miRTarBase - #MIRT662844 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 link
C-to-U 11 18 + 58451098 28550310 link
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OMD   
Synonyms OSAD, SLRR2C
Description osteomodulin
Transcript NM_005014   
Expression
Putative miRNA Targets on OMD
3'UTR of OMD
(miRNA target sites are highlighted)
>OMD|NM_005014|3'UTR
   1 CAAGAAACTATATAGGTATACACTTACGACTTCACAAAACCTATACTTAATATAGTAAATCTAAGTAAACATGTATTACT
  81 CAAAGTAATATATTTAGAATTATGTATTAGTATAAGATCAGAATTGAATTTAAGTTGTTGGTGACATCTGCATCATTTCA
 161 TAGGATTAGAACTTACTCAAAATAATGTAAATCTTTAAAAATATAAATTAGAATGACAAGTGGGAATCATAAATTAAACG
 241 TTAATGGTTTCTTATGCTCTTTTTAAATATAGAAATATCATGTTAAAGAAAGTGAGTGTATCATTTCTATTAACAGTAAT
 321 TTTTCTAAAAATGAGGAAGGAAGTAGCATTAGCAGTAAAGACCCACAGGCCATGACCTTTTTGATCACTCTGAGGACAAT
 401 ATTTAAATGACAGGAAGGTATATTAATGTAACAAGCATTCATTTAAGGAATAGACCATTTTCTCTGACCTCTTCTTCAGG
 481 AAAGCTTTCACACTGGTATTTGTGATCTCACCATTATGACATCCATCCCCCTAGCTCACCACATAGCACATAGAATGATA
 561 TTTTTGATTTGTAAGAGGCCATCCAGGTACTAAGGACCCAAGGCATACAGATTCACAAAATTAACTAATCTTTTTGCCTC
 641 AGAATACCAAAACAACAAAATTATAAAGCTGTATTTGGACAACTAAAAAACACCAAACTATCTCATTGCAATTTGTATTT
 721 TAGCAGATTTCAGCAACTATCCTAAACAATGTTATTGTGTTCCATTTTAACTGGGATAAATGTTTTTGTAAAAATACAAC
 801 CATAGAAAGGCCTCTTTGTTACAAAATGATTTGCAAAGAAATAACTGCTTTGTTTGCAAGATTAAATTAGTGTTGGCAAA
 881 ATAAAGTTCTAAAGATAATACTAAACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ||||||| | ||| ||| 
Target 5' atctCACCATTATGACA-TCCa 3'
505 - 525 122.00 -16.10
2
miRNA  3' guUUGUGGUA-A--CA-GUGUGAGgu 5'
            :| ||:|| |  || :|||||:  
Target 5' aaGAAACTATATAGGTATACACTTac 3'
2 - 27 118.00 -8.70
3
miRNA  3' guUUGUGGUAACAGUGUGAggu 5'
            || :|  || |||||||   
Target 5' ggAAAGC--TT-TCACACTggt 3'
479 - 497 115.00 -6.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30128534 18 COSMIC
COSN31587142 28 COSMIC
COSN31605210 97 COSMIC
COSN31575592 116 COSMIC
COSN15661612 169 COSMIC
COSN30167913 193 COSMIC
COSN24717813 376 COSMIC
COSN6399591 572 COSMIC
COSN7577924 900 COSMIC
COSN6399590 1763 COSMIC
COSN1382878 1965 COSMIC
COSN7577922 2386 COSMIC
COSN22374284 2654 COSMIC
COSN22373841 2655 COSMIC
COSN22376244 2656 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1286392235 1 dbSNP
rs777070283 9 dbSNP
rs1348302504 11 dbSNP
rs768184042 13 dbSNP
rs1238201648 16 dbSNP
rs746460178 17 dbSNP
rs1041153955 23 dbSNP
rs534575934 27 dbSNP
rs1319535611 28 dbSNP
rs1206255953 29 dbSNP
rs377123492 33 dbSNP
rs1482445482 39 dbSNP
rs745480492 44 dbSNP
rs778901437 47 dbSNP
rs570743890 51 dbSNP
