miRTarBase - #MIRT664957 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PTCD3   
Synonyms MRP-S39
Description pentatricopeptide repeat domain 3
Transcript NM_017952   
Expression
Putative miRNA Targets on PTCD3
3'UTR of PTCD3
(miRNA target sites are highlighted)
>PTCD3|NM_017952|3'UTR
   1 AAGTGGAGATTCAGGAGCAGCAATGGGTCTCACCATAGCTGCTGGAATCACACCTGAGAACTGAGATATACCAATATTTA
  81 ACATTGTTACAAAGAAGAAAAGATACAGATTTGGTGAATTTGTTACTGTGAGGTACAGTCAGTACACAGCTGACTTATGT
 161 AGATTTAAGCTGCTAATATGCTACTTAACCATCTATTAATGCACCATTAAAGGCTTAGCATTTAAGTAGCAACATTGCGG
 241 TTTTCAGACACATGGTGAGGTCCATGGCTCTTGTCATCAGGATAAGCCTGCACACCTAGAGTGTCGGTGAGCTGACCTCA
 321 CGATGCTGTCCTCGTGCGATTGCCCTCTCCTGCTGCTGGACTTCTGCCTTTGTTGGCCTGATGTGCTGCTGTGATGCTGG
 401 TCCTTCATCTTAGGTGTTCATGCAGTTCTAACACAGTTGGGGTTGGGTCAATAGTTTCCCAATTTCAGGATATTTCGATG
 481 TCAGAAATAACGCATCTTAGGAATGACTAAACAAGATAATGGCAGTTTAGGCTGCACAACTGGTAAAATGACTGTAGATA
 561 AATGTTGTAATTAGTGTACACGTTTGTATTTTTGTTAATATAGCCGCTGCCATAGTTTTCTAACTTGAACAGCCATGAAT
 641 GTTTCATGTCTCCCTTTTTTTTTGTCTATAGCTGTTACCTATTTTAGTGGTTGAAATGAGAGCTAGTGATGACAGAAGGA
 721 TGTGGAATGTCTTCTTGACATCATTGTGTATTGCTGGTAATCAAGTTGGTAACGACTACTTCTAGCAGCTCTTACCACTA
 801 TGACTTAAGTGGTCCTGGAAGGCAGTAAGTGGAGGTTTGCAGCATTCCTGCCTTCATGAGGGCTTCTACCACTGACCACT
 881 TTGCACGTACCTGGCTCCCAGATTTACTTAGGTACCCCACGAGTTGTCCACATAAGCAGCTTCATCTTTACCTTGCCAGA
 961 GTTGACAATTATGGGATACTCTAGTCTACTTATACTTGTGTTCCCATCTGTCTGCCATCCTCTGAAGGCCGGGACCCAGT
1041 CATACATCCTTAGAAACCAAAGTATGGTTTTTGTTTTCTCTTGGAATGTCAGGTCTTAAGGCATTTAATTGAGGGACAAA
1121 AAAAAAAAAAGCCGATATAGTAGCTAGCTACTTAAGCATCCATGGGTATTGCTCCATATCAAAGCAGATTTGCAGGACAG
1201 AGAGAGTAAATTAGCCTTCAGTCTTGGTTTACAGCTTCCAAGGAGAGCCTTGGCCACCTGAAATGTTAACTCGGTCCCTT
1281 CCTGTCTCTAGTTCATCAGCACCTGCAGATGCCTGACTCTTGTTAGCCTTACTATTCAATACAGTCCTTAGATTCACGGT
1361 ATGCCTCTTCCTATCCAGGCACCTATTCTGAATCACCATGTTGCTCTGCAGCTAGAGTTGATAGGAGAAAATCCATTTGG
1441 GTAGATGGCCTATGAATTTGTAGTAGACTTTCAAAATGAGTGATTTGTTAGCTTGGTACTTTTAAGTTTGTGGTACAGAT
1521 CCTCCAAACCCATACTCTGAGCAATTAACTGCCTTGAACATAGAGAAAAATTAAGGCCTCACAGGATGAGTCTCCATTCT
1601 CTGTAAATGCTTATTTTATCATAGTCTTTAGCCTCTACTATGAGTAAAATGTTCTCTTCGGCCGGGTGTGGTGACTCACA
1681 CCTGTAACCTCAGCACTTTGGGAGGCAGAGGTGGGAGGATCACTTAGGTCCAGGAGTTCGAGACTAGCCTGGGCAACATA
1761 GTGAGACACCGGATCTACAAAAAAATAAAAAGCCAGACTGGTGGTATGTATCTGTGTCCCAGCTAATTGGGAGGGTGAGT
1841 TGGGAGGATTGTTTGAGCCTAGGAGAGGGAGGTTGCAGTGAGCCGTGATTGCACCACTGCACTCCAGCCTGGGCAACAGA
1921 GCAAGACCCTGTCTTGGAGAAACCAGAATTTTGGAAGAGCAAATGGGGCTGAGTGCAGTGGCTCATGCCTGTAATCCCAG
2001 CACTTAGGGTGCCAATGTGGATTACCTGAGCCCAGGAGTTTGAGACCAGCCTGGGTAACAGTGAGACCCCCCTCCCTACA
2081 AAAGATTTTAATAATTAGTTGGGCGTAGTGGTGCATGCCTGTAATCCCAGCTACTCTGGAGACAGGTGGAGGGGATTGCT
2161 TGAGCCTGGGAAGCTGAGGCTGCAGTAGCCATGACTGCACCACTGCATTCCAGCCTGGTTGACAGAGTGACCCTTGTCTC
2241 CAAGAAAAAAAAAAAGCAAATGGGATTAAGGACTCATGGAATGGGAAGGGGAAGGGGAGTCTTACTATATGTGGAATAAA
2321 CTTGCTCAGTGTTGCCACAGAGTTACATTACCAATGTGTAGAAGTCAGAAACTAGACTTCTAGTTTGGTTCAACATTTGA
2401 GGGTTGTTTTATAGCCATCAAAGTATTCAAGAGGTTGGATGGCACTCAAAAGATTCTACATGTCTAGAATCAAACTCAAA
2481 TCTGGCACGTAGGTGCTTCTTAGTAAATGCTTAATGAATGCCACCAACTCTGCAAAGTATTCATTGATTTTGAGACCTTA
2561 GTCATGTTGCTACTAAAAGTAGGGCATATGACCGCCTAAGAAACAGAACTTCGAGAAGTCCTAACGTAACCACAGTAAAG
2641 CAGACTCCCCTTTCAGCAACCTCAAAGCAAAAAAAAAAAAAAAAAAACCAGTTAGCTGCTATATAAACACTATACCAAGC
2721 ACTAGGCTTAGAGGAAAAGATGTCAGATTGTACTGTCACTGGCTATGTACCCATATTCTCTAAGACAGGGTAGCATTTGT
2801 CTTTCAAACTGCAGGGTTTGAAATCAGTTTTTGTGGGTGATTGCAATTTTTTAATGAAATGCATTAGAACATCTAAGCAC
2881 GTCACCTACAGTTTTGTGATGGTGCATTTTTGCATTGCAGTATAGATCTGTGCATAGATATATGCATTAAGTGTAGCAAA
2961 TCGTGATGTAAATTTTTTACTGCTGGTCATGGTCAAAAAGTAAGATACGCTAGGAAATTGAGTCACTAGGAGCATGGATG
3041 TATAAGGCAGGTTTTATACAACCATTTAGATTCAACATTAATGGTAGAGTGGCATTTTACCAAAAAAATGGGTGTATTTG
