miRTarBase - #MIRT663903 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRI1   
Synonyms M1Pi, MRDI, MTNA, Ypr118w
Description methylthioribose-1-phosphate isomerase 1
Transcript NM_001031727   
Other Transcripts NM_032285   
Expression
Putative miRNA Targets on MRI1
3'UTR of MRI1
(miRNA target sites are highlighted)
>MRI1|NM_001031727|3'UTR
   1 CCAACTCAGCTCTCCCTAGCCTGCCTCTCTAGGTTTTTCAATACATTTCTTGAATGGCTACCCAAAAGCTGACCGTCCAG
  81 CCCCTGACCACACTTGTTCCTAGTGCAGGGAGCTCAGACAGGGCCTTCCATCTAGAGCCCAGCACCTAGAGCCAGGCTGC
 161 CCAGATTCAAATCCTGACTCCGCCACTTTTCCCACTGTATGATCTTGGGCAAGTCACTTCACCTCTCTGTGCCTTGGTTT
 241 CCTCATTTATAAAATGTGGATAACAGGCCGGGCGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAG
 321 GTGGATCACAAGATCAGGAGATTGAGACCATCCTGGCTAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTA
 401 GCCGGGTGTGGTGGTGGGCACCTGCAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGAATGGCGTGAAACTGGGAGGCAG
 481 AGCTTGCAGTGAGCCGAGATAGCGCCACTGCACTCCAGCCTGGGCAACAGAGCGAGACTCCGTCTCAAAAATAAATATAA
 561 TTAATTAATTATTTAATTAAAAAAATAAAAAATAAATGTGGATAATACTAGTACCTCCCTCTTAAGGTCAGGGCTGGAGC
 641 TAGGGTGACATCTCCAGGGCAGAATTTTAAGAGGACACCAAAAAAGCTCAGCAACCAAGATAAAAAATATTTTAAAGCAA
 721 TATTTTGTTTTGGGTTTTTTTTTTTTGAGATCAAGTATCACTCGTTACCCAGGCTGGAATGTAGAGGCGAGATCTCAGCT
 801 CACTGAAACCTGTGCCTCCCCGGTTCAAGCGATTCTCCTGCCACAGCCTCCTGAGTAGCTGGGATTACAGGCATGCGCCA
 881 CCATGCCCAGCTAATTTTTCTATTTTTAGTAGAGACATGATTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACTC
 961 AAATGATCCCCCTGCCTCAGCCTCCCAAAGTGCTGGGACTACAGGCATGAGCCACTGTGCCTGACCTTACAGCAGTATTT
1041 TTTAAAAATCAAAATTAATGCAAAAATCCATGATGAGGCCAGGCTTGGTGGCTCATGCCTGTAATTCCAGCACTTTGGGA
1121 GGATCCCTTGAGCCCAGGTGTTTGAGACCAGTTTGGGTAACATAGGAAGAGCTTGTCTCTACAAACAAAAATTTAAAAAC
1201 AATGAGCTGGGCATGGAACTCACACCTCTAGCCCCAGCTACTCAGGCTGAAGTGGGAGGATGGCTTGAGCCCAGGAGTTC
1281 AAGGATGCAGTGTGCTTTGATTGCACTACTGCACTTCACCCTAAGCAACAGAGTGAGACCCCATCTCTTTAAAAAAAAAA
1361 AAAAATCCATGATGAACAAAACAAGTATTTGTTTGAGACGGGGTCTCGCTCTGTCGCCCAGGCTGGAGTACAGTGGTGCC
1441 ATCTCAGCTCACTGCAACCTCCGCCTTCTGGGTTCAAGCGACTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGG
1521 AGCCTGGCACTATGCCTGGCTAATTTTTGTATTTTTATTGGAGACACCATGTTAGTCGTGGCTGGTCTCCAACTCCTGAC
1601 CTCGGGTGATCCGCGCCCCGCGGCCTCCGAAAGTGCTGGGATTACAAGCGTGAGCCACCGTGCCCGGCCTAAATAAAATT
1681 TTGAAGAGGCTAGAACCCCGCACTTGTGCCTTGAGCTTACTGACCTCAACACCCTGGTTCCACTAAAACTTTATTTACAA
1761 AATTATGCTGCCGGTCTGCAGGATGTAGTTTAACAATTTGATTATTTTGGATATTAAAATATTTTTTAAGTCTTGAAAAT
1841 ATTGTTTACTATTACCAAAGTTTTTGAACCTTCTTAAATTCTGTACCAGAGGTGAGTGCCACACCCTAACCTAGTCTGAG
1921 TTTTTATGTGTAAAGATCATAAAACGTTGTAAGTTTTCTAAAACACATAAGCTCTCAATAAACGTTAGCTTATCATTGTC
2001 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:|:||| |   :|||||| 
Target 5' atAGCGCCACT---GCACTCCa 3'
499 - 517 141.00 -18.80
2
miRNA  3' guuugUGGUAACAGUGU-GAGGu 5'
               :|:|  || ||| |||| 
Target 5' ctggaGCTAGGGTGACATCTCCa 3'
634 - 656 121.00 -15.60
3