rs77817998 52 dbSNP
rs1164174380 79 dbSNP
rs1413597351 82 dbSNP
rs974218812 84 dbSNP
rs1418973641 91 dbSNP
rs537082423 96 dbSNP
rs969874900 103 dbSNP
rs1252695663 106 dbSNP
rs911407512 112 dbSNP
rs1306061673 114 dbSNP
rs1357256640 120 dbSNP
rs1448734523 124 dbSNP
rs1283372263 129 dbSNP
rs1489941034 133 dbSNP
rs1215892774 139 dbSNP
rs1023810539 146 dbSNP
rs1268369010 147 dbSNP
rs1210232808 148 dbSNP
rs1340785204 151 dbSNP
rs1358149766 154 dbSNP
rs1013726367 155 dbSNP
rs985626366 156 dbSNP
rs34154100 158 dbSNP
rs1281900417 164 dbSNP
rs1486933012 165 dbSNP
rs896759940 172 dbSNP
rs1258702245 182 dbSNP
rs752904004 186 dbSNP
rs1472019757 189 dbSNP
rs1188454082 191 dbSNP
rs1391049200 193 dbSNP
rs569744036 198 dbSNP
rs1166774580 203 dbSNP
rs920185832 207 dbSNP
rs972945962 210 dbSNP
rs1289750670 211 dbSNP
rs961708044 215 dbSNP
rs1402478250 217 dbSNP
rs1344492097 220 dbSNP
rs907534689 221 dbSNP
rs1387741788 223 dbSNP
rs1338423406 225 dbSNP
rs993019436 229 dbSNP
rs959800326 239 dbSNP
rs1157174686 240 dbSNP
rs74396514 242 dbSNP
rs1225795358 247 dbSNP
rs781317946 255 dbSNP
rs191543046 257 dbSNP
rs1201463924 263 dbSNP
rs1001389848 270 dbSNP
rs568628137 275 dbSNP
rs1218344353 276 dbSNP
rs1441006407 276 dbSNP
rs995945216 278 dbSNP
rs1186987708 282 dbSNP
rs968489141 293 dbSNP
rs1021502013 294 dbSNP
rs1010108591 317 dbSNP
rs891832870 324 dbSNP
rs10992328 325 dbSNP
rs1040198384 339 dbSNP
rs1161472641 344 dbSNP
rs944516997 345 dbSNP
rs1400022415 348 dbSNP
rs77873345 350 dbSNP
rs1320963829 360 dbSNP
rs1268480797 361 dbSNP
rs1432355939 364 dbSNP
rs1327511423 366 dbSNP
rs2761672 373 dbSNP
rs1231926228 376 dbSNP
rs1272610989 378 dbSNP
rs541353051 382 dbSNP
rs10992327 390 dbSNP
rs919977427 394 dbSNP
rs974440193 414 dbSNP
rs1464735901 415 dbSNP
rs1364988326 418 dbSNP
rs1050241257 427 dbSNP
rs564816648 432 dbSNP
rs1204328065 436 dbSNP
rs1198214158 445 dbSNP
rs1376049500 447 dbSNP
rs920051791 450 dbSNP
rs1471116323 451 dbSNP
rs187452753 458 dbSNP
rs940246802 469 dbSNP
rs530842933 474 dbSNP
rs960893679 485 dbSNP
rs1031167666 495 dbSNP
rs779488969 498 dbSNP
rs1321000818 517 dbSNP
rs1337087426 520 dbSNP
rs1274893457 522 dbSNP
rs563440831 523 dbSNP
rs1289538943 527 dbSNP
rs1235022919 529 dbSNP
rs1226977141 532 dbSNP
rs1324312411 532 dbSNP
rs541961625 535 dbSNP
rs968668003 537 dbSNP
rs1209537410 544 dbSNP
rs543565600 551 dbSNP
rs142604101 552 dbSNP
rs1182747792 553 dbSNP
rs900278018 558 dbSNP
rs541234584 560 dbSNP
rs1471590650 566 dbSNP
rs927072507 568 dbSNP
rs1166795623 571 dbSNP
rs1323089077 572 dbSNP