3121 ATTTGGGTGCTGTAAGGCAATTTGCTAGGACATGGGATAATCAGATTACACAAAATCTAGGCAGTGAACAAGTCTTCATC
3201 CTGGCCCAGGAAATAGCCTATTAAAAAATGCTGTCCAGGCCAGGCACAGTGGCTCACACCTGTAATCCCAGGACTTCGGG
3281 AGGCTGAGGCTGGAGGATTGCTTGAGTTCAAGACCAGCCTGAGCAACACAGTGAAAACCCATCTCAAAAAAAAAAAAAAA
3361 AAACCAAAAAAACTGTCCAGCTGTGGACTTTCAGGATTCAGGACTGCTGGGGATCAAGCCCAAGGATGTTTTTCAGAGCT
3441 CTGTGATTTAAGATGCTCGAAAAGAGTGTCCAAGAGGAGTAAAGGTCATGACAGAATTTACTCCCAGGACAATCTAAGTT
3521 CTGCCACAAGTACCCGTGGTGTCTGTTCCCACAACAATGGCCCTTTCACAAGCTCTTGCCTCACAACCCCTGCAGAAGTC
3601 CTTCAACAAAACTAATAATAGACTAGTGAAACCTACTCCTCACATGGGTAAGAGTTGCAGTGGGCAGGTGACCCTCCTCC
3681 CTGCCCCCATCCTTTGCTTCCTCAAGCTCCCTGCCAACCTCTGGATACATCAATGGGAAGGAAACCAGGGAAGCATAGAC
3761 CTATAGTACAACAGGGGTGTAGTGACCACTGGACCTGATGAAGCGAATCTGCCTGAAATTTAATACGCCTTTTTATTTCC
3841 CTTCTGTGTTAAATCAAATGATCTGTTCTGCACTGAGCCAAGCAAGTTACTTTTAAAACTGGTGGCACCACTCATTTGGG
3921 ACTTGGAGACTGCTTTTATCCAGAACCTGTTAAGAGAACAGGGGATTTAAATACAAAGGAATATGAAGGTGGTGTGCCTT
4001 AAAGACAGTCTAAAATTAGGTTTTAGTTTGTTACATTATTTTGAAATATTAAACATGAAAATGTTAAATCAGGATGTGTG
4081 AGTTTTAAGATGTTGAACACTGTCCTACATCAGTGAGGAGGGAGGCAATAAAGTAATTTCAGAGTAAAACAGATTGAGGA
4161 TGAAACCAAGACAGAAGTGATGATTTGGCTTTTTATGATTTTTGCTGTGGAAATGGCAGTCGTGTGACTTTTCACTTGCA
4241 GTTTAAATGAAAGGGTGAAGAGAAGCCTACCTGCCCTAATGGCTCAGGGCTATATCCACCTCCCGGATAACCCTGGCCCT
4321 TGGGACTCCATCATCTCCTTGAAGTAGCACTGAGAATCCAAGAAGAGGCTCCGCTGCTTTTTGCACATGTTACTGAGTTA
4401 CATCTCAGGAAGATTTTTAAGCACGAGGAAGGAAAATACAGGCCTGGCCAAGCAGGGTCCCCTTTTCGGTATCATCTTTG
4481 TTCCTAATAAGCAATCAAGGGGGGTGGGTGTGTTGGCTGGTAAAGGAACTACTAAGATTCAGAAGCTTGTAGTCTTCATT
4561 ATTTTGTTTTACAGGTTAAAATAAACCACTTGACTGGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
1
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :|||||| 
Target 5' attGCACCACT---GCACTCCa 3'
1888 - 1906 140.00 -17.90
2
miRNA  3' guUUG---UGGUAACA----GUGUGAGGu 5'
            |||   ||||  ||    || ||||| 
Target 5' ctAACGTAACCACAGTAAAGCAGACTCCc 3'
2621 - 2649 126.00 -12.90
3
miRNA  3' guuUGUGGUAACAGUGUGAGGu 5'
             :||||| |   :||:||| 
Target 5' actGCACCACT---GCATTCCa 3'
2194 - 2212 124.00 -15.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20096920 28 COSMIC
COSN30110860 48 COSMIC
COSN31520088 59 COSMIC
COSN1243772 67 COSMIC
COSN17424299 97 COSMIC
COSN31536636 112 COSMIC
COSN59599 331 COSMIC
COSN17390148 411 COSMIC
COSN20090574 572 COSMIC
COSN20096926 1131 COSMIC
COSN27507793 1131 COSMIC
COSN9391722 1245 COSMIC
COSN10009539 1505 COSMIC
COSN5513200 1665 COSMIC
COSN14655324 1837 COSMIC
COSN29439053 1906 COSMIC
COSN20096928 2686 COSMIC
COSN16489865 2999 COSMIC
COSN23823467 3259 COSMIC
COSN1861504 3500 COSMIC
COSN22391686 3702 COSMIC
COSN26344279 3798 COSMIC
COSN21251285 4034 COSMIC
COSN20096930 4505 COSMIC
rs3731818 4123 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762826734 3 dbSNP
rs1252516413 4 dbSNP
rs1474202153 6 dbSNP
rs763753309 7 dbSNP
rs1418276745 11 dbSNP
rs1462868577 12 dbSNP
rs751515097 13 dbSNP
rs1352993935 14 dbSNP
rs1461506269 17 dbSNP
rs757088972 18 dbSNP
rs1453916342 19 dbSNP
rs780241456 22 dbSNP
rs1413451960 23 dbSNP
rs753913084 24 dbSNP
rs369951753 25 dbSNP
rs397985198 25 dbSNP
rs398080425 25 dbSNP
rs56274257 25 dbSNP
rs1356501848 26 dbSNP
rs200827695 26 dbSNP
rs754972541 28 dbSNP
rs755235910 28 dbSNP
rs199557485 32 dbSNP
rs1260513887 34 dbSNP
rs574795821 36 dbSNP
rs767141249 36 dbSNP
rs772518523 43 dbSNP
rs777941424 49 dbSNP
rs370735534 52 dbSNP
rs1252519594 53 dbSNP
rs886341534 68 dbSNP
rs1371445558 73 dbSNP
rs777972551 74 dbSNP
rs975663481 79 dbSNP
rs1028460591 84 dbSNP
rs1250875023 103 dbSNP
rs186223895 107 dbSNP
rs191101902 109 dbSNP
rs572387824 112 dbSNP
rs908275747 114 dbSNP
rs1257299444 129 dbSNP
rs1460758148 136 dbSNP
rs1475713992 137 dbSNP
