSNP
rs1416745244 3878 dbSNP
rs572417216 3885 dbSNP
rs1203154899 3886 dbSNP
rs1173312436 3889 dbSNP
rs995568790 3902 dbSNP
rs1365921975 3905 dbSNP
rs1468811132 3908 dbSNP
rs1027056747 3915 dbSNP
rs80226037 3917 dbSNP
rs1249101699 3921 dbSNP
rs1250551578 3924 dbSNP
rs868001376 3928 dbSNP
rs758747486 3934 dbSNP
rs1467611195 3941 dbSNP
rs886063794 3944 dbSNP
rs10965168 3947 dbSNP
rs1025428103 3950 dbSNP
rs1257533833 3953 dbSNP
rs1209710154 3963 dbSNP
rs1365182609 3964 dbSNP
rs1468288710 3965 dbSNP
rs970636174 3967 dbSNP
rs978416137 3973 dbSNP
rs1407746334 3974 dbSNP
rs923773494 3989 dbSNP
rs1316084916 3991 dbSNP
rs936520886 3993 dbSNP
rs990360443 3994 dbSNP
rs759358291 3996 dbSNP
rs114668746 4000 dbSNP
rs538929944 4003 dbSNP
rs867044875 4006 dbSNP
rs1440243259 4009 dbSNP
rs1453577350 4011 dbSNP
rs1329698021 4012 dbSNP
rs1167750721 4017 dbSNP
rs1475780455 4021 dbSNP
rs531409672 4023 dbSNP
rs1417988826 4041 dbSNP
rs1337688334 4044 dbSNP
rs558535038 4045 dbSNP
rs1421519920 4055 dbSNP
rs1278681913 4056 dbSNP
rs1263457251 4071 dbSNP
rs1205350060 4077 dbSNP
rs1335267046 4080 dbSNP
rs549922415 4082 dbSNP
rs1485455223 4086 dbSNP
rs1234947101 4095 dbSNP
rs1215493940 4096 dbSNP
rs1051430348 4098 dbSNP
rs890128308 4099 dbSNP
rs1292775129 4102 dbSNP
rs572025534 4108 dbSNP
rs1242768486 4122 dbSNP
rs1195806329 4128 dbSNP
rs1328248111 4130 dbSNP
rs1037709179 4138 dbSNP
rs1381803728 4147 dbSNP
rs565253292 4149 dbSNP
rs995653828 4150 dbSNP
rs1328293365 4151 dbSNP
rs769041996 4154 dbSNP
rs1027192951 4155 dbSNP
rs1394457041 4167 dbSNP
rs540642472 4168 dbSNP
rs1012753493 4174 dbSNP
rs909019075 4175 dbSNP
rs554122610 4180 dbSNP
rs971154070 4184 dbSNP
rs1167626583 4191 dbSNP
rs1468735658 4193 dbSNP
rs1272517559 4194 dbSNP
rs897750984 4196 dbSNP
rs1341572397 4198 dbSNP
rs1227004731 4200 dbSNP
rs1251892302 4200 dbSNP
rs929922702 4201 dbSNP
rs1416326644 4204 dbSNP
rs1370711487 4206 dbSNP
rs1461381780 4206 dbSNP
rs367927619 4216 dbSNP
rs1412078444 4217 dbSNP
rs891182247 4222 dbSNP
rs1167951376 4225 dbSNP
rs574228472 4232 dbSNP
rs148395592 4235 dbSNP
rs777184495 4238 dbSNP
rs748168395 4240 dbSNP
rs957972308 4249 dbSNP
rs1387994912 4250 dbSNP
rs989271559 4254 dbSNP
rs1175098226 4258 dbSNP
rs1007371248 4260 dbSNP
rs1018400919 4261 dbSNP
rs1398748592 4263 dbSNP
rs893287559 4265 dbSNP
rs1439447074 4268 dbSNP
rs369020018 4270 dbSNP
rs1195347596 4273 dbSNP
rs1356388294 4277 dbSNP
rs953100649 4285 dbSNP
rs1291218823 4287 dbSNP
rs987633105 4292 dbSNP
rs765014651 4295 dbSNP
rs1418072 4301 dbSNP
rs192327540 4305 dbSNP
rs1273374569 4306 dbSNP
rs1445031321 4313 dbSNP
rs1228098953 4317 dbSNP
rs1336822312 4318 dbSNP
rs563542059 4320 dbSNP
rs1328746445 4322 dbSNP
rs1036050293 4326 dbSNP
rs1252514689 4332 dbSNP
rs773385066 4336 dbSNP
rs1408734537 4337 dbSNP
rs532527183 4338 dbSNP
rs1002467296 4339 dbSNP
rs1336846996 4340 dbSNP
rs1035752902 4366 dbSNP
rs763108133 4369 dbSNP
rs1048557202 4372 dbSNP
rs895318886 4373 dbSNP
rs991643413 4375 dbSNP