rs1457095405 574 dbSNP
rs1468667275 577 dbSNP
rs1040121885 581 dbSNP
rs41278685 593 dbSNP
rs1429855226 595 dbSNP
rs1479166975 596 dbSNP
rs1802973 603 dbSNP
rs758723967 608 dbSNP
rs772837416 627 dbSNP
rs1315265244 629 dbSNP
rs1341449301 634 dbSNP
rs536638813 636 dbSNP
rs1263923606 648 dbSNP
rs1344353061 659 dbSNP
rs1449793674 670 dbSNP
rs1010139228 671 dbSNP
rs1274072093 674 dbSNP
rs1482023546 682 dbSNP
rs1183599652 702 dbSNP
rs557833630 703 dbSNP
rs930580095 704 dbSNP
rs1201736814 706 dbSNP
rs1460800044 709 dbSNP
rs1391665342 712 dbSNP
rs1278790131 719 dbSNP
rs955936662 722 dbSNP
rs569706918 725 dbSNP
rs41278683 730 dbSNP
rs1368236641 747 dbSNP
rs1337049605 786 dbSNP
rs1008240088 787 dbSNP
rs1403295351 793 dbSNP
rs889748773 794 dbSNP
rs948073684 803 dbSNP
rs1367588741 808 dbSNP
rs1229483846 811 dbSNP
rs1296963111 822 dbSNP
rs1340148020 826 dbSNP
rs747840428 842 dbSNP
rs1256543667 845 dbSNP
rs776224905 845 dbSNP
rs182722859 871 dbSNP
rs1482783215 872 dbSNP
rs1198483771 877 dbSNP
rs995588110 887 dbSNP
rs565803535 895 dbSNP
rs574688525 899 dbSNP
rs1449686420 901 dbSNP
rs1300237491 909 dbSNP
rs1187543649 911 dbSNP
rs571690018 913 dbSNP
rs1434416762 915 dbSNP
rs192535371 923 dbSNP
rs528719903 934 dbSNP
rs1359092047 935 dbSNP
rs918187271 938 dbSNP
rs1334931130 939 dbSNP
rs377607336 945 dbSNP
rs373195619 954 dbSNP
rs1057084706 957 dbSNP
rs938363798 958 dbSNP
rs553315437 960 dbSNP
rs1335124701 963 dbSNP
rs1394631220 976 dbSNP
rs1167518491 987 dbSNP
rs1436006714 990 dbSNP
rs1320158308 991 dbSNP
rs1363061192 994 dbSNP
rs986350367 1002 dbSNP
rs968344267 1004 dbSNP
rs979912902 1008 dbSNP
rs947126673 1013 dbSNP
rs1450293394 1017 dbSNP
rs1022947522 1018 dbSNP
rs1231056720 1024 dbSNP
rs1269710555 1026 dbSNP
rs571035975 1037 dbSNP
rs1181512172 1042 dbSNP
rs1207655339 1045 dbSNP
rs1245844680 1057 dbSNP
rs1489281243 1065 dbSNP
rs760310252 1070 dbSNP
rs988621089 1074 dbSNP
rs1444009538 1078 dbSNP
rs955842802 1086 dbSNP
rs1019532920 1088 dbSNP
rs987079959 1095 dbSNP
rs954111012 1098 dbSNP
rs370419202 1099 dbSNP
rs1343628219 1107 dbSNP
rs1028733295 1115 dbSNP
rs995619150 1119 dbSNP
rs898562111 1123 dbSNP
rs1384945810 1127 dbSNP
rs1205484467 1128 dbSNP
rs1015659836 1129 dbSNP
rs1329548779 1140 dbSNP
rs1227517851 1144 dbSNP
rs1266067075 1146 dbSNP
rs1004392957 1149 dbSNP
rs1277294575 1155 dbSNP
rs1244154931 1160 dbSNP
rs749971672 1162 dbSNP
rs896608877 1169 dbSNP
rs1056756361 1175 dbSNP
rs938257008 1179 dbSNP
rs905558996 1180 dbSNP
rs1026154027 1183 dbSNP
rs1197833775 1185 dbSNP
rs1254636733 1186 dbSNP