rs1167759517 141 dbSNP
rs1371778999 158 dbSNP
rs141396917 159 dbSNP
rs992452337 165 dbSNP
rs1177310611 171 dbSNP
rs916918373 176 dbSNP
rs542992092 192 dbSNP
rs1034100586 227 dbSNP
rs34560672 235 dbSNP
rs35430542 235 dbSNP
rs564808680 236 dbSNP
rs1398971671 239 dbSNP
rs895342313 247 dbSNP
rs1044305872 253 dbSNP
rs1468332064 260 dbSNP
rs1274264021 265 dbSNP
rs1412950837 272 dbSNP
rs1315399167 276 dbSNP
rs1013695429 287 dbSNP
rs1354605284 289 dbSNP
rs1224428728 298 dbSNP
rs1025071316 299 dbSNP
rs1379158645 302 dbSNP
rs1301166046 306 dbSNP
rs1415104376 313 dbSNP
rs1295052361 318 dbSNP
rs750371226 322 dbSNP
rs978330410 323 dbSNP
rs1032767552 327 dbSNP
rs1052985274 334 dbSNP
rs958058166 335 dbSNP
rs975269934 338 dbSNP
rs921991016 339 dbSNP
rs1392661329 350 dbSNP
rs549566225 350 dbSNP
rs1192454418 352 dbSNP
rs1340814213 356 dbSNP
rs560937066 361 dbSNP
rs1268633793 363 dbSNP
rs1208314302 366 dbSNP
rs1485069578 370 dbSNP
rs1260394935 382 dbSNP
rs1217536952 383 dbSNP
rs1279098641 389 dbSNP
rs987314482 393 dbSNP
rs779489360 401 dbSNP
rs907685054 402 dbSNP
rs72936322 413 dbSNP
rs1428420913 419 dbSNP
rs1303283854 421 dbSNP
rs1037588660 438 dbSNP
rs369928287 452 dbSNP
rs1374892286 455 dbSNP
rs1421205708 458 dbSNP
rs1373238070 476 dbSNP
rs1432890457 477 dbSNP
rs1434780458 480 dbSNP
rs1028561844 488 dbSNP
rs550319502 492 dbSNP
rs1055981849 493 dbSNP
rs895582980 495 dbSNP
rs1261402622 506 dbSNP
rs746173122 510 dbSNP
rs1489431210 519 dbSNP
rs1255631778 529 dbSNP
rs1015803152 535 dbSNP
rs1345743982 540 dbSNP
rs1435171751 543 dbSNP
rs1304352907 544 dbSNP
rs756054561 553 dbSNP
rs961379679 555 dbSNP
rs992545881 558 dbSNP
rs1401588264 563 dbSNP
rs772466900 572 dbSNP
rs1296149569 582 dbSNP
rs182442447 583 dbSNP
rs1403638632 589 dbSNP
rs1174842946 592 dbSNP
rs1460967936 599 dbSNP
rs1231357266 602 dbSNP
rs902657724 605 dbSNP
rs1000222394 606 dbSNP
rs776013863 607 dbSNP
rs1213530952 613 dbSNP
rs1443076942 615 dbSNP
rs185540190 619 dbSNP
rs996177888 628 dbSNP
rs200100778 630 dbSNP
rs1258611675 633 dbSNP
rs1220266297 635 dbSNP
rs3178407 635 dbSNP
rs1206260918 646 dbSNP
rs1287639659 651 dbSNP
rs1292300470 655 dbSNP
rs528079036 655 dbSNP
rs1264401725 664 dbSNP
rs1028968662 665 dbSNP
rs1193076373 667 dbSNP
rs954793715 669 dbSNP
rs1455725750 671 dbSNP
rs1157146098 672 dbSNP
rs1361875683 673 dbSNP
rs1452717378 675 dbSNP
rs1289383039 677 dbSNP
rs1396474580 677 dbSNP
rs1390741692 682 dbSNP
rs1041163114 687 dbSNP
rs1467535233 694 dbSNP
rs1438154475 701 dbSNP
rs901150240 705 dbSNP
rs1473288629 711 dbSNP
rs996836725 712 dbSNP
rs1324610578 714 dbSNP
rs987514022 719 dbSNP
rs1238748537 723 dbSNP
rs1418532599 723 dbSNP
rs1049786758 736 dbSNP
rs907717686 738 dbSNP
rs147915682 739 dbSNP
rs868755537 739 dbSNP
rs1210208256 740 dbSNP
rs961896116 741 dbSNP
rs1358075829 746 dbSNP
rs973751809 750 dbSNP
rs1304348503 752 dbSNP
rs920510524 772 dbSNP
rs1005805869 774 dbSNP
rs937228266 775 dbSNP
rs374294480 778 dbSNP
rs1055407374 779 dbSNP
rs377436064 782 dbSNP
rs916877244 791 dbSNP
rs949813278 796 dbSNP
rs1013938689 798 dbSNP
rs1323362210 801 dbSNP
rs1406300507 801 dbSNP
rs1041442208 812 dbSNP
rs902722644 822 dbSNP
rs746529494 840 dbSNP
rs116965781 845 dbSNP
rs1253667449 848 dbSNP
rs894068786 854 dbSNP
rs996806627 858 dbSNP
rs1180575055 863 dbSNP
rs1247228996 865 dbSNP
rs1028999810 881 dbSNP
rs566473796 883 dbSNP
rs766166409 887 dbSNP
rs1199367789 888 dbSNP
rs546639164 893 dbSNP
rs1418357118 894 dbSNP
rs1281742507 901 dbSNP
rs1204113316 908 dbSNP
rs1353810855 909 dbSNP
rs116084878 912 dbSNP
rs957475990 913 dbSNP
rs1369495232 914 dbSNP
rs571120640 921 dbSNP
rs1164083275 922 dbSNP
rs11395 926 dbSNP
rs764864779 927 dbSNP
rs556946922 933 dbSNP