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            ::|| ||  |  | ||||| 
Target 5' tgGGCAACAGAGCGAGACTCCg 3'
521 - 542 120.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN17154038 5 COSMIC
COSN31552799 37 COSMIC
COSN1211183 72 COSMIC
COSN30502573 75 COSMIC
COSN31542904 109 COSMIC
COSN28602420 285 COSMIC
COSN28598451 287 COSMIC
COSN28599682 294 COSMIC
COSN28881067 314 COSMIC
COSN28595770 337 COSMIC
COSN29233717 465 COSMIC
COSN24107430 572 COSMIC
COSN24157207 580 COSMIC
COSN23123750 608 COSMIC
COSN28570709 1252 COSMIC
COSN28568576 1314 COSMIC
COSN28570686 1324 COSMIC
COSN28569649 1325 COSMIC
COSN30673180 1364 COSMIC
COSN31782111 1366 COSMIC
COSN7354464 1604 COSMIC
COSN21077092 1714 COSMIC
COSN21483741 1836 COSMIC
COSN32058094 1930 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs901036730 1 dbSNP
rs1443472307 2 dbSNP
rs1469071 5 dbSNP
rs758775428 8 dbSNP
rs778302139 10 dbSNP
rs747443089 12 dbSNP
rs771515625 13 dbSNP
rs746052543 14 dbSNP
rs748893321 16 dbSNP
rs1469528652 19 dbSNP
rs1211481416 20 dbSNP
rs768354051 21 dbSNP
rs774155872 24 dbSNP
rs569521698 25 dbSNP
rs1244335083 26 dbSNP
rs772027126 27 dbSNP
rs200883876 29 dbSNP
rs1170038184 34 dbSNP
rs1418720955 41 dbSNP
rs1463192326 42 dbSNP
rs773104020 44 dbSNP
rs142846234 45 dbSNP
rs1438407988 56 dbSNP
rs952784632 60 dbSNP
rs1240372933 61 dbSNP
rs1199631911 74 dbSNP
rs1004199440 75 dbSNP
rs558298182 76 dbSNP
rs1219014017 79 dbSNP
rs576868553 81 dbSNP
rs1322930454 92 dbSNP
rs1315155974 107 dbSNP
rs1314621421 115 dbSNP
rs1374608187 123 dbSNP
rs1311419444 126 dbSNP
rs1034799645 130 dbSNP
rs770091366 136 dbSNP
rs1389835365 143 dbSNP
rs1291940475 147 dbSNP
rs1376035169 148 dbSNP
rs1459657626 149 dbSNP
rs1398844306 152 dbSNP
rs992938729 153 dbSNP
rs917411220 156 dbSNP
rs1035238806 161 dbSNP
rs967550771 179 dbSNP
rs977644502 182 dbSNP
rs991125124 183 dbSNP
rs1382680127 186 dbSNP
rs1179879629 192 dbSNP
rs1227650238 198 dbSNP
rs541169659 198 dbSNP
rs963140686 201 dbSNP
rs1273903899 221 dbSNP
rs1344727674 223 dbSNP
rs1217878380 228 dbSNP
rs1350924616 231 dbSNP
rs1283086841 245 dbSNP
rs554369099 246 dbSNP
rs973146852 249 dbSNP
rs1330242618 252 dbSNP
rs936298860 255 dbSNP
rs572684560 260 dbSNP
rs919091275 262 dbSNP
rs1388702817 270 dbSNP
rs1053448238 271 dbSNP
rs879488097 274 dbSNP
rs377569249 275 dbSNP
rs1159584299 277 dbSNP
rs1465990035 282 dbSNP
rs1376233591 287 dbSNP
rs987706339 289 dbSNP
rs1434154794 293 dbSNP
rs911844605 294 dbSNP
rs1216542934 298 dbSNP
rs942434909 301 dbSNP
rs1040785645 304 dbSNP
rs1261032413 305 dbSNP
rs1329157038 309 dbSNP
rs1448843145 311 dbSNP
rs900989606 312 dbSNP
rs1039031012 314 dbSNP
rs1235117179 315 dbSNP
rs993965989 318 dbSNP
rs1324079917 322 dbSNP
rs1277798921 323 dbSNP
rs1398387255 325 dbSNP
rs1342386386 337 dbSNP
rs572840831 341 dbSNP
rs1395913158 346 dbSNP
rs1476899980 348 dbSNP
rs1400648227 352 dbSNP
rs1174875469 362 dbSNP
rs1175352138 363 dbSNP