rs995049853 1194 dbSNP
rs898981127 1211 dbSNP
rs1044736232 1217 dbSNP
rs535004820 1222 dbSNP
rs948610878 1229 dbSNP
rs552883349 1234 dbSNP
rs530807236 1242 dbSNP
rs1422852862 1250 dbSNP
rs914334268 1251 dbSNP
rs1309975480 1263 dbSNP
rs968185772 1269 dbSNP
rs988483629 1270 dbSNP
rs1351009742 1271 dbSNP
rs1409196064 1274 dbSNP
rs1307475961 1284 dbSNP
rs1277549894 1286 dbSNP
rs1056441971 1291 dbSNP
rs934494466 1304 dbSNP
rs912382055 1308 dbSNP
rs1319362586 1312 dbSNP
rs939426547 1324 dbSNP
rs986768299 1328 dbSNP
rs954085347 1329 dbSNP
rs72752463 1331 dbSNP
rs779215162 1346 dbSNP
rs1473989957 1363 dbSNP
rs541826683 1366 dbSNP
rs962669920 1367 dbSNP
rs1413301409 1371 dbSNP
rs1443059270 1376 dbSNP
rs1170551294 1378 dbSNP
rs1414478912 1381 dbSNP
rs1015689505 1385 dbSNP
rs188936403 1393 dbSNP
rs896688399 1394 dbSNP
rs761674587 1406 dbSNP
rs1360636014 1414 dbSNP
rs1468514467 1421 dbSNP
rs1431684907 1425 dbSNP
rs1035586960 1429 dbSNP
rs1283423477 1446 dbSNP
rs559829872 1461 dbSNP
rs1230241180 1462 dbSNP
rs1297696155 1463 dbSNP
rs184032866 1466 dbSNP
rs915397687 1469 dbSNP
rs777917772 1471 dbSNP
rs577012533 1472 dbSNP
rs558562496 1474 dbSNP
rs1237325141 1479 dbSNP
rs1460146587 1480 dbSNP
rs1190758493 1485 dbSNP
rs1390800919 1505 dbSNP
rs1182258998 1515 dbSNP
rs1427143830 1526 dbSNP
rs534233147 1526 dbSNP
rs756110602 1542 dbSNP
rs1333253131 1543 dbSNP
rs1403725217 1545 dbSNP
rs762400162 1550 dbSNP
rs1483834445 1553 dbSNP
rs1018567223 1567 dbSNP
rs543660803 1569 dbSNP
rs987063121 1587 dbSNP
rs1363773773 1590 dbSNP
rs190885374 1595 dbSNP
rs116752208 1597 dbSNP
rs536270291 1598 dbSNP
rs565764969 1599 dbSNP
rs537641165 1606 dbSNP
rs553861925 1610 dbSNP
rs1230582996 1611 dbSNP
rs1321869098 1622 dbSNP
rs1349146039 1627 dbSNP
rs1287884272 1630 dbSNP
rs1464647911 1633 dbSNP
rs1410444559 1637 dbSNP
rs1248589170 1638 dbSNP
rs892762402 1642 dbSNP
rs994584097 1644 dbSNP
rs1052837715 1645 dbSNP
rs1458643412 1650 dbSNP
rs1159679824 1670 dbSNP
rs1387421366 1672 dbSNP
rs1380225334 1685 dbSNP
rs1324949912 1686 dbSNP
rs1331183397 1701 dbSNP
rs1022795625 1708 dbSNP
rs1301475303 1712 dbSNP
rs1283228104 1722 dbSNP
rs1321809017 1726 dbSNP
rs1435541279 1750 dbSNP
rs534904850 1752 dbSNP
rs1230592756 1754 dbSNP
rs139462386 1756 dbSNP
rs553686122 1757 dbSNP
rs934397363 1759 dbSNP
rs144843654 1763 dbSNP
rs1203682991 1767 dbSNP
rs1398944941 1771 dbSNP
rs1411052328 1774 dbSNP
rs1051352437 1775 dbSNP
rs186014548 1781 dbSNP
rs1426806042 1786 dbSNP
rs1198286873 1789 dbSNP
rs921189069 1806 dbSNP
rs1182611408 1812 dbSNP
