miRTarBase - #MIRT662956 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol JPH2   
Synonyms CMH17, JP-2, JP2
Description junctophilin 2
Transcript NM_020433   
Other Transcripts NM_175913   
Expression
Putative miRNA Targets on JPH2
3'UTR of JPH2
(miRNA target sites are highlighted)
>JPH2|NM_020433|3'UTR
   1 CCGTCGCTTACCAGAGCCAGAAGTTCCTGCTGAGGACATGAGGACCCGTCTTTTTGCAGTGCCAGGCAGGGTGGCCAAAG
  81 AGGACTGGACTCTGGACCTGGAGCCCCGTGGTCCAGTTCACATTCACCCCACAAGAGTTTCAGGAGGCCTCCCACGGTGC
 161 CTGTGCTGGGTGGCGGTGGTGGTGCCAAGAGGAATGGAATGTCCTGGGCTCCTTCAGGAGCTCTCTACCCAGGGGCAAGG
 241 AGAGCCCAGAGAGAAGCGCCCTGGTCTCTTGAGCTTCCTGATCTGCTCCTGTCCCCCGCTCTCCTCCACTCCCTTGCCTT
 321 TCCCTAGGTTGTCCCCTCCCTGGGCTTTTGTGTGTTTTGGGAGATGTCACCTAACCAGGACATTGATATTCAATCCCATC
 401 CCCCTTCCTCCCACCCTGCCCCACTTTGATTTAATCCTTTGGCTGTGGGCTGAGGCCTCCCAGGGAAGCTGGGTGGGGTG
 481 GGTGTTGAGACCCCCTCAGACCAGCACAGAGACCTGTCCTTGTGCAGTCTGCACCCTGCACTCCCTCCCTTGCCTGTAGA
 561 TGTTCTGGATGACAGTAGAGGAAATGGACAAGGTCAGTTTGAATATCCCAGAACACAGTGCTCTGTCTCCTCCCACCAGT
 641 CCAGTTAGCTTCCCTTCTGGACCAATAGACGAGGGGAGACCCCATGGATCCTCTGGCTGGGAAGCCACTGACCAGGTGGC
 721 CAGGGGGCAGGGTGGGAAGAGGGGTTAAGGTGCAGTGATGATGGCCTGTTTTGGAGTGTGTCTGAGACTGGGATTGCATT
 801 TGGGGTTTCCCGTGTGCTTGGGATGCTAGAGGGTCACCTGCAGGAGGCCTGGGGCCGGCGAGAAATCTCCTGTGATGCCC
 881 TGTGAAATGGCTTGTCTCCTCCCCCATCAGGGCCCACCGAAAGCTCAGGGGAGCACAGAAGCCCATGGAAGCCCAGGGAG
 961 ATGTCCCTGGGGCAGACACTAAGGCAGGTGTTGAAGACAAGCTGCTTGTCAAGAAGCATTTCCCGGCAAGAGAGGGGCAA
1041 GTCTGGGGCTCCAACTGGGTACAGCCTGGGTGCAGTTATAAGCCCCTTTGGCTTACTTGGTAGAAGATGGCTACTTGGAT
1121 GTACCTCACTTAAAGATGTTTTGTACCACACTAGGTCTCTGGGCCCTTGTGCTTCCTGTGGGTGGGGTGAGGGCCAAAGG
1201 CTATGGTTTCCTGCCTCCAGGAGAATGGAGAGAAAGGGCTTCCAGGCCCCTCCAAGCCTGGGGAAGGACGTGGCATCCAA
1281 GCTGAGCCAGAGGGAACTGCTGCTGTCCTCCCTTCATTTCTGTGGACCTTGGAGGCTTTGGCTTTGTGGCAGGGCCTCCC
1361 CAGGCAGCTCTGGGACCTAGGAGTTTGCTTCTGATAGGGTCAGCTTTCCCATTTCCCTTCAATGCTTGGGAACCTTCTCC
1441 CTTAGCTTCACACTTGCCGTTTCAAGCCCTGCTGGGACCTTGTGGCTTGGCTGGAATCCAGGACTGTATTTTCATGGAGA
1521 AGAACCTGCAGATTCTTCCATCCTCAGCTGGCCATGGCCCACAGCTCTGCATCTGCATCTGAGCTTCTCAAGACTCCTGG
1601 AGCATGAGGGGAATGGGGCGGGGCCACTGCTCTGTGCTGACGGGCTCCGTCTCGGAGATTCTTGTCCTGTTTTTTTTCTG
1681 TTGTTTTTTTTTGGCTGGTGCTGGGGACAAGCCTGTGCCTGCCAAAGCTCCCAGGCCAAGTTTGGGGGCTGGTGTTTGGG
1761 GTTGGGTTTGGGGTTCAGGATGCTGCAGTCTGTGCAATAATAAACCCGCATCTGCTCACGGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :|||| |    :|||||| 
Target 5' tctGCACCCT----GCACTCCc 3'
528 - 545 133.00 -12.40
2
miRNA  3' guuuguGGUAACAGUGUGAGgu 5'
                ||| | |||||:||  
Target 5' cgtggtCCAGT-TCACATTCac 3'
107 - 127 123.00 -13.20
3
miRNA  3' guuuGUGGUAA-C--AGUGUGAGgu 5'
              | || || |  |||||||:  
Target 5' ccttCTCCCTTAGCTTCACACTTgc 3'
1433 - 1457 120.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1205558 3 ClinVar
391991 29 ClinVar
675764 138 ClinVar
1194687 187 ClinVar
1195211 187 ClinVar
1206466 273 ClinVar
1183492 1178 ClinVar
191667 1293 ClinVar
COSN23472793 20 COSMIC
COSN22356316 32 COSMIC
COSN19730896 48 COSMIC
COSN9129724 54 COSMIC
COSN23723059 186 COSMIC
COSN16765592 187 COSMIC
COSN9129723 326 COSMIC
COSN1249192 695 COSMIC
COSN5971735 905 COSMIC
COSN20565336 1046 COSMIC
COSN20719020 1122 COSMIC
COSN16439294 1181 COSMIC
COSN31961858 1452 COSMIC
COSN19079133 1462 COSMIC
COSN7999761 1575 COSMIC
COSN7999760 1630 COSMIC
COSN21647645 1654 COSMIC
COSN28392797 1872 COSMIC
COSN24685540 1944 COSMIC
COSN20116450 2001 COSMIC
COSN2527174 2582 COSMIC
COSN20933940 2763 COSMIC
COSN20116449 2961 COSMIC
rs116834259 1178 GWAS
rs6073330 5942 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759227844 1 dbSNP
rs376077213 2 dbSNP
rs200730588 3 dbSNP
rs1031089866 6 dbSNP
rs999223617 11 dbSNP
rs762339383 17 dbSNP
rs1443567212 22 dbSNP
rs777107778 26 dbSNP
rs1057524316 29 dbSNP
rs1360719565 31 dbSNP
rs1180889166 33 dbSNP
rs769338729 34 dbSNP
rs747470652 37 dbSNP
rs1210918448 39 dbSNP
rs1489520037 40 dbSNP
rs1289611186 41 dbSNP
rs1222031053 44 dbSNP
rs771979084 46 dbSNP
rs554873459 47 dbSNP
rs779070292 48 dbSNP
rs1333948285 49 dbSNP
rs960626729 59 dbSNP
rs1040184070 61 dbSNP
rs564910523 62 dbSNP
rs886493119 63 dbSNP
rs1048269919 68 dbSNP
rs868608883 74 dbSNP
rs920578917 75 dbSNP
rs1044658913 76 dbSNP
rs1191051715 90 dbSNP
rs1391340657 93 dbSNP
rs978334353 95 dbSNP
rs545223668 102 dbSNP
rs141788583 103 dbSNP
rs1022498081 104 dbSNP
rs754563265 105 dbSNP
rs1362446172 108 dbSNP
rs1344084547 111 dbSNP
rs1432327993 129 dbSNP
rs1299585572 131 dbSNP
rs1322399642 133 dbSNP
rs1319273133 137 dbSNP
rs115154926 138 dbSNP
rs1451596526 139 dbSNP
rs953717407 144 dbSNP
rs1404203828 148 dbSNP
rs1336248463 153 dbSNP
rs1229074783 159 dbSNP
rs1470383787 161 dbSNP
rs992974387 165 dbSNP
rs1360954874 166 dbSNP
rs956394595 168 dbSNP
rs1249145899 180 dbSNP
rs536749457 181 dbSNP
rs1428414666 182 dbSNP
rs1420780390 183 dbSNP
rs1190920719 184 dbSNP
rs1473366938 184 dbSNP
rs574044753 185 dbSNP
rs1242218641 186 dbSNP
rs967733727 186 dbSNP
rs1491581575 187 dbSNP
rs56170305 187 dbSNP
rs1199238212 189 dbSNP
rs1268826376 189 dbSNP
rs398040671 189 dbSNP
rs1203890422 190 dbSNP
rs1181548607 191 dbSNP
rs1231918520 191 dbSNP
rs964619621 191 dbSNP
rs867623924 193 dbSNP
rs1006129085 195 dbSNP
rs1412025436 195 dbSNP
rs1019201973 200 dbSNP