rs888363752 368 dbSNP
rs3180008 382 dbSNP
rs368749940 391 dbSNP
rs1169448647 393 dbSNP
rs1476650631 395 dbSNP
rs1425106212 402 dbSNP
rs1005922554 404 dbSNP
rs1034339181 405 dbSNP
rs377578606 408 dbSNP
rs556584100 408 dbSNP
rs958726525 408 dbSNP
rs1461549439 409 dbSNP
rs749595377 419 dbSNP
rs1024412014 421 dbSNP
rs151047310 426 dbSNP
rs1329064929 431 dbSNP
rs1271029037 432 dbSNP
rs1035585247 434 dbSNP
rs895423792 451 dbSNP
rs1012480726 452 dbSNP
rs1142084 454 dbSNP
rs1454000808 458 dbSNP
rs561499546 464 dbSNP
rs1306014844 465 dbSNP
rs1022649488 471 dbSNP
rs926147179 473 dbSNP
rs1398159663 480 dbSNP
rs1168198897 481 dbSNP
rs1472176817 484 dbSNP
rs957640376 485 dbSNP
rs1240002756 494 dbSNP
rs186790830 495 dbSNP
rs1185281600 496 dbSNP
rs910874177 496 dbSNP
rs535335808 498 dbSNP
rs1237293626 500 dbSNP
rs976432989 501 dbSNP
rs1458963281 504 dbSNP
rs565178174 505 dbSNP
rs1266934505 516 dbSNP
rs950510231 527 dbSNP
rs1354270421 531 dbSNP
rs1450146456 533 dbSNP
rs775049375 534 dbSNP
rs929762928 535 dbSNP
rs73009867 541 dbSNP
rs888302349 542 dbSNP
rs867959394 543 dbSNP
rs1453852736 546 dbSNP
rs1162193419 547 dbSNP
rs1387885673 547 dbSNP
rs941277799 549 dbSNP
rs1164962443 558 dbSNP
rs1056132612 559 dbSNP
rs1379590629 568 dbSNP
rs894455467 571 dbSNP
rs1471036272 573 dbSNP
rs1450118581 579 dbSNP
rs73507683 579 dbSNP
rs915246335 579 dbSNP
rs565491736 580 dbSNP
rs1042774685 583 dbSNP
rs1372116006 584 dbSNP
rs202003453 586 dbSNP
rs140711395 587 dbSNP
rs903259059 587 dbSNP
rs999384391 598 dbSNP
rs1374434130 600 dbSNP
rs529859148 602 dbSNP
rs1435256766 614 dbSNP
rs1304633363 619 dbSNP
rs1017157958 620 dbSNP
rs1359415869 627 dbSNP
rs1033162529 628 dbSNP
rs1156693395 632 dbSNP
rs1402401511 640 dbSNP
rs1305447512 641 dbSNP
rs898744877 650 dbSNP
rs994544755 653 dbSNP
rs1476947239 661 dbSNP
rs957800027 674 dbSNP
rs369863573 675 dbSNP
rs1487967294 677 dbSNP
rs1261145609 678 dbSNP
rs1218496437 680 dbSNP
rs1017815262 683 dbSNP
rs1278583084 686 dbSNP
rs1217806890 691 dbSNP
rs1239841714 696 dbSNP
rs1264882560 699 dbSNP
rs1347652050 702 dbSNP
rs183320358 705 dbSNP
rs1215736241 706 dbSNP
rs1009036360 708 dbSNP
rs1274094325 720 dbSNP
rs1018744046 721 dbSNP
rs1295848035 731 dbSNP
rs964476806 732 dbSNP
rs1457132260 734 dbSNP
rs112618802 735 dbSNP
rs1415327015 735 dbSNP
rs561698016 735 dbSNP
rs974546781 736 dbSNP
rs1252565350 747 dbSNP
rs1419546272 748 dbSNP
rs915193858 755 dbSNP
rs1186760785 757 dbSNP
rs968357012 765 dbSNP
rs1237397609 769 dbSNP
rs976380897 770 dbSNP
rs1366164737 783 dbSNP
rs1462880710 785 dbSNP
rs1462579526 787 dbSNP
rs536993992 789 dbSNP
rs922312738 790 dbSNP
rs1316889923 792 dbSNP
rs1293056844 798 dbSNP
rs1215799745 799 dbSNP
rs1399140215 805 dbSNP
rs552141551 811 dbSNP
rs923913877 817 dbSNP
rs929725601 822 dbSNP
rs113299987 823 dbSNP
rs1056527662 824 dbSNP
rs1337180488 830 dbSNP
rs916751794 831 dbSNP
rs948239960 832 dbSNP
rs909690139 834 dbSNP