rs1180993960 4376 dbSNP
rs1482148229 4377 dbSNP
rs369883938 4377 dbSNP
rs574517785 4377 dbSNP
rs1211875273 4380 dbSNP
rs1486485348 4381 dbSNP
rs1012308759 4385 dbSNP
rs1351816324 4385 dbSNP
rs1279559868 4388 dbSNP
rs971891868 4395 dbSNP
rs1190430189 4396 dbSNP
rs1314133938 4401 dbSNP
rs1358266245 4403 dbSNP
rs868485692 4404 dbSNP
rs1331751896 4408 dbSNP
rs1402298309 4412 dbSNP
rs377095789 4420 dbSNP
rs1158353968 4424 dbSNP
rs1471531095 4427 dbSNP
rs1423692698 4430 dbSNP
rs1420155025 4435 dbSNP
rs906646585 4450 dbSNP
rs999916363 4455 dbSNP
rs1031002243 4467 dbSNP
rs1235988607 4468 dbSNP
rs529338099 4474 dbSNP
rs1460507197 4478 dbSNP
rs1448000795 4480 dbSNP
rs1168102471 4485 dbSNP
rs2027484 4488 dbSNP
rs559905847 4494 dbSNP
rs1467844422 4504 dbSNP
rs1010786990 4507 dbSNP
rs1028746938 4518 dbSNP
rs1310800091 4522 dbSNP
rs953354667 4527 dbSNP
rs912534298 4533 dbSNP
rs987211039 4537 dbSNP
rs528758637 4538 dbSNP
rs911620110 4545 dbSNP
rs1377801349 4560 dbSNP
rs1282127237 4563 dbSNP
rs1354619946 4568 dbSNP
rs145033500 4572 dbSNP
rs1396663574 4573 dbSNP
rs568454117 4577 dbSNP
rs1165526409 4585 dbSNP
rs531075347 4587 dbSNP
rs1297610151 4593 dbSNP
rs1411707137 4593 dbSNP
rs1188506509 4595 dbSNP
rs1475838988 4596 dbSNP
rs373955459 4599 dbSNP
rs1247835347 4600 dbSNP
rs893223083 4609 dbSNP
rs1324677432 4613 dbSNP
rs767544223 4617 dbSNP
rs931513164 4628 dbSNP
rs1320597473 4642 dbSNP
rs1287058367 4658 dbSNP
rs777327166 4663 dbSNP
rs916720678 4667 dbSNP
rs867659057 4671 dbSNP
rs948205723 4678 dbSNP
rs1349526221 4685 dbSNP
rs147163605 4695 dbSNP
rs1278576995 4696 dbSNP
rs1326570103 4700 dbSNP
rs1435587550 4701 dbSNP
rs1348214523 4705 dbSNP
rs1003062797 4706 dbSNP
rs755614877 4707 dbSNP
rs140447697 4709 dbSNP
rs1389839031 4712 dbSNP
rs1206140688 4714 dbSNP
rs1166936433 4715 dbSNP
rs1264458253 4719 dbSNP
rs1455906577 4720 dbSNP
rs999650109 4732 dbSNP
rs958606332 4733 dbSNP
rs1487763348 4739 dbSNP
rs1244507161 4745 dbSNP
rs1206058054 4746 dbSNP
rs1342222666 4751 dbSNP
rs1273539364 4763 dbSNP
rs1225720152 4776 dbSNP
rs1012590252 4780 dbSNP
rs1386175605 4782 dbSNP
rs1016386151 4783 dbSNP
rs1299794060 4786 dbSNP
rs1443099353 4798 dbSNP
rs1187942425 4800 dbSNP
rs373177944 4800 dbSNP
rs963140776 4802 dbSNP
rs1052351894 4807 dbSNP
rs1306410840 4810 dbSNP
rs893812452 4811 dbSNP
rs1010757482 4816 dbSNP
rs954549957 4817 dbSNP
rs763726255 4818 dbSNP
rs1028881292 4819 dbSNP
rs987788090 4820 dbSNP
rs1290484876 4821 dbSNP
rs910479670 4822 dbSNP
rs1202600607 4826 dbSNP
rs753440280 4827 dbSNP
rs1486418135 4829 dbSNP
rs183974744 4834 dbSNP
rs889069557 4836 dbSNP
rs1382608688 4853 dbSNP
rs1009142471 4868 dbSNP
rs1018812370 4872 dbSNP
rs1309144343 4873 dbSNP
rs942657039 4874 dbSNP
rs558835765 4877 dbSNP
rs1429411976 4889 dbSNP
rs781680640 4891 dbSNP
rs971807134 4891 dbSNP
rs80318698 4899 dbSNP
rs951705703 4904 dbSNP
rs1303432670 4905 dbSNP
rs991180887 4910 dbSNP
rs916815909 4911 dbSNP
rs1376335278 4920 dbSNP
rs1372574761 4929 dbSNP