rs1008766999 204 dbSNP
rs796876146 206 dbSNP
rs1170730083 208 dbSNP
rs1404285935 210 dbSNP
rs1414784607 211 dbSNP
rs1203159727 216 dbSNP
rs1327963413 218 dbSNP
rs1368527126 221 dbSNP
rs1411864116 222 dbSNP
rs1289290684 223 dbSNP
rs888606970 225 dbSNP
rs1299658270 226 dbSNP
rs1044481380 227 dbSNP
rs948823281 228 dbSNP
rs1243507348 229 dbSNP
rs1346369406 229 dbSNP
rs1381765033 230 dbSNP
rs112280608 231 dbSNP
rs1196169785 231 dbSNP
rs1206851332 231 dbSNP
rs1227305984 231 dbSNP
rs1252164494 231 dbSNP
rs1274832230 231 dbSNP
rs1308799532 231 dbSNP
rs1331804481 231 dbSNP
rs1365189481 231 dbSNP
rs1379247590 231 dbSNP
rs138730859 231 dbSNP
rs1388083199 231 dbSNP
rs1431457836 231 dbSNP
rs1450481614 231 dbSNP
rs1478301797 231 dbSNP
rs1484264907 231 dbSNP
rs3037626 231 dbSNP
rs398035759 231 dbSNP
rs58575408 231 dbSNP
rs60547209 231 dbSNP
rs747015843 231 dbSNP
rs748796237 231 dbSNP
rs1491319545 232 dbSNP
rs1491174341 233 dbSNP
rs1268798524 235 dbSNP
rs1396808311 235 dbSNP
rs1451741996 235 dbSNP
rs1381486139 237 dbSNP
rs1246126524 253 dbSNP
rs1451023803 254 dbSNP
rs886269916 262 dbSNP
rs1296559789 267 dbSNP
rs1461492026 271 dbSNP
rs565720270 273 dbSNP
rs2867794 283 dbSNP
rs1423192114 289 dbSNP
rs1319062512 290 dbSNP
rs899187039 299 dbSNP
rs1044354187 318 dbSNP
rs923895890 319 dbSNP
rs1314768082 322 dbSNP
rs191207499 326 dbSNP
rs187856842 336 dbSNP
rs754353484 346 dbSNP
rs985269041 347 dbSNP
rs934867038 349 dbSNP
rs1466218635 351 dbSNP
rs924759363 353 dbSNP
rs1255180543 362 dbSNP
rs569407326 363 dbSNP
rs1029378209 378 dbSNP
rs1369285647 380 dbSNP
rs764515463 383 dbSNP
rs1456712531 387 dbSNP
rs1157076604 390 dbSNP
rs976453914 393 dbSNP
rs760869710 394 dbSNP
rs1176140656 395 dbSNP
rs1377412089 397 dbSNP
rs1398167235 410 dbSNP
rs974372398 411 dbSNP
rs549418181 412 dbSNP
rs961064895 414 dbSNP
rs538689581 417 dbSNP
rs1227195959 425 dbSNP
rs529748268 432 dbSNP
rs560693371 433 dbSNP
rs987778262 436 dbSNP
rs1255402296 452 dbSNP
rs1292195559 466 dbSNP
rs950611261 469 dbSNP
rs1201967279 475 dbSNP
rs571767965 478 dbSNP
rs747507963 479 dbSNP
rs1180341297 484 dbSNP
rs1057145151 495 dbSNP
rs547398184 496 dbSNP
rs1305051654 497 dbSNP
rs1357931229 504 dbSNP
rs1467861646 514 dbSNP
rs1303811265 518 dbSNP
rs1390958692 521 dbSNP
rs934692464 523 dbSNP
rs903171785 551 dbSNP
rs1286146817 568 dbSNP
rs148471283 570 dbSNP
rs1228486368 571 dbSNP
rs1042721575 574 dbSNP
rs1300425369 578 dbSNP
rs1310399604 581 dbSNP
rs368327943 586 dbSNP
rs565226327 592 dbSNP
rs1365461944 597 dbSNP
rs1482644727 597 dbSNP
rs759712887 599 dbSNP
rs1483383608 600 dbSNP
rs1459716741 602 dbSNP
rs1423620706 607 dbSNP
rs1435399319 614 dbSNP
rs1177480445 621 dbSNP
rs184687169 627 dbSNP
rs774667178 628 dbSNP
rs1305736084 629 dbSNP
rs1372027211 630 dbSNP
rs985293587 631 dbSNP
rs1292456785 639 dbSNP
rs1364926937 643 dbSNP
rs755396016 656 dbSNP
rs1419215884 667 dbSNP
rs1301966277 678 dbSNP
rs1253319866 696 dbSNP
rs932470115 701 dbSNP
rs1276984702 711 dbSNP
rs1490176217 713 dbSNP
rs770863978 720 dbSNP
rs146249580 723 dbSNP
rs934879132 732 dbSNP
rs903369816 735 dbSNP
rs6130533 737 dbSNP
rs749025976 759 dbSNP
rs562683762 761 dbSNP
rs1170910855 763 dbSNP
rs1391582187 766 dbSNP
rs1163717168 781 dbSNP
rs1043207784 786 dbSNP
rs559982237 790 dbSNP
rs1015276278 792 dbSNP
rs1259240161 798 dbSNP
rs1238572067 799 dbSNP
rs1329972130 801 dbSNP
rs1290325084 802 dbSNP
rs1221710866 804 dbSNP
rs56045951 810 dbSNP
rs1326417586 817 dbSNP
rs550079429 818 dbSNP
rs974488316 822 dbSNP
rs553856955 829 dbSNP
rs1299516678 830 dbSNP
rs1362443493 832 dbSNP
rs1227958844 837 dbSNP
rs1288066807 840 dbSNP
rs1323523102 841 dbSNP
rs943073674 843 dbSNP
rs1383247105 849 dbSNP
rs1268011118 854 dbSNP
rs1287977056 857 dbSNP
rs1463954564 861 dbSNP
rs1191108199 873 dbSNP
rs1249030229 880 dbSNP
rs1472707485 886 dbSNP
rs747742091 893 dbSNP
rs1406556783 895 dbSNP
rs1165033223 897 dbSNP
rs1263966554 901 dbSNP
rs141775792 902 dbSNP
rs895982894 911 dbSNP
rs1173669001 923 dbSNP
rs7274414 927 dbSNP
rs13039568 930 dbSNP
rs1282579681 931 dbSNP
rs372186134 934 dbSNP
rs1190802259 940 dbSNP
rs558474276 942 dbSNP
rs998933858 945 dbSNP
rs1287787233 948 dbSNP
rs903244646 949 dbSNP
rs1200895332 957 dbSNP
rs1043076857 961 dbSNP
rs1442137154 963 dbSNP
rs1445113444 989 dbSNP
rs6130532 990 dbSNP
rs112845697 991 dbSNP
rs73908563 997 dbSNP
rs893765956 1004 dbSNP
rs755815738 1008 dbSNP
rs1465531773 1017 dbSNP
rs950671730 1019 dbSNP
rs1270185376 1020 dbSNP
rs1161215772 1021 dbSNP
rs1049662697 1023 dbSNP
rs187218891 1033 dbSNP
rs1322911663 1034 dbSNP
rs1360734794 1035 dbSNP
rs1415594852 1036 dbSNP
rs973241461 1041 dbSNP
rs963177035 1065 dbSNP
rs1230307235 1085 dbSNP
rs1325093216 1094 dbSNP
rs1295356264 1104 dbSNP
rs1344947071 1110 dbSNP
rs1218028188 1113 dbSNP
rs1041252904 1114 dbSNP
rs1486240173 1117 dbSNP
rs1023026946 1121 dbSNP
rs112602806 1122 dbSNP
rs960080130 1128 dbSNP
rs1036075327 1130 dbSNP
rs549187622 1135 dbSNP
rs1170791397 1136 dbSNP
rs1468884074 1137 dbSNP
rs368770003 1138 dbSNP
rs1435116740 1148 dbSNP
rs1402264230 1152 dbSNP
rs1043321153 1154 dbSNP
rs1168123323 1166 dbSNP
rs916198722 1167 dbSNP
rs991690619 1168 dbSNP
rs535922197 1170 dbSNP
rs183102706 1171 dbSNP
rs1329593510 1173 dbSNP