rs1392411282 835 dbSNP
rs1429195479 835 dbSNP
rs112694173 838 dbSNP
rs1055674462 849 dbSNP
rs1198386440 851 dbSNP
rs1353618641 856 dbSNP
rs765954125 858 dbSNP
rs894403213 869 dbSNP
rs1249260674 870 dbSNP
rs1206194074 873 dbSNP
rs1307510047 875 dbSNP
rs533564703 877 dbSNP
rs1243624485 878 dbSNP
rs1384863122 885 dbSNP
rs1047406652 887 dbSNP
rs1445751250 889 dbSNP
rs886073411 893 dbSNP
rs1008652505 901 dbSNP
rs1294132477 902 dbSNP
rs1462697972 903 dbSNP
rs1018690292 909 dbSNP
rs1162734961 918 dbSNP
rs1202714714 929 dbSNP
rs1386392642 931 dbSNP
rs1252785716 939 dbSNP
rs1178636639 940 dbSNP
rs1045758001 941 dbSNP
rs553128410 948 dbSNP
rs555046014 949 dbSNP
rs1253124755 951 dbSNP
rs12984952 967 dbSNP
rs1199755517 968 dbSNP
rs754822247 969 dbSNP
rs1033523860 973 dbSNP
rs1480774123 980 dbSNP
rs574897910 986 dbSNP
rs1008149115 987 dbSNP
rs1017763059 988 dbSNP
rs1219590880 990 dbSNP
rs1361042281 991 dbSNP
rs1292400035 1009 dbSNP
rs1022065856 1013 dbSNP
rs1314850769 1018 dbSNP
rs1308905934 1021 dbSNP
rs1392139010 1026 dbSNP
rs1367145482 1027 dbSNP
rs966265685 1034 dbSNP
rs1406841604 1036 dbSNP
rs1366280251 1039 dbSNP
rs968010573 1045 dbSNP
rs978384811 1057 dbSNP
rs764992530 1059 dbSNP
rs976329945 1067 dbSNP
rs1160245816 1073 dbSNP
rs554890340 1077 dbSNP
rs960950515 1078 dbSNP
rs1196918944 1081 dbSNP
rs1422452799 1092 dbSNP
rs1490677946 1096 dbSNP
rs187860182 1098 dbSNP
rs34059821 1102 dbSNP
rs1138206 1104 dbSNP
rs916699318 1105 dbSNP
rs951136452 1124 dbSNP
rs1239490951 1126 dbSNP
rs1172096452 1128 dbSNP
rs543798201 1132 dbSNP
rs73507688 1135 dbSNP
rs909623658 1137 dbSNP
rs1281541117 1139 dbSNP
rs1462861260 1141 dbSNP
rs1038569936 1145 dbSNP
rs1302746252 1149 dbSNP
rs920062595 1150 dbSNP
rs1374247256 1158 dbSNP
rs3179532 1165 dbSNP
rs576829165 1178 dbSNP
rs1387746667 1181 dbSNP
rs141818227 1183 dbSNP
rs1465848317 1185 dbSNP
rs1427639938 1193 dbSNP
rs1173742154 1201 dbSNP
rs991311666 1202 dbSNP
rs781152627 1203 dbSNP
rs1212989177 1204 dbSNP
rs1444839852 1214 dbSNP
rs1263759344 1215 dbSNP
rs1559153 1218 dbSNP
rs1482772932 1219 dbSNP
rs1307832595 1221 dbSNP
rs1559152 1227 dbSNP
rs924605266 1232 dbSNP
rs934661794 1233 dbSNP
rs1205766727 1234 dbSNP
rs900284774 1240 dbSNP
rs1054511975 1241 dbSNP
rs893203989 1244 dbSNP
rs1138208 1245 dbSNP
rs1486644092 1251 dbSNP
rs1328341396 1252 dbSNP
rs1211523554 1257 dbSNP
rs995859645 1260 dbSNP
rs1395971314 1262 dbSNP
rs1404302782 1266 dbSNP
rs1339139328 1271 dbSNP
rs1470529347 1273 dbSNP
rs1007683528 1281 dbSNP
rs1022096919 1282 dbSNP
rs34205382 1283 dbSNP
rs1484624818 1295 dbSNP
rs548364232 1296 dbSNP
rs999450616 1297 dbSNP
rs1374307800 1314 dbSNP
rs1193753234 1318 dbSNP
rs902051070 1322 dbSNP
rs1241246013 1324 dbSNP
rs1187882782 1335 dbSNP
rs1185180001 1339 dbSNP
rs1419840463 1341 dbSNP
rs1257657524 1342 dbSNP
rs386807012 1345 dbSNP
rs201792909 1348 dbSNP
rs745620979 1348 dbSNP
rs748722037 1348 dbSNP