rs1399693849 946 dbSNP
rs1296098261 953 dbSNP
rs1040260806 962 dbSNP
rs1160573625 963 dbSNP
rs1432918992 975 dbSNP
rs1392391166 981 dbSNP
rs1290571390 982 dbSNP
rs1478886936 983 dbSNP
rs922674948 986 dbSNP
rs1192180752 987 dbSNP
rs1233238565 990 dbSNP
rs932763007 992 dbSNP
rs1208133983 994 dbSNP
rs574964428 996 dbSNP
rs1337050113 1000 dbSNP
rs1220260512 1001 dbSNP
rs1347739194 1004 dbSNP
rs1268858298 1012 dbSNP
rs1399750437 1020 dbSNP
rs991333815 1021 dbSNP
rs766613479 1027 dbSNP
rs751435515 1029 dbSNP
rs888463832 1029 dbSNP
rs916950472 1030 dbSNP
rs1413045861 1031 dbSNP
rs3088038 1032 dbSNP
rs1481070139 1036 dbSNP
rs1334755590 1040 dbSNP
rs1416157039 1046 dbSNP
rs1037306456 1047 dbSNP
rs1169761258 1049 dbSNP
rs897438393 1051 dbSNP
rs1425372225 1057 dbSNP
rs1041469389 1073 dbSNP
rs924369849 1081 dbSNP
rs59774838 1089 dbSNP
rs1485066811 1091 dbSNP
rs1237607926 1099 dbSNP
rs1211614470 1105 dbSNP
rs1474074438 1112 dbSNP
rs1491110132 1113 dbSNP
rs1491537575 1114 dbSNP
rs1271473756 1116 dbSNP
rs146088976 1116 dbSNP
rs569719164 1117 dbSNP
rs1284922748 1118 dbSNP
rs1450257407 1118 dbSNP
rs386390659 1118 dbSNP
rs537165087 1118 dbSNP
rs75522864 1118 dbSNP
rs1418403223 1119 dbSNP
rs1352711719 1127 dbSNP
rs1330546732 1130 dbSNP
rs11450641 1131 dbSNP
rs80236687 1131 dbSNP
rs75393642 1132 dbSNP
rs1162518181 1134 dbSNP
rs1053974358 1135 dbSNP
rs1167683252 1137 dbSNP
rs1183150389 1137 dbSNP
rs1468111931 1138 dbSNP
rs1024460622 1139 dbSNP
rs1198492806 1145 dbSNP
rs1458500748 1159 dbSNP
rs1260457811 1165 dbSNP
rs893925700 1170 dbSNP
rs996437511 1179 dbSNP
rs1290829575 1189 dbSNP
rs7598787 1203 dbSNP
rs1033056208 1212 dbSNP
rs190348090 1213 dbSNP
rs1447504370 1224 dbSNP
rs11548647 1226 dbSNP
rs754946828 1238 dbSNP
rs989110508 1240 dbSNP
rs764329813 1246 dbSNP
rs1457201103 1253 dbSNP
rs1350129621 1258 dbSNP
rs1166416843 1273 dbSNP
rs182889004 1274 dbSNP
rs1353972354 1279 dbSNP
rs1379088160 1291 dbSNP
rs1178700562 1296 dbSNP
rs548189430 1298 dbSNP
rs1440919631 1301 dbSNP
rs1240537610 1306 dbSNP
rs748372633 1311 dbSNP
rs1014905645 1323 dbSNP
rs1189889538 1326 dbSNP
rs1488337749 1333 dbSNP
rs897928221 1338 dbSNP
rs1223978186 1340 dbSNP
rs1315336390 1341 dbSNP
rs1285489925 1353 dbSNP
rs753966391 1356 dbSNP
rs1020181573 1358 dbSNP
rs965985679 1359 dbSNP
rs1386036648 1360 dbSNP
rs1367957857 1379 dbSNP
rs975911932 1383 dbSNP
rs1027498414 1386 dbSNP
rs1428280470 1396 dbSNP
rs1359492383 1402 dbSNP
rs1294515360 1405 dbSNP
rs921766513 1411 dbSNP
rs1420961135 1416 dbSNP
rs1382721882 1419 dbSNP
rs958778453 1425 dbSNP
rs1381958521 1426 dbSNP
rs1174498011 1430 dbSNP
rs932690813 1441 dbSNP
rs1268567065 1442 dbSNP
rs1386941002 1449 dbSNP
rs757561892 1459 dbSNP
rs1487455806 1465 dbSNP
rs1272338722 1467 dbSNP
rs985577122 1473 dbSNP
rs991407376 1478 dbSNP
rs576679404 1486 dbSNP
rs1206920345 1503 dbSNP
rs971063817 1518 dbSNP
rs1232365157 1520 dbSNP
rs1312683636 1521 dbSNP
rs977067911 1525 dbSNP
rs1278388740 1533 dbSNP
rs567610814 1536 dbSNP
rs1339495067 1538 dbSNP
rs935765865 1549 dbSNP
rs1401314750 1554 dbSNP
rs1373038903 1560 dbSNP
rs1037465813 1577 dbSNP
rs1186952612 1583 dbSNP
rs1258207032 1587 dbSNP
rs897402505 1590 dbSNP
rs950340725 1595 dbSNP
rs1045836570 1597 dbSNP
rs1423224089 1622 dbSNP
rs544091779 1624 dbSNP
rs915445234 1629 dbSNP
rs138075448 1634 dbSNP
rs1418201023 1635 dbSNP
rs932134814 1636 dbSNP
rs534726191 1638 dbSNP
rs890724499 1641 dbSNP
rs1009897489 1652 dbSNP
rs1373238337 1660 dbSNP
rs1434557006 1661 dbSNP
rs1020001207 1662 dbSNP
rs1361450155 1664 dbSNP
rs1429279998 1665 dbSNP
rs944917372 1667 dbSNP
rs1403572117 1671 dbSNP
rs1036369158 1675 dbSNP
rs1270078655 1679 dbSNP
rs965913887 1680 dbSNP