rs1330635409 1175 dbSNP
rs1434936985 1176 dbSNP
rs116834259 1178 dbSNP
rs530264670 1183 dbSNP
rs999402404 1184 dbSNP
rs967489299 1201 dbSNP
rs746682467 1204 dbSNP
rs571160435 1207 dbSNP
rs1197235838 1215 dbSNP
rs943085518 1217 dbSNP
rs1011609821 1218 dbSNP
rs911582744 1224 dbSNP
rs867109418 1228 dbSNP
rs1049696996 1230 dbSNP
rs1451026479 1232 dbSNP
rs1250208758 1233 dbSNP
rs1388138269 1238 dbSNP
rs373715958 1239 dbSNP
rs531657090 1240 dbSNP
rs1168777301 1244 dbSNP
rs901060301 1254 dbSNP
rs1040891011 1255 dbSNP
rs562642617 1260 dbSNP
rs542868150 1262 dbSNP
rs939812001 1266 dbSNP
rs908326654 1271 dbSNP
rs1048611070 1277 dbSNP
rs931008872 1281 dbSNP
rs1251590758 1283 dbSNP
rs1251176654 1285 dbSNP
rs548773116 1289 dbSNP
rs561604738 1293 dbSNP
rs1274918335 1304 dbSNP
rs1468842455 1305 dbSNP
rs1187892047 1311 dbSNP
rs1245955569 1316 dbSNP
rs1430142804 1318 dbSNP
rs963209103 1320 dbSNP
rs991093484 1321 dbSNP
rs779621273 1323 dbSNP
rs560673878 1325 dbSNP
rs991606176 1326 dbSNP
rs1319216751 1327 dbSNP
rs960360159 1339 dbSNP
rs1383129597 1341 dbSNP
rs1295795014 1343 dbSNP
rs1339529196 1349 dbSNP
rs1242220753 1373 dbSNP
rs1035702840 1376 dbSNP
rs192849698 1385 dbSNP
rs967369823 1386 dbSNP
rs540263584 1389 dbSNP
rs1335659826 1400 dbSNP
rs1266177705 1419 dbSNP
rs1021910071 1426 dbSNP
rs1486686982 1426 dbSNP
rs577920256 1433 dbSNP
rs557876933 1434 dbSNP
rs541405303 1435 dbSNP
rs1021737780 1441 dbSNP
rs1431468071 1446 dbSNP
rs1383118665 1451 dbSNP
rs1472339765 1452 dbSNP
rs77861816 1453 dbSNP
rs138657243 1462 dbSNP
rs1454585398 1463 dbSNP
rs1029011566 1480 dbSNP
rs1238224955 1487 dbSNP
rs997482761 1490 dbSNP
rs901093500 1491 dbSNP
rs1189707299 1497 dbSNP
rs1051517381 1512 dbSNP
rs1355473430 1513 dbSNP
rs928995403 1516 dbSNP
rs1286341671 1517 dbSNP
rs1019947839 1520 dbSNP
rs535692174 1522 dbSNP
rs1004084066 1524 dbSNP
rs1482192022 1528 dbSNP
rs897481039 1533 dbSNP
rs886929209 1534 dbSNP
rs1037592752 1535 dbSNP
rs13043824 1536 dbSNP
rs756551671 1542 dbSNP
rs1344821817 1549 dbSNP
rs1482745452 1554 dbSNP
rs931085494 1567 dbSNP
rs1420171989 1571 dbSNP
rs894202309 1572 dbSNP
rs915747872 1575 dbSNP
rs1209786447 1576 dbSNP
rs991697651 1579 dbSNP
rs1285531994 1584 dbSNP
rs928935140 1585 dbSNP
rs1439465611 1589 dbSNP
rs1374938910 1590 dbSNP
rs577213804 1591 dbSNP
rs1334655820 1595 dbSNP
rs1391892917 1596 dbSNP
rs62205900 1601 dbSNP
rs946256819 1603 dbSNP
rs914743560 1604 dbSNP
rs1341695123 1611 dbSNP
rs928750887 1613 dbSNP
rs767516459 1618 dbSNP
rs1363583865 1632 dbSNP
rs373874882 1635 dbSNP
rs1162726750 1639 dbSNP
rs1265885967 1666 dbSNP
rs1455823944 1667 dbSNP
rs187930451 1668 dbSNP
rs551414672 1671 dbSNP
rs1165221830 1675 dbSNP
rs6073333 1682 dbSNP
rs976121916 1686 dbSNP
rs1355763789 1691 dbSNP
rs1462065264 1692 dbSNP
rs1292807230 1693 dbSNP
rs1368725562 1727 dbSNP
rs1443073325 1734 dbSNP
rs45602132 1743 dbSNP
rs6130531 1747 dbSNP
rs1018455260 1751 dbSNP
rs1275397693 1752 dbSNP
rs796910142 1757 dbSNP
rs766707029 1759 dbSNP
rs1484342127 1766 dbSNP
rs1267305644 1768 dbSNP
rs1221315557 1769 dbSNP
rs1452537396 1770 dbSNP
rs762897380 1775 dbSNP
rs1008849489 1777 dbSNP
rs1448116312 1779 dbSNP
rs1221684303 1781 dbSNP
rs1349389930 1785 dbSNP
rs891274045 1794 dbSNP
rs1288451597 1805 dbSNP
rs1391696328 1810 dbSNP
rs549188803 1815 dbSNP
rs529131498 1817 dbSNP
rs1387562550 1820 dbSNP
rs1055460956 1838 dbSNP
rs1272103777 1855 dbSNP
rs1228013681 1856 dbSNP
rs938377647 1856 dbSNP
rs560092160 1861 dbSNP
rs897513650 1864 dbSNP
rs540680980 1865 dbSNP
rs1436997761 1870 dbSNP
rs1041357051 1879 dbSNP
rs1037289468 1881 dbSNP
rs1351378045 1887 dbSNP
rs1218425959 1910 dbSNP
rs1243101583 1917 dbSNP
rs1485971382 1935 dbSNP
rs1385830895 1944 dbSNP
rs572393993 1945 dbSNP
rs946304918 1948 dbSNP
rs941960393 1951 dbSNP
rs1160011016 1952 dbSNP
rs1175446096 1962 dbSNP
rs1411187069 1977 dbSNP
rs894417479 1990 dbSNP
rs1398687749 1991 dbSNP
rs182960889 1991 dbSNP
rs938538324 1996 dbSNP
rs1427887907 1999 dbSNP
rs200803678 2000 dbSNP
rs199808276 2001 dbSNP
rs66692327 2001 dbSNP
rs11482166 2002 dbSNP
rs72532598 2003 dbSNP
rs201482285 2006 dbSNP
rs750637707 2006 dbSNP
rs771973296 2006 dbSNP
rs1357385932 2009 dbSNP
rs189836776 2013 dbSNP
rs1214027563 2019 dbSNP
rs1288231139 2021 dbSNP
rs928475512 2022 dbSNP
rs1268292777 2023 dbSNP
rs977517046 2025 dbSNP
rs1285385494 2028 dbSNP
rs1312034661 2030 dbSNP
rs575523148 2031 dbSNP
rs966095265 2032 dbSNP
rs1015360073 2034 dbSNP
rs946091865 2036 dbSNP
rs186566462 2042 dbSNP
rs1250490829 2043 dbSNP
rs759771045 2052 dbSNP
rs1369584231 2078 dbSNP
rs183251499 2086 dbSNP
rs74173187 2089 dbSNP
rs1018983593 2090 dbSNP
rs958517304 2091 dbSNP
rs1415426818 2092 dbSNP
rs1334124298 2095 dbSNP
rs1034083687 2096 dbSNP
rs45453697 2098 dbSNP
rs1367260890 2107 dbSNP
rs1321453842 2108 dbSNP
rs566906377 2127 dbSNP
rs1403959744 2133 dbSNP
rs748062788 2134 dbSNP
rs1025773024 2135 dbSNP
rs34119946 2137 dbSNP
rs571279601 2140 dbSNP
rs557769075 2150 dbSNP
rs893430358 2151 dbSNP
rs1054706914 2152 dbSNP
rs1427818782 2155 dbSNP
rs1185144777 2157 dbSNP
rs897551078 2164 dbSNP
rs911398993 2172 dbSNP
rs45451396 2176 dbSNP
rs1435563477 2177 dbSNP
rs1005866015 2180 dbSNP
rs894139026 2182 dbSNP
rs1056150475 2183 dbSNP