rs1213682035 1350 dbSNP
rs746911736 1350 dbSNP
rs796431153 1350 dbSNP
rs1212671298 1351 dbSNP
rs1491343888 1351 dbSNP
rs1559151 1351 dbSNP
rs59239281 1351 dbSNP
rs768072293 1351 dbSNP
rs1175868659 1352 dbSNP
rs564164401 1356 dbSNP
rs1407884434 1357 dbSNP
rs1397966062 1360 dbSNP
rs768347525 1364 dbSNP
rs960648016 1366 dbSNP
rs1423508530 1368 dbSNP
rs193179571 1370 dbSNP
rs997697316 1373 dbSNP
rs147208398 1375 dbSNP
rs3029143 1375 dbSNP
rs397804006 1375 dbSNP
rs1359930653 1378 dbSNP
rs1428774752 1379 dbSNP
rs1290818508 1387 dbSNP
rs1232103383 1388 dbSNP
rs1179860435 1395 dbSNP
rs1362996441 1396 dbSNP
rs1026544405 1408 dbSNP
rs1385995634 1409 dbSNP
rs951039386 1416 dbSNP
rs1004292151 1417 dbSNP
rs1016632300 1419 dbSNP
rs563377140 1437 dbSNP
rs1357460291 1444 dbSNP
rs991259414 1453 dbSNP
rs1247367520 1459 dbSNP
rs1353379037 1462 dbSNP
rs1278179041 1466 dbSNP
rs569120106 1469 dbSNP
rs538247789 1471 dbSNP
rs767396366 1480 dbSNP
rs969476934 1485 dbSNP
rs974122677 1487 dbSNP
rs147089928 1492 dbSNP
rs557919261 1495 dbSNP
rs971232276 1501 dbSNP
rs1425244679 1502 dbSNP
rs1139803 1517 dbSNP
rs981333273 1518 dbSNP
rs1242326404 1530 dbSNP
rs1156560514 1532 dbSNP
rs138245463 1535 dbSNP
rs1191370162 1537 dbSNP
rs1251484541 1539 dbSNP
rs760711725 1550 dbSNP
rs1271172218 1559 dbSNP
rs1128028 1561 dbSNP
rs534618940 1563 dbSNP
rs1054861964 1567 dbSNP
rs774737872 1570 dbSNP
rs1128029 1575 dbSNP
rs943445931 1578 dbSNP
rs1351928612 1588 dbSNP
rs1279699855 1591 dbSNP
rs1222536608 1592 dbSNP
rs1343037212 1594 dbSNP
rs1410422650 1595 dbSNP
rs539238818 1596 dbSNP
rs931740205 1597 dbSNP
rs748625007 1604 dbSNP
rs1344511551 1605 dbSNP
rs1039109966 1609 dbSNP
rs1316205147 1611 dbSNP
rs537397846 1613 dbSNP
rs557452226 1615 dbSNP
rs901998738 1616 dbSNP
rs1161445326 1622 dbSNP
rs903598899 1623 dbSNP
rs997645143 1625 dbSNP
rs1128030 1630 dbSNP
rs1128031 1631 dbSNP
rs1128032 1633 dbSNP
rs1475162488 1636 dbSNP
rs1128033 1645 dbSNP
rs184279710 1646 dbSNP
rs1006510765 1647 dbSNP
rs1128034 1648 dbSNP
rs1013483653 1653 dbSNP
rs1441419628 1656 dbSNP
rs1016991994 1657 dbSNP
rs866609595 1658 dbSNP
rs1012641228 1660 dbSNP
rs1022739188 1661 dbSNP
rs1360745383 1662 dbSNP
rs971181410 1664 dbSNP
rs1268289340 1667 dbSNP
rs1432835533 1676 dbSNP
rs974068682 1690 dbSNP
rs1335805438 1694 dbSNP
rs187913961 1698 dbSNP
rs1284272484 1700 dbSNP
rs760302467 1701 dbSNP
rs1044733 1706 dbSNP
rs1211387376 1713 dbSNP
rs1188751104 1714 dbSNP
rs990113782 1722 dbSNP
rs914531317 1735 dbSNP
rs1243110751 1741 dbSNP
rs1274720713 1748 dbSNP
rs1182108340 1752 dbSNP
rs537702629 1767 dbSNP
rs558844435 1772 dbSNP
rs912706612 1789 dbSNP
rs1264611176 1808 dbSNP
rs143494501 1811 dbSNP
rs974762224 1820 dbSNP
rs1194724521 1821 dbSNP
rs923363612 1823 dbSNP
rs933438777 1825 dbSNP
rs1232793093 1826 dbSNP
rs1450183653 1843 dbSNP
rs1384737052 1845 dbSNP
rs921606112 1846 dbSNP
rs1469000715 1854 dbSNP
rs931687619 1857 dbSNP