rs1028803457 1682 dbSNP
rs897787712 1689 dbSNP
rs1171810953 1690 dbSNP
rs1478961362 1697 dbSNP
rs1432372283 1701 dbSNP
rs1366903332 1707 dbSNP
rs994966749 1710 dbSNP
rs1424420127 1712 dbSNP
rs953212828 1719 dbSNP
rs1176640318 1724 dbSNP
rs1457254836 1729 dbSNP
rs1258547213 1734 dbSNP
rs1028153912 1740 dbSNP
rs373664361 1741 dbSNP
rs894338453 1748 dbSNP
rs1264449454 1750 dbSNP
rs1244927004 1758 dbSNP
rs1301606247 1759 dbSNP
rs539044301 1769 dbSNP
rs367806115 1770 dbSNP
rs1012688046 1771 dbSNP
rs1024061547 1772 dbSNP
rs1445288758 1779 dbSNP
rs143779329 1795 dbSNP
rs529877432 1799 dbSNP
rs1332506053 1802 dbSNP
rs1031342555 1809 dbSNP
rs147190880 1816 dbSNP
rs1443887209 1823 dbSNP
rs1213583442 1828 dbSNP
rs1458477705 1830 dbSNP
rs188754885 1832 dbSNP
rs746239230 1835 dbSNP
rs553479296 1836 dbSNP
rs1238694486 1838 dbSNP
rs1392938474 1839 dbSNP
rs918588927 1840 dbSNP
rs4832024 1841 dbSNP
rs1045975378 1842 dbSNP
rs920994513 1864 dbSNP
rs932361971 1874 dbSNP
rs986316331 1884 dbSNP
rs747532266 1885 dbSNP
rs193290586 1886 dbSNP
rs4832251 1891 dbSNP
rs1437441615 1892 dbSNP
rs1367649381 1897 dbSNP
rs550431277 1913 dbSNP
rs1419122962 1922 dbSNP
rs1037014836 1928 dbSNP
rs1160319154 1929 dbSNP
rs897867429 1933 dbSNP
rs930623745 1936 dbSNP
rs1376913036 1943 dbSNP
rs568686570 1958 dbSNP
rs1199295148 1963 dbSNP
rs1453008770 1970 dbSNP
rs138308935 1978 dbSNP
rs371532684 1978 dbSNP
rs1370576974 1986 dbSNP
rs367752860 1988 dbSNP
rs1488308698 1990 dbSNP
rs894575376 1992 dbSNP
rs536018001 1997 dbSNP
rs1235335431 2007 dbSNP
rs1012928397 2016 dbSNP
rs901523262 2027 dbSNP
rs1274676633 2031 dbSNP
rs148032485 2041 dbSNP
rs1347646260 2055 dbSNP
rs1346870331 2058 dbSNP
rs997412345 2064 dbSNP
rs1283551103 2065 dbSNP
rs1465276708 2067 dbSNP
rs1045542983 2068 dbSNP
rs1250633148 2074 dbSNP
rs1172991683 2079 dbSNP
rs1467601117 2092 dbSNP
rs1028898400 2094 dbSNP
rs780746739 2100 dbSNP
rs907013045 2103 dbSNP
rs1477869183 2105 dbSNP
rs554085658 2108 dbSNP
rs998817808 2109 dbSNP
rs1278477918 2110 dbSNP
rs1016548341 2117 dbSNP
rs1326021960 2118 dbSNP
rs1032004452 2120 dbSNP
rs957084850 2125 dbSNP
rs1218317758 2135 dbSNP
rs1011646334 2136 dbSNP
rs1272037733 2137 dbSNP
rs972798084 2140 dbSNP
rs1027965490 2141 dbSNP
rs1470836068 2145 dbSNP
rs918557870 2150 dbSNP
rs953778881 2160 dbSNP
rs1169676414 2166 dbSNP
rs1409416923 2180 dbSNP
rs565794917 2186 dbSNP
rs140466363 2188 dbSNP
rs1393857498 2199 dbSNP
rs927536436 2200 dbSNP
rs1472155670 2203 dbSNP
rs1237417597 2204 dbSNP
rs1441650116 2209 dbSNP
rs1188789655 2211 dbSNP
rs557877896 2216 dbSNP
rs1256630551 2218 dbSNP
rs966196314 2219 dbSNP
rs1336816559 2220 dbSNP
rs1054590924 2222 dbSNP
rs182501604 2229 dbSNP
rs1226712984 2230 dbSNP
rs1378441011 2242 dbSNP
rs1041508575 2245 dbSNP
rs1447188013 2245 dbSNP
rs1454568685 2245 dbSNP
rs76195032 2245 dbSNP
rs945787999 2245 dbSNP
rs74483912 2246 dbSNP
rs545681637 2256 dbSNP
rs1162185161 2257 dbSNP
rs1028864742 2258 dbSNP
rs1413968490 2272 dbSNP
rs997169701 2278 dbSNP
rs1447015314 2285 dbSNP
rs1236857160 2288 dbSNP
rs575795908 2292 dbSNP
rs1050120090 2294 dbSNP
rs889038480 2304 dbSNP
rs1219572914 2306 dbSNP
rs746172668 2308 dbSNP
rs543440309 2310 dbSNP
rs543260342 2312 dbSNP
rs1016066827 2318 dbSNP
rs1233856478 2318 dbSNP
rs962200494 2321 dbSNP
rs994189878 2325 dbSNP
rs1435402101 2326 dbSNP
rs556396566 2329 dbSNP
rs930884107 2330 dbSNP
rs1049550321 2331 dbSNP
rs1417263866 2336 dbSNP
rs971483477 2339 dbSNP
rs561437833 2343 dbSNP
rs953257940 2346 dbSNP
rs927288557 2348 dbSNP
rs1189836026 2349 dbSNP
rs72936327 2352 dbSNP
rs1045786425 2364 dbSNP
rs1224862061 2372 dbSNP
rs1487311984 2373 dbSNP
rs1285242001 2384 dbSNP
rs554210040 2384 dbSNP
rs541969999 2390 dbSNP