rs936947759 2184 dbSNP
rs1411731650 2185 dbSNP
rs1330094989 2188 dbSNP
rs1190104298 2189 dbSNP
rs1439399096 2190 dbSNP
rs1002758147 2193 dbSNP
rs1459631250 2195 dbSNP
rs1254929523 2196 dbSNP
rs7263113 2197 dbSNP
rs1313889051 2204 dbSNP
rs1269242764 2206 dbSNP
rs1194015331 2207 dbSNP
rs1336804064 2211 dbSNP
rs1197073406 2223 dbSNP
rs1273577023 2225 dbSNP
rs779746756 2235 dbSNP
rs773701622 2251 dbSNP
rs1254631819 2252 dbSNP
rs1454556733 2253 dbSNP
rs1192656498 2255 dbSNP
rs946124655 2257 dbSNP
rs914686756 2261 dbSNP
rs1227469033 2269 dbSNP
rs1371586075 2270 dbSNP
rs1054544136 2283 dbSNP
rs761931941 2295 dbSNP
rs1298660999 2300 dbSNP
rs553760614 2302 dbSNP
rs749694014 2303 dbSNP
rs942732259 2308 dbSNP
rs1390157001 2312 dbSNP
rs1377186836 2313 dbSNP
rs535394333 2321 dbSNP
rs6065705 2322 dbSNP
rs1395599636 2326 dbSNP
rs973941785 2327 dbSNP
rs1324349644 2332 dbSNP
rs149482563 2335 dbSNP
rs756453161 2351 dbSNP
rs1333586254 2357 dbSNP
rs3830811 2358 dbSNP
rs918769120 2378 dbSNP
rs972905418 2386 dbSNP
rs962832446 2391 dbSNP
rs1274976098 2392 dbSNP
rs1468716905 2405 dbSNP
rs1016006095 2414 dbSNP
rs1204354022 2416 dbSNP
rs1259457044 2431 dbSNP
rs1448924834 2435 dbSNP
rs1002674753 2438 dbSNP
rs533451511 2462 dbSNP
rs1391151876 2464 dbSNP
rs1194247902 2465 dbSNP
rs1005961446 2485 dbSNP
rs1490468633 2492 dbSNP
rs1170825713 2504 dbSNP
rs958622787 2514 dbSNP
rs868473124 2521 dbSNP
rs1474275747 2522 dbSNP
rs1167646695 2525 dbSNP
rs1254970583 2525 dbSNP
rs1419249508 2531 dbSNP
rs1457003142 2534 dbSNP
rs1157174609 2540 dbSNP
rs1387649693 2542 dbSNP
rs564281142 2547 dbSNP
rs80089799 2548 dbSNP
rs1354194604 2552 dbSNP
rs1412414876 2554 dbSNP
rs907087699 2556 dbSNP
rs1204313027 2557 dbSNP
rs1335369187 2560 dbSNP
rs1041641911 2566 dbSNP
rs150285701 2576 dbSNP
rs892794801 2578 dbSNP
rs1205883869 2580 dbSNP
rs1243445305 2581 dbSNP
rs1054736226 2593 dbSNP
rs775585676 2598 dbSNP
rs1258382911 2603 dbSNP
rs892968246 2612 dbSNP
rs1396732306 2613 dbSNP
rs561757780 2616 dbSNP
rs1054553924 2624 dbSNP
rs1157644134 2627 dbSNP
rs1306757707 2628 dbSNP
rs1365848092 2633 dbSNP
rs1454631843 2634 dbSNP
rs942762500 2639 dbSNP
rs1158830582 2641 dbSNP
rs1040953273 2644 dbSNP
rs1432533352 2649 dbSNP
rs1314146839 2652 dbSNP
rs1355614028 2658 dbSNP
rs780594693 2659 dbSNP
rs1304804411 2661 dbSNP
rs1337242661 2666 dbSNP
rs1239543323 2670 dbSNP
rs1279821767 2671 dbSNP
rs907993524 2671 dbSNP
rs1213345918 2674 dbSNP
rs1281127163 2688 dbSNP
rs768004989 2690 dbSNP
rs1423071064 2695 dbSNP
rs1051077648 2711 dbSNP
rs1165034877 2717 dbSNP
rs1425081256 2735 dbSNP
rs1055716 2737 dbSNP
rs1452178958 2748 dbSNP
rs751678194 2750 dbSNP
rs190644014 2752 dbSNP
rs573483375 2758 dbSNP
rs917885715 2767 dbSNP
rs991320196 2773 dbSNP
rs1180765606 2784 dbSNP
rs1175187234 2786 dbSNP
rs1359179803 2786 dbSNP
rs1461050719 2791 dbSNP
rs959440075 2791 dbSNP
rs1483359220 2798 dbSNP
rs930667706 2799 dbSNP
rs1253800821 2805 dbSNP
rs1447492221 2808 dbSNP
rs1302381060 2814 dbSNP
rs918864210 2820 dbSNP
rs972957692 2822 dbSNP
rs1368602196 2823 dbSNP
rs1219987777 2831 dbSNP
rs1304442417 2838 dbSNP
rs1306948147 2840 dbSNP
rs1202547057 2842 dbSNP
rs1253191958 2847 dbSNP
rs1481227544 2851 dbSNP
rs1213693036 2861 dbSNP
rs920611704 2866 dbSNP
rs1455865849 2868 dbSNP
rs2294893 2869 dbSNP
rs958623179 2877 dbSNP
rs1427360581 2878 dbSNP
rs1167677370 2879 dbSNP
rs1374340307 2880 dbSNP
rs546111974 2881 dbSNP
rs549171308 2882 dbSNP
rs1265145449 2883 dbSNP
rs1055727 2885 dbSNP
rs981720584 2897 dbSNP
rs984948609 2898 dbSNP
rs971246563 2901 dbSNP
rs958456514 2904 dbSNP
rs1034441751 2905 dbSNP
rs988561509 2907 dbSNP
rs2294892 2911 dbSNP
rs537941489 2919 dbSNP
rs1385522101 2920 dbSNP
rs1470075327 2921 dbSNP
rs995810413 2923 dbSNP
rs1241948845 2926 dbSNP
rs140614308 2927 dbSNP
rs555416770 2931 dbSNP
rs892979399 2932 dbSNP
rs886589606 2939 dbSNP
rs1032823904 2943 dbSNP
rs34525185 2948 dbSNP
rs1415604988 2951 dbSNP
rs1462992139 2954 dbSNP
rs1048336362 2956 dbSNP
rs550734028 2956 dbSNP
rs771929096 2957 dbSNP
rs111307614 2961 dbSNP
rs1291923734 2962 dbSNP
rs3215550 2962 dbSNP
rs532124780 2962 dbSNP
rs564918986 2971 dbSNP
rs71337853 2971 dbSNP
rs889907408 2972 dbSNP
rs950663194 2980 dbSNP
rs1026661468 2986 dbSNP
rs6031396 2991 dbSNP
rs535713315 3005 dbSNP
rs930739678 3008 dbSNP
rs1488301830 3009 dbSNP
rs1489593731 3013 dbSNP
rs566687796 3014 dbSNP
rs897154474 3017 dbSNP
rs1208256865 3026 dbSNP
rs1037253343 3038 dbSNP
rs1055050676 3040 dbSNP
rs1329930106 3040 dbSNP
rs1182432747 3044 dbSNP
rs938010823 3045 dbSNP
rs941575764 3053 dbSNP
rs1330983026 3058 dbSNP
rs910070145 3061 dbSNP
rs1302448446 3063 dbSNP
rs1388820981 3064 dbSNP
rs1434392010 3070 dbSNP
rs147949985 3075 dbSNP
rs539303494 3085 dbSNP
rs927085702 3086 dbSNP
rs1457370820 3092 dbSNP
rs186853797 3095 dbSNP
rs560120415 3097 dbSNP
rs971062808 3098 dbSNP
rs1465514145 3102 dbSNP
rs1378070340 3104 dbSNP
rs1287244464 3106 dbSNP
rs1200754208 3117 dbSNP
rs913084175 3122 dbSNP
rs989022262 3123 dbSNP
rs550622249 3125 dbSNP
rs6031395 3128 dbSNP
rs561721038 3137 dbSNP
rs1232264498 3139 dbSNP
rs371333370 3154 dbSNP
rs1178704362 3157 dbSNP
rs1380727123 3164 dbSNP
rs1453991604 3169 dbSNP
rs1172074303 3179 dbSNP