rs973947727 1838 dbSNP
rs1451090748 1856 dbSNP
rs1164650042 1857 dbSNP
rs1247717318 1862 dbSNP
rs1236935486 1863 dbSNP
rs570096573 1865 dbSNP
rs962743592 1869 dbSNP
rs537304476 1870 dbSNP
rs1335555745 1873 dbSNP
rs982895367 1874 dbSNP
rs961059562 1875 dbSNP
rs1357098886 1886 dbSNP
rs1445783135 1889 dbSNP
rs373352424 1890 dbSNP
rs1002796726 1894 dbSNP
rs1249486548 1896 dbSNP
rs1417103783 1903 dbSNP
rs1189142035 1911 dbSNP
rs548160193 1913 dbSNP
rs1281425552 1914 dbSNP
rs1472290574 1914 dbSNP
rs1218916847 1916 dbSNP
rs1371943377 1919 dbSNP
rs1022503682 1921 dbSNP
rs370114400 1932 dbSNP
rs974840947 1937 dbSNP
rs1295072003 1938 dbSNP
rs1390062143 1954 dbSNP
rs1011109296 1959 dbSNP
rs1341276968 1961 dbSNP
rs1245599580 1973 dbSNP
rs1312926437 1978 dbSNP
rs943631071 1984 dbSNP
rs1228992789 1991 dbSNP
rs912115813 1993 dbSNP
rs892837327 2005 dbSNP
rs1052706416 2012 dbSNP
rs1321093894 2022 dbSNP
rs182724023 2034 dbSNP
rs559587309 2035 dbSNP
rs538255781 2040 dbSNP
rs1449572470 2041 dbSNP
rs1050833749 2042 dbSNP
rs973600990 2044 dbSNP
rs547909205 2045 dbSNP
rs1023230445 2048 dbSNP
rs1334995591 2058 dbSNP
rs1426752396 2063 dbSNP
rs1435863176 2069 dbSNP
rs376637244 2090 dbSNP
rs149441046 2091 dbSNP
rs941247719 2102 dbSNP
rs1322576748 2106 dbSNP
rs190124112 2107 dbSNP
rs755220953 2114 dbSNP
rs959967068 2122 dbSNP
rs138941135 2125 dbSNP
rs1447998099 2131 dbSNP
rs1247988830 2134 dbSNP
rs1462123489 2136 dbSNP
rs1209950246 2137 dbSNP
rs1466625920 2138 dbSNP
rs1261412053 2143 dbSNP
rs1231811002 2146 dbSNP
rs1259132762 2146 dbSNP
rs1209420838 2147 dbSNP
rs1313007937 2148 dbSNP
rs1442856851 2150 dbSNP
rs1178883783 2151 dbSNP
rs1308684932 2151 dbSNP
rs1212620893 2154 dbSNP
rs1430356995 2156 dbSNP
rs1035634092 2174 dbSNP
rs1174775438 2175 dbSNP
rs1364238720 2175 dbSNP
rs1221437783 2177 dbSNP
rs1240669166 2177 dbSNP
rs1288358577 2177 dbSNP
rs1301925565 2177 dbSNP
rs1329417448 2177 dbSNP
rs1344595465 2177 dbSNP
rs1359963749 2177 dbSNP
rs1388388485 2177 dbSNP
rs1391076844 2177 dbSNP
rs1431826901 2177 dbSNP
rs35323105 2177 dbSNP
rs35648369 2177 dbSNP
rs998757553 2177 dbSNP
rs1298030703 2178 dbSNP
rs1480424356 2178 dbSNP
rs1197698599 2180 dbSNP
rs1414737184 2187 dbSNP
rs576371155 2187 dbSNP
rs1403813487 2189 dbSNP
rs928045408 2191 dbSNP
rs1343463354 2195 dbSNP
rs1301759839 2198 dbSNP
rs980839166 2199 dbSNP
rs186095397 2201 dbSNP
rs1403096363 2209 dbSNP
rs542624669 2215 dbSNP
rs1289907465 2216 dbSNP
rs751467130 2225 dbSNP
rs572054390 2235 dbSNP
rs1323183643 2238 dbSNP
rs1428674292 2239 dbSNP