rs1298979364 2411 dbSNP
rs1218401697 2412 dbSNP
rs990819715 2414 dbSNP
rs560094493 2420 dbSNP
rs1397591777 2428 dbSNP
rs114301836 2435 dbSNP
rs1454824585 2448 dbSNP
rs924552752 2450 dbSNP
rs1347431527 2459 dbSNP
rs999077008 2460 dbSNP
rs1186437814 2461 dbSNP
rs1417771473 2463 dbSNP
rs1432926891 2464 dbSNP
rs1053071801 2467 dbSNP
rs893061679 2469 dbSNP
rs977613514 2470 dbSNP
rs1462087592 2478 dbSNP
rs376223709 2480 dbSNP
rs923005260 2483 dbSNP
rs1262656835 2485 dbSNP
rs1205762140 2489 dbSNP
rs1165055964 2490 dbSNP
rs933093811 2493 dbSNP
rs564206810 2494 dbSNP
rs1011452839 2506 dbSNP
rs1027999196 2523 dbSNP
rs1050052609 2524 dbSNP
rs531312900 2539 dbSNP
rs77561694 2544 dbSNP
rs759617995 2545 dbSNP
rs866644895 2557 dbSNP
rs1019354734 2558 dbSNP
rs1339440842 2559 dbSNP
rs966263811 2565 dbSNP
rs1278320966 2570 dbSNP
rs1383366516 2581 dbSNP
rs1364737665 2588 dbSNP
rs1301536192 2594 dbSNP
rs972653047 2595 dbSNP
rs1291432286 2596 dbSNP
rs1179029068 2599 dbSNP
rs1354723215 2599 dbSNP
rs919411701 2605 dbSNP
rs941930694 2610 dbSNP
rs952402715 2611 dbSNP
rs985027562 2613 dbSNP
rs767050023 2614 dbSNP
rs1461701502 2621 dbSNP
rs1194893964 2622 dbSNP
rs948722005 2626 dbSNP
rs1196493448 2631 dbSNP
rs532065162 2633 dbSNP
rs1209163026 2635 dbSNP
rs1228981513 2647 dbSNP
rs115845566 2648 dbSNP
rs934734232 2649 dbSNP
rs371971748 2650 dbSNP
rs993277575 2655 dbSNP
rs1024798007 2661 dbSNP
rs1190173422 2664 dbSNP
rs1339166123 2667 dbSNP
rs1444968708 2668 dbSNP
rs769591351 2668 dbSNP
rs773229505 2668 dbSNP
rs1176578997 2669 dbSNP
rs1442106385 2669 dbSNP
rs1457101763 2669 dbSNP
rs1491483686 2669 dbSNP
rs34710000 2669 dbSNP
rs397871348 2669 dbSNP
rs749254778 2669 dbSNP
rs751406832 2669 dbSNP
rs934574272 2669 dbSNP
rs75417819 2670 dbSNP
rs1053364580 2681 dbSNP
rs749961308 2682 dbSNP
rs1353819561 2683 dbSNP
rs1475093968 2684 dbSNP
rs1002920717 2685 dbSNP
rs1238430806 2686 dbSNP
rs1360825254 2686 dbSNP
rs947325409 2686 dbSNP
rs1335482796 2688 dbSNP
rs62147751 2688 dbSNP
rs989973524 2689 dbSNP
rs1372641519 2690 dbSNP
rs1431457800 2693 dbSNP
rs889477644 2702 dbSNP
rs372495859 2715 dbSNP
rs529570425 2716 dbSNP
rs1396563682 2727 dbSNP
rs1007883146 2732 dbSNP
rs958976435 2740 dbSNP
rs1314717127 2742 dbSNP
rs1364236746 2749 dbSNP
rs1438993957 2749 dbSNP
rs1183686330 2753 dbSNP
rs990189079 2758 dbSNP
rs1324183387 2766 dbSNP
rs550305023 2772 dbSNP
rs896918547 2775 dbSNP
rs187980017 2779 dbSNP
rs191507832 2785 dbSNP
rs923438731 2792 dbSNP
rs1350584457 2795 dbSNP
rs541258620 2809 dbSNP
rs1047125 2815 dbSNP
rs986299706 2831 dbSNP
rs1329587102 2834 dbSNP
rs1282812148 2835 dbSNP
rs774082311 2837 dbSNP
rs765406151 2839 dbSNP
rs1483757836 2842 dbSNP
rs1296417383 2843 dbSNP
rs985048734 2850 dbSNP
rs1023156045 2867 dbSNP
rs146175068 2870 dbSNP
rs970061370 2870 dbSNP
rs184027221 2871 dbSNP
rs1476898174 2874 dbSNP
rs981421295 2876 dbSNP
rs1202723307 2879 dbSNP
rs1260179859 2881 dbSNP
rs941675016 2882 dbSNP
rs1037401490 2886 dbSNP
rs755688877 2888 dbSNP
rs188694830 2891 dbSNP
rs1189279306 2904 dbSNP
rs928613462 2906 dbSNP
rs929264104 2913 dbSNP
rs1046181140 2914 dbSNP
rs569836412 2920 dbSNP
rs1392308080 2921 dbSNP
rs779125551 2922 dbSNP
rs1002888237 2924 dbSNP
rs1347588295 2925 dbSNP
rs1276442966 2934 dbSNP
rs575619760 2937 dbSNP
rs76572207 2942 dbSNP
rs1326990226 2944 dbSNP
rs1320135194 2957 dbSNP
rs894587268 2958 dbSNP
rs988902099 2963 dbSNP
rs1176876748 2964 dbSNP
rs1173200865 2990 dbSNP
rs1420991057 2998 dbSNP
rs1192327326 3007 dbSNP
rs529856259 3009 dbSNP
rs8982 3010 dbSNP
rs1304516541 3012 dbSNP
rs1021664874 3038 dbSNP
rs1242965640 3039 dbSNP
rs1433779897 3041 dbSNP
rs1204690185 3043 dbSNP
rs1320605027 3044 dbSNP
rs1366692692 3050 dbSNP