rs1377296724 3181 dbSNP
rs1188134011 3182 dbSNP
rs974446019 3186 dbSNP
rs1353243333 3196 dbSNP
rs964368099 3202 dbSNP
rs548324484 3203 dbSNP
rs6031394 3206 dbSNP
rs1233034747 3207 dbSNP
rs1300807759 3210 dbSNP
rs1346454059 3212 dbSNP
rs1344928552 3214 dbSNP
rs1033330755 3215 dbSNP
rs1435978349 3224 dbSNP
rs1200525791 3227 dbSNP
rs1257039217 3228 dbSNP
rs1235959839 3230 dbSNP
rs1006749106 3231 dbSNP
rs889616225 3235 dbSNP
rs1029781246 3236 dbSNP
rs1467881542 3240 dbSNP
rs562822661 3249 dbSNP
rs1296464583 3253 dbSNP
rs1435330253 3267 dbSNP
rs766382738 3283 dbSNP
rs897164545 3292 dbSNP
rs1417539130 3298 dbSNP
rs1412116651 3307 dbSNP
rs1332643363 3317 dbSNP
rs768632520 3317 dbSNP
rs375290784 3331 dbSNP
rs1323419313 3343 dbSNP
rs1038665503 3361 dbSNP
rs1332442307 3362 dbSNP
rs1036969251 3365 dbSNP
rs1269075216 3367 dbSNP
rs1336951121 3372 dbSNP
rs1331634665 3374 dbSNP
rs1394892634 3380 dbSNP
rs1220330163 3384 dbSNP
rs1333834866 3387 dbSNP
rs899294973 3388 dbSNP
rs114560127 3389 dbSNP
rs938041831 3393 dbSNP
rs906517304 3394 dbSNP
rs888725528 3398 dbSNP
rs6031393 3399 dbSNP
rs950011307 3407 dbSNP
rs938229719 3410 dbSNP
rs1460382601 3415 dbSNP
rs1167512106 3429 dbSNP
rs1391988779 3433 dbSNP
rs1389298309 3435 dbSNP
rs913107007 3457 dbSNP
rs1168938637 3475 dbSNP
rs928089948 3483 dbSNP
rs981219297 3484 dbSNP
rs949761288 3488 dbSNP
rs912916670 3500 dbSNP
rs1450359414 3501 dbSNP
rs1231445688 3502 dbSNP
rs146898970 3505 dbSNP
rs1266973792 3507 dbSNP
rs1243992654 3516 dbSNP
rs879639162 3517 dbSNP
rs1282458791 3519 dbSNP
rs988506640 3522 dbSNP
rs1441903967 3524 dbSNP
rs1194450708 3527 dbSNP
rs142575195 3527 dbSNP
rs1202664965 3528 dbSNP
rs6031392 3531 dbSNP
rs985773753 3532 dbSNP
rs953910487 3535 dbSNP
rs1229513921 3547 dbSNP
rs1382358370 3555 dbSNP
rs1421196438 3564 dbSNP
rs561089235 3568 dbSNP
rs181329740 3569 dbSNP
rs998243006 3577 dbSNP
rs577153270 3585 dbSNP
rs961412848 3587 dbSNP
rs1412791160 3596 dbSNP
rs147717551 3599 dbSNP
rs368747134 3600 dbSNP
rs987507081 3601 dbSNP
rs950997448 3602 dbSNP
rs924574101 3603 dbSNP
rs1217709404 3607 dbSNP
rs1186922250 3608 dbSNP
rs1340518052 3615 dbSNP
rs1484740572 3622 dbSNP
rs771532729 3633 dbSNP
rs535146111 3636 dbSNP
rs963499435 3640 dbSNP
rs1407947830 3649 dbSNP
rs1005530424 3651 dbSNP
rs1418817595 3654 dbSNP
rs1308415090 3663 dbSNP
rs573089682 3669 dbSNP
rs1421988785 3670 dbSNP
rs542851772 3673 dbSNP
rs868509435 3679 dbSNP
rs745542565 3681 dbSNP
rs1374252020 3685 dbSNP
rs1304465603 3686 dbSNP
rs1464130647 3686 dbSNP
rs572344244 3691 dbSNP
rs1390787588 3694 dbSNP
rs552945974 3699 dbSNP
rs1378913111 3704 dbSNP
rs906723425 3710 dbSNP
rs1302959341 3711 dbSNP
rs539358660 3712 dbSNP
rs1480904531 3716 dbSNP
rs6130530 3717 dbSNP
rs770527592 3719 dbSNP
rs1480577118 3722 dbSNP
rs945516386 3726 dbSNP
rs1439918463 3728 dbSNP
rs1287353092 3729 dbSNP
rs1240347320 3735 dbSNP
rs913009994 3749 dbSNP
rs1052854325 3754 dbSNP
rs1458495839 3756 dbSNP
rs1178821147 3759 dbSNP
rs1394123746 3761 dbSNP
rs1356552204 3766 dbSNP
rs1285482368 3779 dbSNP
rs1225972052 3786 dbSNP
rs1177565406 3787 dbSNP
rs891752664 3793 dbSNP
rs6031391 3794 dbSNP
rs1329245764 3798 dbSNP
rs577608659 3799 dbSNP
rs925793453 3802 dbSNP
rs1325419133 3808 dbSNP
rs537128956 3811 dbSNP
rs568246006 3812 dbSNP
rs1225806967 3813 dbSNP
rs6031390 3817 dbSNP
rs919536946 3819 dbSNP
rs1391669583 3825 dbSNP
rs6073332 3827 dbSNP
rs973606578 3831 dbSNP
rs1487293595 3834 dbSNP
rs6073331 3835 dbSNP
rs1427421120 3836 dbSNP
rs1411966167 3839 dbSNP
rs1183499294 3841 dbSNP
rs963574591 3843 dbSNP
rs1425725655 3844 dbSNP
rs566066409 3853 dbSNP
rs552552113 3854 dbSNP
rs1033822122 3862 dbSNP
rs1221248207 3863 dbSNP
rs1451826950 3868 dbSNP
rs1002750707 3871 dbSNP
rs1361303725 3879 dbSNP
rs745508177 3889 dbSNP
rs1206345289 3907 dbSNP
rs961175627 3909 dbSNP
rs1015668395 3912 dbSNP
rs532870720 3925 dbSNP
rs189981532 3938 dbSNP
rs1009605648 3942 dbSNP
rs1323883415 3943 dbSNP
rs544058414 3963 dbSNP
rs1223236579 3964 dbSNP
rs1365340161 3965 dbSNP
rs1265685499 3966 dbSNP
rs866043155 3968 dbSNP
rs892451421 3971 dbSNP
rs530612304 3976 dbSNP
rs1478097116 3982 dbSNP
rs374772017 3982 dbSNP
rs1187148424 3983 dbSNP
rs1331961022 3985 dbSNP
rs1406903583 3986 dbSNP
rs1165706209 3989 dbSNP
rs1344800179 3999 dbSNP
rs1002474795 4002 dbSNP
rs1418156464 4005 dbSNP
rs758498949 4007 dbSNP
rs561680212 4013 dbSNP
rs906809217 4014 dbSNP
rs541912911 4016 dbSNP
rs1000124880 4017 dbSNP
rs1282957834 4018 dbSNP
rs750624583 4024 dbSNP
rs1229280365 4032 dbSNP
rs1038887687 4035 dbSNP
rs1455751541 4038 dbSNP
rs1387973734 4042 dbSNP
rs943193205 4057 dbSNP
rs1159941119 4065 dbSNP
rs1009778689 4066 dbSNP
rs1210014698 4068 dbSNP
rs1235696877 4069 dbSNP
rs1402984732 4078 dbSNP
rs892631086 4079 dbSNP
rs1423603810 4083 dbSNP
rs1051937638 4088 dbSNP
rs1160687951 4090 dbSNP
rs1380934718 4093 dbSNP
rs1434206978 4095 dbSNP
rs1332725982 4097 dbSNP
rs572710573 4101 dbSNP
rs1297948544 4116 dbSNP
rs1375227453 4117 dbSNP
rs1254564415 4121 dbSNP
rs1311032817 4127 dbSNP
rs1353756062 4129 dbSNP
rs1218101374 4134 dbSNP
rs1052864228 4135 dbSNP
rs1186245203 4141 dbSNP
rs552950924 4150 dbSNP
rs1464087618 4158 dbSNP
rs935709579 4163 dbSNP
rs545666396 4165 dbSNP
rs765432580 4177 dbSNP