rs1464907089 4934 dbSNP
rs1041809312 4946 dbSNP
rs534903672 4961 dbSNP
rs903361109 4962 dbSNP
rs1317202875 4965 dbSNP
rs1179447008 4968 dbSNP
rs1003028384 4971 dbSNP
rs1240202200 4975 dbSNP
rs1256495732 4977 dbSNP
rs554186007 4982 dbSNP
rs1199524168 4983 dbSNP
rs1482157456 4990 dbSNP
rs574047089 4997 dbSNP
rs570299330 4998 dbSNP
rs1328340998 4999 dbSNP
rs1485152121 5003 dbSNP
rs533220924 5004 dbSNP
rs928163176 5007 dbSNP
rs1341125688 5009 dbSNP
rs189600424 5018 dbSNP
rs1394441572 5025 dbSNP
rs1364536794 5026 dbSNP
rs1289764327 5028 dbSNP
rs866621463 5032 dbSNP
rs116114562 5040 dbSNP
rs1387162730 5044 dbSNP
rs1167725704 5048 dbSNP
rs747326565 5053 dbSNP
rs1368474411 5054 dbSNP
rs946707845 5061 dbSNP
rs1421639223 5062 dbSNP
rs577389294 5064 dbSNP
rs770270653 5064 dbSNP
rs1263622172 5065 dbSNP
rs1191894173 5066 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
             :::||| |   :|||||| 
Target 5' ---GUGCCACU---GCACUCCa 3'
1 - 16
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000380172.4 | 3UTR | GUGCCACUGCACUCCAGCCUGGGCAACAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.781 3.3e-6 0.705 6.0e-5 24 Click to see details
GSE28260 Renal cortex and medulla 0.501 4.1e-2 0.423 7.5e-2 13 Click to see details
GSE27834 Pluripotent stem cells -0.397 6.4e-2 -0.509 2.2e-2 16 Click to see details
GSE42095 Differentiated embryonic stem cells 0.312 7.4e-2 -0.247 1.3e-1 23 Click to see details
GSE17498 Multiple myeloma 0.222 8.4e-2 0.311 2.5e-2 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.263 1.3e-1 0.092 3.5e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.113 1.9e-1 0.147 1.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.27 2.0e-1 -0.196 2.7e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.096 3.0e-1 0.059 3.7e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.086 3.4e-1 0.065 3.8e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.198 3.5e-1 0.143 3.9e-1 6 Click to see details
GSE21849 B cell lymphoma 0.057 3.8e-1 0.250 9.5e-2 29 Click to see details
GSE14794 Lymphoblastoid cells -0.031 3.9e-1 -0.074 2.4e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.059 3.9e-1 0.043 4.2e-1 25 Click to see details
GSE17306 Multiple myeloma -0.037 4.0e-1 0.047 3.7e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.03 4.4e-1 0.115 2.9e-1 25 Click to see details
GSE38226 Liver fibrosis 0 5.0e-1 0.011 4.8e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.562 0.06 -0.450 0.11 9 Click to see details
STAD 0.436 0.14 0.405 0.16 8 Click to see details
KICH -0.39 0.17 -0.619 0.05 8 Click to see details
THCA -0.472 0.21 -0.600 0.14 5 Click to see details
KIRC 0.146 0.22 0.124 0.26 29 Click to see details
ESCA 0.403 0.25 0.300 0.31 5 Click to see details
HNSC -0.263 0.42 0.500 0.33 3 Click to see details
CHOL 0.068 0.43 0.233 0.27 9 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
LIHC -0.023 0.44 -0.025 0.43 49 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1