rs1256355715 3059 dbSNP
rs2278084 3060 dbSNP
rs889718845 3071 dbSNP
rs943910271 3077 dbSNP
rs977680506 3077 dbSNP
rs1381905835 3082 dbSNP
rs1040738699 3086 dbSNP
rs896786576 3088 dbSNP
rs1397712295 3092 dbSNP
rs1169226716 3095 dbSNP
rs1313160308 3099 dbSNP
rs542567604 3102 dbSNP
rs574626537 3102 dbSNP
rs1160917483 3104 dbSNP
rs192150285 3111 dbSNP
rs554073947 3112 dbSNP
rs1184622735 3114 dbSNP
rs1462879274 3116 dbSNP
rs566677358 3118 dbSNP
rs910281497 3122 dbSNP
rs370032097 3132 dbSNP
rs1209482245 3139 dbSNP
rs1438608592 3141 dbSNP
rs1275258407 3153 dbSNP
rs1410135728 3159 dbSNP
rs1006333442 3163 dbSNP
rs546050627 3165 dbSNP
rs1467151649 3168 dbSNP
rs1247907353 3179 dbSNP
rs1374458594 3206 dbSNP
rs1193257349 3212 dbSNP
rs1297388914 3215 dbSNP
rs1023061145 3222 dbSNP
rs973476419 3224 dbSNP
rs547003931 3225 dbSNP
rs564144031 3227 dbSNP
rs981625612 3229 dbSNP
rs576222784 3232 dbSNP
rs1385161272 3241 dbSNP
rs1164705310 3246 dbSNP
rs1177949475 3246 dbSNP
rs1362032655 3249 dbSNP
rs1456670003 3250 dbSNP
rs956061828 3254 dbSNP
rs1491555686 3255 dbSNP
rs1491128115 3256 dbSNP
rs989324322 3260 dbSNP
rs1234771607 3263 dbSNP
rs914648293 3267 dbSNP
rs1220394454 3271 dbSNP
rs1490188069 3273 dbSNP
rs144482176 3278 dbSNP
rs1224712799 3279 dbSNP
rs767123067 3285 dbSNP
rs7606402 3289 dbSNP
rs1046316391 3299 dbSNP
rs760570465 3300 dbSNP
rs369688328 3302 dbSNP
rs1375112519 3303 dbSNP
rs1272646749 3310 dbSNP
rs1292656919 3314 dbSNP
rs911017121 3316 dbSNP
rs1388935063 3317 dbSNP
rs943946215 3319 dbSNP
rs1365717143 3325 dbSNP
rs937827361 3326 dbSNP
rs1427156723 3327 dbSNP
rs1305266362 3338 dbSNP
rs1335500321 3343 dbSNP
rs1201656350 3346 dbSNP
rs1269743063 3346 dbSNP
rs1480230218 3346 dbSNP
rs1484864479 3346 dbSNP
rs747037460 3346 dbSNP
rs948829807 3346 dbSNP
rs1229568345 3353 dbSNP
rs1260029499 3355 dbSNP
rs1270515023 3356 dbSNP
rs1318439451 3357 dbSNP
rs1222599082 3358 dbSNP
rs1040977247 3359 dbSNP
rs1332771709 3359 dbSNP
rs1213136210 3360 dbSNP
rs528930370 3360 dbSNP
rs10194887 3361 dbSNP
rs59832078 3361 dbSNP
rs79198208 3361 dbSNP
rs1178715323 3362 dbSNP
rs1266318602 3362 dbSNP
rs1489571759 3363 dbSNP
rs59476187 3364 dbSNP
rs1426740266 3365 dbSNP
rs1187092580 3366 dbSNP
rs1260971218 3366 dbSNP
rs918287811 3370 dbSNP
rs1486802446 3373 dbSNP
rs1248177591 3374 dbSNP
rs1202776795 3385 dbSNP
rs1323842398 3386 dbSNP
rs1472109304 3387 dbSNP
rs1224620341 3389 dbSNP
rs929640733 3392 dbSNP
rs894546800 3393 dbSNP
rs1383309013 3405 dbSNP
rs1364671208 3419 dbSNP
rs772637944 3421 dbSNP
rs1011660874 3424 dbSNP
rs1048647570 3431 dbSNP
rs1043418788 3435 dbSNP
rs1407115431 3442 dbSNP
rs1338875920 3459 dbSNP
rs1459470283 3460 dbSNP
rs779501913 3471 dbSNP
rs760263702 3481 dbSNP
rs1372639739 3486 dbSNP
rs1163438311 3489 dbSNP
rs369619786 3493 dbSNP
rs71874029 3493 dbSNP
rs999086464 3506 dbSNP
rs184693198 3511 dbSNP
rs1296038249 3512 dbSNP
rs1030571670 3513 dbSNP
rs1370346733 3515 dbSNP
rs1193776812 3516 dbSNP
rs888216312 3530 dbSNP
rs1251435056 3536 dbSNP
rs1410747828 3553 dbSNP
rs1228910167 3555 dbSNP
rs781628328 3558 dbSNP
rs1011928423 3561 dbSNP
rs1044549828 3563 dbSNP
rs906032120 3574 dbSNP
rs1245713706 3577 dbSNP
rs1384063419 3581 dbSNP
rs372892884 3585 dbSNP
rs72936330 3587 dbSNP
rs956261857 3601 dbSNP
rs1396018627 3607 dbSNP
rs531663536 3613 dbSNP
rs374166017 3615 dbSNP
rs796790296 3615 dbSNP
rs533320960 3616 dbSNP
rs769335260 3617 dbSNP
rs142501359 3622 dbSNP
rs749030501 3627 dbSNP
rs968790123 3635 dbSNP
rs569772604 3645 dbSNP
rs1250908480 3647 dbSNP
rs770488703 3649 dbSNP
rs911094270 3659 dbSNP
rs1205597568 3661 dbSNP
rs1253955433 3663 dbSNP
rs115393590 3671 dbSNP
rs1287643076 3672 dbSNP
rs1222482894 3674 dbSNP