rs1248127011 4180 dbSNP
rs929010845 4181 dbSNP
rs1232027953 4183 dbSNP
rs1456287364 4185 dbSNP
rs918941225 4192 dbSNP
rs1217255380 4193 dbSNP
rs1381183924 4195 dbSNP
rs1454028720 4197 dbSNP
rs1310369181 4198 dbSNP
rs973015066 4201 dbSNP
rs576757604 4205 dbSNP
rs763982383 4205 dbSNP
rs556725270 4208 dbSNP
rs1398500923 4210 dbSNP
rs536883247 4212 dbSNP
rs922532396 4215 dbSNP
rs186255404 4222 dbSNP
rs926838720 4222 dbSNP
rs961226044 4223 dbSNP
rs13040293 4224 dbSNP
rs984190310 4225 dbSNP
rs1321307151 4227 dbSNP
rs764060990 4235 dbSNP
rs952880387 4238 dbSNP
rs1432908215 4257 dbSNP
rs1315790753 4279 dbSNP
rs1200267818 4285 dbSNP
rs1033757445 4286 dbSNP
rs1025088991 4295 dbSNP
rs1175969434 4306 dbSNP
rs1248457239 4314 dbSNP
rs1478412244 4315 dbSNP
rs1186407841 4326 dbSNP
rs535126883 4335 dbSNP
rs1415443570 4340 dbSNP
rs988615304 4341 dbSNP
rs956744877 4344 dbSNP
rs1167043960 4346 dbSNP
rs75072398 4355 dbSNP
rs565900522 4361 dbSNP
rs970751633 4363 dbSNP
rs1032349509 4365 dbSNP
rs1332270640 4366 dbSNP
rs1448528263 4367 dbSNP
rs1025266043 4368 dbSNP
rs1258458808 4368 dbSNP
rs1436612177 4368 dbSNP
rs540122856 4368 dbSNP
rs565611766 4368 dbSNP
rs76182424 4368 dbSNP
rs796392895 4368 dbSNP
rs1009788432 4369 dbSNP
rs1248187148 4370 dbSNP
rs1292333971 4371 dbSNP
rs1452453894 4372 dbSNP
rs904477535 4382 dbSNP
rs1261201835 4391 dbSNP
rs892641095 4400 dbSNP
rs1481988721 4441 dbSNP
rs1368200220 4443 dbSNP
rs1472027920 4444 dbSNP
rs1236878549 4445 dbSNP
rs181011498 4454 dbSNP
rs1405642322 4458 dbSNP
rs1297026279 4459 dbSNP
rs890267454 4461 dbSNP
rs1051581502 4464 dbSNP
rs1339613942 4465 dbSNP
rs532833209 4471 dbSNP
rs929061274 4475 dbSNP
rs1285787230 4479 dbSNP
rs1357308503 4481 dbSNP
rs999961651 4494 dbSNP
rs570396794 4504 dbSNP
rs904298729 4515 dbSNP
rs1216251362 4518 dbSNP
rs550395310 4522 dbSNP
rs1283893218 4524 dbSNP
rs12329575 4525 dbSNP
rs932346414 4528 dbSNP
rs558481077 4534 dbSNP
rs374504379 4535 dbSNP
rs148522227 4544 dbSNP
rs939919363 4548 dbSNP
rs941698464 4551 dbSNP
rs1157678898 4555 dbSNP
rs926913784 4557 dbSNP
rs908399528 4561 dbSNP
rs188110007 4569 dbSNP
rs1307377993 4571 dbSNP
rs138602954 4571 dbSNP
rs1401388111 4571 dbSNP
rs984391692 4571 dbSNP
rs1240924823 4573 dbSNP
rs1255536323 4573 dbSNP
rs1343475090 4583 dbSNP
rs560876428 4583 dbSNP
rs774985732 4583 dbSNP
rs1457608704 4590 dbSNP
rs1177564465 4596 dbSNP
rs988291571 4598 dbSNP
rs931144310 4601 dbSNP
rs11699409 4614 dbSNP
rs980873467 4616 dbSNP
rs1306563309 4617 dbSNP
rs971144394 4618 dbSNP
rs1429445354 4619 dbSNP
rs1032423366 4626 dbSNP
rs1390478792 4630 dbSNP
rs1024941048 4632 dbSNP
rs988410190 4636 dbSNP
rs1445815048 4637 dbSNP
rs576720163 4639 dbSNP
rs79461710 4640 dbSNP
rs74681032 4641 dbSNP
rs79378126 4642 dbSNP
rs76540718 4644 dbSNP
rs1032581704 4645 dbSNP
rs1001463276 4646 dbSNP
rs1412478173 4655 dbSNP
rs890349533 4662 dbSNP
rs1310518760 4666 dbSNP
rs6031389 4693 dbSNP
rs1028523744 4694 dbSNP
rs996573433 4699 dbSNP
rs993252708 4705 dbSNP
rs900847598 4721 dbSNP
rs1317632501 4726 dbSNP
rs1197120990 4736 dbSNP
rs543317756 4739 dbSNP
rs1177431696 4740 dbSNP
rs1265988908 4742 dbSNP
rs1040662314 4746 dbSNP
rs939679461 4754 dbSNP
rs1200863759 4758 dbSNP
rs1429872519 4762 dbSNP
rs1465083799 4764 dbSNP
rs1168256324 4768 dbSNP
rs773946098 4773 dbSNP
rs1204252317 4780 dbSNP
rs1462627089 4782 dbSNP
rs1048306023 4786 dbSNP
rs1293171065 4797 dbSNP
rs1483256758 4798 dbSNP
rs1252147159 4803 dbSNP
rs62205899 4805 dbSNP
rs931174067 4806 dbSNP
rs926444754 4807 dbSNP
rs1320091901 4819 dbSNP
rs569280138 4821 dbSNP
rs1280421822 4823 dbSNP
rs904852777 4825 dbSNP
rs1204720019 4832 dbSNP
rs1357927776 4837 dbSNP
rs752592793 4845 dbSNP
rs3746568 4846 dbSNP
rs1211084081 4848 dbSNP
rs529346091 4851 dbSNP
rs769099476 4853 dbSNP
rs184728050 4873 dbSNP
rs11905877 4876 dbSNP
rs925564610 4880 dbSNP
rs979698352 4890 dbSNP
rs935476671 4892 dbSNP
rs953679480 4895 dbSNP
rs1348325233 4896 dbSNP
rs1029120700 4904 dbSNP
rs997015605 4905 dbSNP
rs1459695850 4910 dbSNP
rs1303836259 4911 dbSNP
rs549178699 4913 dbSNP
rs965131944 4914 dbSNP
rs192393286 4921 dbSNP
rs3746567 4923 dbSNP
rs1228078648 4929 dbSNP
rs539082801 4944 dbSNP
rs1319538071 4945 dbSNP
rs1246617059 4947 dbSNP
rs1291784993 4959 dbSNP
rs911226191 4968 dbSNP
rs986784321 4981 dbSNP
rs1181321416 4987 dbSNP
rs1265281859 4998 dbSNP
rs1486175327 5004 dbSNP
rs886767725 5013 dbSNP
rs758556154 5014 dbSNP
rs954789722 5017 dbSNP
rs1425718115 5026 dbSNP
rs1048799371 5036 dbSNP
rs1379719322 5039 dbSNP
rs995397107 5042 dbSNP
rs1300161768 5055 dbSNP
rs1178706416 5058 dbSNP
rs1301454079 5068 dbSNP
rs1381803154 5070 dbSNP
rs545006567 5074 dbSNP
rs1315334781 5081 dbSNP
rs1044875675 5084 dbSNP
rs949186169 5086 dbSNP
rs1237281767 5087 dbSNP
rs1285800194 5089 dbSNP
rs760776729 5090 dbSNP
rs918029069 5095 dbSNP
rs576102411 5097 dbSNP
rs1235468170 5103 dbSNP
rs536966497 5106 dbSNP
rs750511372 5108 dbSNP
rs1184400346 5109 dbSNP
rs1266838532 5116 dbSNP
rs1237768104 5119 dbSNP
rs1228346837 5125 dbSNP
rs779061725 5127 dbSNP
rs1160521420 5129 dbSNP
rs935350898 5130 dbSNP
rs1174591511 5131 dbSNP
rs1309611422 5139 dbSNP
rs925270705 5158 dbSNP
rs980093704 5160 dbSNP
rs1331140468 5164 dbSNP
rs1375663640 5177 dbSNP