rs1290474293 2241 dbSNP
rs956934791 2245 dbSNP
rs1390006310 2249 dbSNP
rs1254350915 2250 dbSNP
rs553579801 2253 dbSNP
rs1470730843 2258 dbSNP
rs893855754 2260 dbSNP
rs1031188423 2262 dbSNP
rs1406027325 2263 dbSNP
rs181740518 2280 dbSNP
rs1164284241 2285 dbSNP
rs1422602856 2308 dbSNP
rs924267210 2308 dbSNP
rs577671015 2314 dbSNP
rs943516471 2315 dbSNP
rs1441167577 2319 dbSNP
rs1296286243 2322 dbSNP
rs1380870734 2324 dbSNP
rs1254614646 2326 dbSNP
rs912041583 2328 dbSNP
rs1313653264 2332 dbSNP
rs1356664742 2334 dbSNP
rs571266574 2335 dbSNP
rs1052001004 2343 dbSNP
rs1438942728 2359 dbSNP
rs996602085 2367 dbSNP
rs899696592 2369 dbSNP
rs1231588358 2377 dbSNP
rs1484318902 2378 dbSNP
rs551829810 2386 dbSNP
rs941152731 2387 dbSNP
rs1442886873 2388 dbSNP
rs1170607664 2397 dbSNP
rs887039513 2402 dbSNP
rs74515658 2406 dbSNP
rs1046939494 2410 dbSNP
rs537279950 2418 dbSNP
rs1168055433 2419 dbSNP
rs1341709503 2422 dbSNP
rs939350198 2425 dbSNP
rs1275174290 2429 dbSNP
rs1230259445 2431 dbSNP
rs927982140 2438 dbSNP
rs973059962 2445 dbSNP
rs1335701412 2447 dbSNP
rs981295532 2457 dbSNP
rs72752461 2461 dbSNP
rs1340667924 2467 dbSNP
rs1214572753 2473 dbSNP
rs915433380 2477 dbSNP
rs1314328556 2482 dbSNP
rs750259652 2503 dbSNP
rs1380766771 2505 dbSNP
rs1295928086 2508 dbSNP
rs989625258 2511 dbSNP
rs1460187733 2519 dbSNP
rs1408908116 2524 dbSNP
rs764833495 2528 dbSNP
rs1031216330 2529 dbSNP
rs987738890 2538 dbSNP
rs1426950365 2546 dbSNP
rs1470154655 2548 dbSNP
rs1175495670 2552 dbSNP
rs533432011 2568 dbSNP
rs1458544789 2571 dbSNP
rs1021379848 2577 dbSNP
rs1325358092 2591 dbSNP
rs1430577882 2602 dbSNP
rs150253209 2609 dbSNP
rs1268963325 2620 dbSNP
rs1347977414 2622 dbSNP
rs1010877896 2630 dbSNP
rs1262972658 2632 dbSNP
rs536234989 2637 dbSNP
rs79630431 2639 dbSNP
rs1207124369 2642 dbSNP
rs776094891 2644 dbSNP
rs143980790 2668 dbSNP
rs1190888616 2669 dbSNP
rs899604893 2670 dbSNP
rs529214361 2671 dbSNP
rs1007591616 2688 dbSNP
rs1005398279 2712 dbSNP
rs1482854784 2715 dbSNP
rs770197599 2718 dbSNP
rs1473332855 2724 dbSNP
rs547476225 2729 dbSNP
rs115654013 2746 dbSNP
rs565251055 2748 dbSNP
rs1398419026 2750 dbSNP
rs1325005749 2758 dbSNP
rs549985781 2759 dbSNP
rs138030823 2763 dbSNP
rs1406165443 2765 dbSNP
rs1282965350 2767 dbSNP
rs906553943 2772 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             |::|||||   :|||||| 
Target 5' -ccAUGCCAUU---GCACUCCa 3'
1 - 18
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000375550.4 | 3UTR | CCAUGCCAUUGCACUCCAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*