rs1043390771 1858 dbSNP
rs1172578478 1860 dbSNP
rs1048357422 1862 dbSNP
rs756910482 1873 dbSNP
rs866855021 1874 dbSNP
rs1385141888 1882 dbSNP
rs903627203 1882 dbSNP
rs886632218 1884 dbSNP
rs942260972 1887 dbSNP
rs1474934084 1905 dbSNP
rs541010059 1915 dbSNP
rs898139814 1921 dbSNP
rs1013513216 1926 dbSNP
rs112835479 1929 dbSNP
rs1044747 1930 dbSNP
rs192477616 1936 dbSNP
rs906949110 1939 dbSNP
rs1290866565 1969 dbSNP
rs1352551697 1973 dbSNP
rs1002648121 1997 dbSNP
rs1444248972 1999 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
1
miRNA  3' guUUGUGGUAACAGUGUGAGGu 5'
            |:|:||| |   :|||||| 
Target 5' auAGCGCCACU---GCACUCCa 3'
2 - 20
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000319545.8 | 3UTR | GAUAGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000319545.8 | 3UTR | GAUAGCGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
MiRNA-Target Expression Profile (TCGA)
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 1 1
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 1 1
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 1 1
MIRT678576 TMEM168 transmembrane protein 168 1 1
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 1 1
MIRT680344 ZNF281 zinc finger protein 281 1 1
MIRT680467 C3 complement C3 1 1
MIRT682826 FLG2 filaggrin family member 2 1 1
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 1 1
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 1 1
MIRT685275 KIAA1143 KIAA1143 1 1
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 1 1
MIRT687526 NASP nuclear autoantigenic sperm protein 1 1
MIRT691760 BCL2L15 BCL2 like 15 1 1
MIRT693890 C3orf62 chromosome 3 open reading frame 62 1 1
MIRT699342 SLC35E1 solute carrier family 35 member E1 1 1
MIRT699909 RUNDC1 RUN domain containing 1 1 1
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 1 1
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 1 1
MIRT702174 LYRM4 LYR motif containing 4 1 1
MIRT706205 ACOT9 acyl-CoA thioesterase 9 1 1
MIRT706659 RNF216 ring finger protein 216 1 1
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 1 1
MIRT706705 GPR155 G protein-coupled receptor 155 1 1
MIRT706777 ANKRD36 ankyrin repeat domain 36 1 1
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 1 1
MIRT706863 MAFF MAF bZIP transcription factor F 1 1
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1 1
MIRT706916 THAP6 THAP domain containing 6 1 1
MIRT706962 FANCC Fanconi anemia complementation group C 1 1
MIRT706980 XPO5 exportin 5 1 1
MIRT707015 RRP36 ribosomal RNA processing 36 1 1
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT707072 MED29 mediator complex subunit 29 1 1
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 1 1
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT724198 MED7 mediator complex subunit 7 1 1
MIRT725403 KIF6 kinesin family member 6 1 1
Error report submission
MIRT ID*
Your e-Mail*
Memo*