rs757477010 5187 dbSNP
rs1444195539 5188 dbSNP
rs866960943 5192 dbSNP
rs953630404 5199 dbSNP
rs904914647 5200 dbSNP
rs1373450374 5204 dbSNP
rs1218528907 5206 dbSNP
rs372861640 5211 dbSNP
rs976246625 5216 dbSNP
rs753969624 5222 dbSNP
rs1204037694 5226 dbSNP
rs763899791 5228 dbSNP
rs7271470 5233 dbSNP
rs1233471034 5234 dbSNP
rs1156682169 5237 dbSNP
rs1003884746 5240 dbSNP
rs896764268 5242 dbSNP
rs547995025 5246 dbSNP
rs1189940829 5249 dbSNP
rs1427825933 5254 dbSNP
rs760406131 5255 dbSNP
rs3827094 5261 dbSNP
rs1170389632 5262 dbSNP
rs935509279 5263 dbSNP
rs767443113 5265 dbSNP
rs905136986 5268 dbSNP
rs6065704 5270 dbSNP
rs925459785 5276 dbSNP
rs1043889414 5283 dbSNP
rs3827093 5292 dbSNP
rs780603687 5294 dbSNP
rs1454275444 5299 dbSNP
rs774928950 5305 dbSNP
rs1224119870 5316 dbSNP
rs1277261798 5318 dbSNP
rs911271009 5320 dbSNP
rs1173704423 5323 dbSNP
rs758746797 5323 dbSNP
rs987245211 5326 dbSNP
rs1274014467 5338 dbSNP
rs551755739 5339 dbSNP
rs955394740 5341 dbSNP
rs923210754 5344 dbSNP
rs971939677 5346 dbSNP
rs1481046055 5364 dbSNP
rs1013464123 5365 dbSNP
rs1193594268 5369 dbSNP
rs1421876755 5372 dbSNP
rs1479027664 5376 dbSNP
rs961914543 5377 dbSNP
rs896311699 5380 dbSNP
rs1005968595 5382 dbSNP
rs1321010313 5388 dbSNP
rs1366896070 5396 dbSNP
rs773893557 5397 dbSNP
rs531936813 5403 dbSNP
rs1297529225 5408 dbSNP
rs1338102492 5409 dbSNP
rs969580378 5410 dbSNP
rs1267017986 5417 dbSNP
rs1194483938 5428 dbSNP
rs765991352 5431 dbSNP
rs372230536 5434 dbSNP
rs1270597011 5445 dbSNP
rs762695508 5449 dbSNP
rs149763023 5452 dbSNP
rs1293972642 5460 dbSNP
rs1490541609 5469 dbSNP
rs1216477632 5479 dbSNP
rs896134170 5487 dbSNP
rs1449282624 5489 dbSNP
rs1194330729 5493 dbSNP
rs1368322937 5494 dbSNP
rs1472222727 5505 dbSNP
rs1052076058 5509 dbSNP
rs190060144 5510 dbSNP
rs1424780350 5511 dbSNP
rs1157569830 5512 dbSNP
rs904070816 5513 dbSNP
rs1383906735 5515 dbSNP
rs574698846 5516 dbSNP
rs922251120 5517 dbSNP
rs1339657641 5523 dbSNP
rs1446032004 5530 dbSNP
rs1317472987 5535 dbSNP
rs560899023 5541 dbSNP
rs1360493738 5549 dbSNP
rs1239490033 5551 dbSNP
rs140012984 5552 dbSNP
rs942880486 5555 dbSNP
rs747310841 5558 dbSNP
rs1255836180 5563 dbSNP
rs1441069500 5569 dbSNP
rs1303752587 5572 dbSNP
rs572438582 5575 dbSNP
rs1244566355 5583 dbSNP
rs889903191 5586 dbSNP
rs559044894 5589 dbSNP
rs1051176053 5593 dbSNP
rs556256805 5597 dbSNP
rs1455220491 5599 dbSNP
rs934010144 5604 dbSNP
rs1401189006 5606 dbSNP
rs1362529031 5607 dbSNP
rs908010417 5609 dbSNP
rs369133330 5616 dbSNP
rs940622693 5617 dbSNP
rs867151039 5626 dbSNP
rs1382237775 5631 dbSNP
rs1446409726 5646 dbSNP
rs1307095664 5662 dbSNP
rs1387118472 5663 dbSNP
rs1240325157 5664 dbSNP
rs951135275 5665 dbSNP
rs1255952145 5667 dbSNP
rs1343541511 5675 dbSNP
rs909128778 5683 dbSNP
rs1027136486 5686 dbSNP
rs1465392786 5688 dbSNP
rs576469844 5701 dbSNP
rs879655785 5704 dbSNP
rs969458014 5739 dbSNP
rs1177627064 5747 dbSNP
rs1023591178 5750 dbSNP
rs1181959603 5751 dbSNP
rs1455753392 5752 dbSNP
rs763428919 5757 dbSNP
rs146283411 5761 dbSNP
rs1013472319 5763 dbSNP
rs1388490040 5766 dbSNP
rs1188072868 5768 dbSNP
rs896320042 5769 dbSNP
rs1296689375 5774 dbSNP
rs1264531452 5778 dbSNP
rs1199221449 5781 dbSNP
rs772691837 5785 dbSNP
rs999622632 5787 dbSNP
rs536521763 5792 dbSNP
rs1317699808 5798 dbSNP
rs1197577727 5824 dbSNP
rs960706952 5827 dbSNP
rs770669414 5828 dbSNP
rs746618946 5829 dbSNP
rs777298942 5830 dbSNP
rs879547632 5830 dbSNP
rs1266137788 5831 dbSNP
rs771506154 5831 dbSNP
rs1201521444 5844 dbSNP
rs745981862 5845 dbSNP
rs779082934 5846 dbSNP
rs1236865232 5853 dbSNP
rs900469684 5873 dbSNP
rs1293011338 5875 dbSNP
rs1007500277 5878 dbSNP
rs1407230829 5883 dbSNP
rs1304301448 5890 dbSNP
rs1296395633 5896 dbSNP
rs1340494252 5905 dbSNP
rs1040607950 5908 dbSNP
rs1227598771 5908 dbSNP
rs1298264783 5915 dbSNP
rs889943658 5916 dbSNP
rs944935771 5921 dbSNP
rs1264293780 5922 dbSNP
rs567981046 5923 dbSNP
rs116434067 5926 dbSNP
rs983614245 5929 dbSNP
rs1224574661 5932 dbSNP
rs934105746 5935 dbSNP
rs930787572 5936 dbSNP
rs1487948018 5939 dbSNP
rs1184543101 5940 dbSNP
rs1263668579 5941 dbSNP
rs6073330 5942 dbSNP
rs1037029947 5944 dbSNP
rs368033545 5948 dbSNP
rs1314510358 5957 dbSNP
rs1426596763 5964 dbSNP
rs974221060 5983 dbSNP
rs1360435188 5986 dbSNP
rs571512313 5994 dbSNP
rs777905870 5995 dbSNP
rs1167526712 5996 dbSNP
rs185438221 6000 dbSNP
rs1382393244 6003 dbSNP
rs1313968892 6007 dbSNP
rs1374882989 6017 dbSNP
rs1356873740 6022 dbSNP
rs1023265512 6025 dbSNP
rs1247501862 6026 dbSNP
rs1185456397 6037 dbSNP
rs1352888109 6041 dbSNP
rs1475168195 6042 dbSNP
rs6031388 6045 dbSNP
rs960583476 6046 dbSNP
rs1213539353 6054 dbSNP
rs916429871 6062 dbSNP
rs1241507169 6063 dbSNP
rs1446735749 6065 dbSNP
rs767494614 6066 dbSNP
rs1379771531 6069 dbSNP
rs1399409067 6071 dbSNP
rs1161947146 6080 dbSNP
rs1030908315 6081 dbSNP
rs1465825603 6085 dbSNP
rs1335198722 6101 dbSNP
rs1380100444 6102 dbSNP
rs999406472 6109 dbSNP
rs1482275475 6111 dbSNP
rs1371997077 6116 dbSNP
rs960490568 6117 dbSNP
rs1222412817 6119 dbSNP
rs1286293936 6133 dbSNP
rs903679424 6135 dbSNP
rs1030754766 6140 dbSNP
rs542412368 6141 dbSNP
rs1281930547 6142 dbSNP
rs1243360723 6143 dbSNP
rs1356080711 6146 dbSNP
rs201202628 6148 dbSNP
rs1407812772 6149 dbSNP
rs11472104 6150 dbSNP
rs1237594974 6151 dbSNP
rs1369695899 6151 dbSNP
rs1468698682 6152 dbSNP
rs762709920 6152 dbSNP
rs1409323201 6153 dbSNP
rs555069523 6153 dbSNP
rs1329238092 6157 dbSNP
rs1410771131 6162 dbSNP
rs10630926 6164 dbSNP
rs1280510383 6164 dbSNP
rs1337006759 6164 dbSNP
rs138296694 6164 dbSNP
rs1470718922 6164 dbSNP
rs397700038 6164 dbSNP
rs1177483113 6165 dbSNP
rs775567128 6165 dbSNP
rs759370804 6166 dbSNP
rs1436336551 6173 dbSNP
rs1398819248 6177 dbSNP
rs1161544318 6187 dbSNP
rs1488399871 6195 dbSNP
rs1197906564 6197 dbSNP
rs1431840890 6198 dbSNP
rs1480985448 6202 dbSNP
rs1022388455 6206 dbSNP
rs977787064 6207 dbSNP
rs1418336772 6216 dbSNP
rs1407928338 6222 dbSNP
rs996626128 6223 dbSNP
rs1354625973 6227 dbSNP
rs1404211734 6236 dbSNP
rs1419292377 6237 dbSNP
rs967694365 6241 dbSNP
rs1269435342 6244 dbSNP
rs565113140 6253 dbSNP
rs1337689491 6266 dbSNP
rs1022579280 6269 dbSNP
rs1273727569 6276 dbSNP
rs192860279 6279 dbSNP
rs1271641173 6281 dbSNP
rs1182900487 6292 dbSNP
rs1439209430 6299 dbSNP
rs1240726018 6301 dbSNP
rs1474189551 6316 dbSNP
rs1287287312 6317 dbSNP
rs1419561645 6319 dbSNP
rs1212601722 6332 dbSNP
rs1334891106 6335 dbSNP
rs1161187540 6338 dbSNP
rs954414076 6343 dbSNP
rs753706209 6344 dbSNP
rs998723724 6349 dbSNP
rs1324478468 6353 dbSNP
rs188453962 6356 dbSNP
rs529931513 6359 dbSNP
rs1040325203 6370 dbSNP
rs1271023466 6376 dbSNP
rs754915656 6377 dbSNP
rs1243842922 6378 dbSNP
rs1226522671 6389 dbSNP
rs897277019 6391 dbSNP
rs182650594 6393 dbSNP
rs76979957 6401 dbSNP
rs1005530311 6406 dbSNP
rs540970634 6410 dbSNP
rs751409379 6412 dbSNP
rs1047963203 6413 dbSNP
rs572164284 6417 dbSNP
rs1443697445 6418 dbSNP
rs1444031151 6419 dbSNP
rs1044761047 6420 dbSNP
rs556225922 6420 dbSNP
rs1157947563 6427 dbSNP
rs1382460491 6441 dbSNP
rs948004587 6443 dbSNP
rs930861416 6445 dbSNP
rs1318779752 6453 dbSNP
rs1382291017 6454 dbSNP
rs1450730322 6457 dbSNP
rs1440311576 6459 dbSNP
rs1383650788 6468 dbSNP
rs920726408 6470 dbSNP
rs573111665 6472 dbSNP
rs544326005 6478 dbSNP
rs1353539121 6481 dbSNP
rs1206078938 6482 dbSNP
rs565091288 6487 dbSNP
rs6065703 6488 dbSNP
rs916260819 6491 dbSNP
rs762308347 6496 dbSNP
rs772999091 6497 dbSNP
rs977819527 6504 dbSNP
rs923890006 6507 dbSNP
rs1192597449 6513 dbSNP
rs967768049 6517 dbSNP
rs914925616 6519 dbSNP
rs141839990 6522 dbSNP
rs764977562 6525 dbSNP
rs1407169527 6526 dbSNP
rs556579641 6529 dbSNP
rs1030317003 6530 dbSNP
rs1022524788 6532 dbSNP
rs996288936 6537 dbSNP
rs1284848353 6538 dbSNP
rs761178564 6545 dbSNP
rs1321878003 6549 dbSNP
rs1221259190 6555 dbSNP
rs1264583634 6560 dbSNP
rs964795474 6562 dbSNP
rs543046705 6564 dbSNP
rs191469494 6565 dbSNP
rs1182842859 6568 dbSNP
rs554401417 6572 dbSNP
rs1479316434 6573 dbSNP
rs775973946 6573 dbSNP
rs1378415636 6579 dbSNP
rs1461734658 6588 dbSNP
rs886433749 6591 dbSNP
rs1005603933 6593 dbSNP
rs1398740307 6607 dbSNP
rs1273345032 6609 dbSNP
rs1453555189 6618 dbSNP
rs375110163 6620 dbSNP
rs1233869614 6622 dbSNP
rs1284392917 6627 dbSNP
rs1047983367 6629 dbSNP
rs1328021951 6647 dbSNP
rs995458585 6651 dbSNP
rs899348006 6652 dbSNP
rs772494867 6653 dbSNP
rs1249064663 6659 dbSNP
rs1044927632 6661 dbSNP
rs1432975913 6663 dbSNP
rs1205304298 6664 dbSNP
rs150549388 6678 dbSNP
rs1268072256 6685 dbSNP
rs895097787 6686 dbSNP
rs1201315439 6688 dbSNP
rs571475744 6689 dbSNP
rs1345187864 6701 dbSNP
rs1319525619 6703 dbSNP
rs1428078890 6704 dbSNP
rs1402860625 6706 dbSNP
rs2206633 6707 dbSNP
rs1173363068 6711 dbSNP
rs939191019 6715 dbSNP
rs916355614 6722 dbSNP
rs1427182394 6725 dbSNP
rs1454449326 6732 dbSNP
rs1294416884 6735 dbSNP
rs774664843 6738 dbSNP
rs1056220396 6743 dbSNP
rs1381265236 6751 dbSNP
rs1292961711 6754 dbSNP
rs1186186393 6770 dbSNP
rs1327881846 6772 dbSNP
rs1042218176 6776 dbSNP
rs946459444 6781 dbSNP
rs939009074 6784 dbSNP
rs1224649884 6785 dbSNP
rs923564614 6786 dbSNP
rs1440578685 6794 dbSNP
rs985184292 6797 dbSNP
rs1279379725 6810 dbSNP
rs538326588 6812 dbSNP
rs978053519 6816 dbSNP
rs1348944782 6817 dbSNP
rs1383464179 6823 dbSNP
rs1305895634 6824 dbSNP
rs922899684 6835 dbSNP
rs771047506 6849 dbSNP
rs1166149396 6851 dbSNP
rs749324000 6858 dbSNP
rs1361336929 6860 dbSNP
rs1452052250 6862 dbSNP
rs915150549 6863 dbSNP
rs1390382314 6864 dbSNP
rs1433540437 6870 dbSNP
rs186604074 6873 dbSNP
rs1379965261 6878 dbSNP
rs964511164 6883 dbSNP
rs549502371 6888 dbSNP
rs1213367911 6893 dbSNP
rs952837786 6895 dbSNP
rs1465459538 6903 dbSNP
rs1019019593 6908 dbSNP
rs1241312852 6909 dbSNP
rs1023462840 6914 dbSNP
rs1182569879 6920 dbSNP
rs1407877036 6925 dbSNP
rs866946843 6931 dbSNP
rs1012948722 6938 dbSNP
rs1166297809 6960 dbSNP
rs1427457494 6967 dbSNP
rs1161653811 6979 dbSNP
rs895787695 6985 dbSNP
rs1457401216 6987 dbSNP
rs529742225 6990 dbSNP
rs1335705272 6992 dbSNP
rs778031156 6993 dbSNP
rs1449550455 6996 dbSNP
rs1003476448 7001 dbSNP
rs1256703254 7004 dbSNP
rs1372518588 7007 dbSNP
rs902399554 7009 dbSNP
rs1042249378 7013 dbSNP
rs950722180 7015 dbSNP
rs1261474257 7019 dbSNP
rs567160218 7029 dbSNP
rs6130529 7038 dbSNP
rs6130528 7039 dbSNP
rs1232380331 7060 dbSNP
rs1479913888 7067 dbSNP
rs1179490500 7068 dbSNP
rs1282802015 7075 dbSNP
rs1049922758 7077