rs937980603 3682 dbSNP
rs1348619618 3683 dbSNP
rs1237279073 3686 dbSNP
rs76096409 3689 dbSNP
rs1307898364 3693 dbSNP
rs10174095 3711 dbSNP
rs947432599 3715 dbSNP
rs1302623124 3721 dbSNP
rs1424978919 3728 dbSNP
rs775524322 3730 dbSNP
rs190326681 3734 dbSNP
rs1430861841 3735 dbSNP
rs1452697004 3742 dbSNP
rs1310214765 3745 dbSNP
rs1183605324 3746 dbSNP
rs1048077708 3757 dbSNP
rs998844248 3762 dbSNP
rs1199475976 3765 dbSNP
rs909513162 3767 dbSNP
rs1292601520 3773 dbSNP
rs890709550 3778 dbSNP
rs765406400 3788 dbSNP
rs1044790075 3790 dbSNP
rs1230540914 3797 dbSNP
rs1447974708 3802 dbSNP
rs1343840954 3805 dbSNP
rs1303877684 3806 dbSNP
rs906063220 3810 dbSNP
rs1018160618 3814 dbSNP
rs1332763499 3815 dbSNP
rs750453880 3827 dbSNP
rs115294321 3828 dbSNP
rs1161061721 3830 dbSNP
rs950503271 3830 dbSNP
rs766443840 3846 dbSNP
rs1010862868 3847 dbSNP
rs1021633253 3849 dbSNP
rs1343115612 3851 dbSNP
rs1034649203 3854 dbSNP
rs751944218 3865 dbSNP
rs150937914 3869 dbSNP
rs1276543845 3870 dbSNP
rs1446926854 3871 dbSNP
rs959515289 3881 dbSNP
rs990766755 3883 dbSNP
rs915038122 3887 dbSNP
rs1321711081 3889 dbSNP
rs539610559 3890 dbSNP
rs1224216684 3891 dbSNP
rs1347287679 3892 dbSNP
rs1268485911 3896 dbSNP
rs1226651485 3908 dbSNP
rs1209345951 3923 dbSNP
rs557994213 3933 dbSNP
rs778164324 3933 dbSNP
rs1404912008 3935 dbSNP
rs1018355859 3947 dbSNP
rs1336919003 3949 dbSNP
rs965236840 3953 dbSNP
rs1416856552 3960 dbSNP
rs3731819 3960 dbSNP
rs1166777200 3961 dbSNP
rs1483985329 3965 dbSNP
rs1475403237 3970 dbSNP
rs1374089079 3971 dbSNP
rs924682812 3977 dbSNP
rs1184245425 3992 dbSNP
rs139407281 4002 dbSNP
rs1051727134 4010 dbSNP
rs1204619536 4011 dbSNP
rs1271025563 4016 dbSNP
rs890469927 4016 dbSNP
rs951333865 4030 dbSNP
rs1214006635 4031 dbSNP
rs1170044894 4033 dbSNP
rs1393675516 4050 dbSNP
rs1340030078 4051 dbSNP
rs1299651393 4057 dbSNP
rs1243520323 4064 dbSNP
rs1414198182 4067 dbSNP
rs1315467115 4077 dbSNP
rs879593372 4083 dbSNP
rs753253011 4086 dbSNP
rs1352379341 4088 dbSNP
rs1327631779 4090 dbSNP
rs1409972860 4094 dbSNP
rs909591418 4095 dbSNP
rs1371727600 4098 dbSNP
rs947705612 4099 dbSNP
rs1428783628 4100 dbSNP
rs1443322280 4103 dbSNP
rs879148483 4108 dbSNP
rs943594143 4109 dbSNP
rs1182777574 4112 dbSNP
rs79687500 4119 dbSNP
rs3731818 4123 dbSNP
rs1301443881 4126 dbSNP
rs994957842 4129 dbSNP
rs555172824 4140 dbSNP
rs939073795 4143 dbSNP
rs182506398 4146 dbSNP
rs891923210 4156 dbSNP
rs777411265 4157 dbSNP
rs748683909 4161 dbSNP
rs559584095 4162 dbSNP
rs747022325 4168 dbSNP
rs1313858437 4173 dbSNP
rs147932252 4174 dbSNP
rs60759787 4174 dbSNP
rs111535600 4177 dbSNP
rs1026478646 4178 dbSNP
rs1246905931 4179 dbSNP
rs1278530352 4190 dbSNP
rs1442465417 4198 dbSNP
rs1351870373 4199 dbSNP
rs533453458 4207 dbSNP
rs1423344999 4211 dbSNP
rs904549364 4214 dbSNP
rs187312531 4216 dbSNP
rs1190116563 4218 dbSNP
rs1006884143 4222 dbSNP
rs563535698 4223 dbSNP
rs901277594 4226 dbSNP
rs1173507177 4227 dbSNP
rs990917913 4230 dbSNP
rs867740766 4246 dbSNP
rs1490173168 4251 dbSNP
rs1269465072 4267 dbSNP
rs1427917958 4270 dbSNP
rs1314967652 4271 dbSNP
rs1283288123 4275 dbSNP
rs1025484865 4276 dbSNP
rs1224032194 4279 dbSNP
rs1330742059 4286 dbSNP
rs1280829655 4287 dbSNP
rs951286937 4289 dbSNP
rs1403750344 4291 dbSNP
rs968405940 4295 dbSNP
rs531172747 4300 dbSNP
rs116674652 4305 dbSNP
rs969247454 4306 dbSNP
rs1458823536 4319 dbSNP
rs866741443 4327 dbSNP
rs1414402351 4329 dbSNP
rs1174411136 4336 dbSNP
rs1324212434 4338 dbSNP
rs1480113433 4340 dbSNP
rs1268127760 4347 dbSNP
rs1330726969 4348 dbSNP
rs567777412 4349 dbSNP
rs540562851 4357 dbSNP
rs189328492 4358 dbSNP
rs987571490 4360 dbSNP
rs1226513863 4365 dbSNP
rs772030911 4372 dbSNP
rs547034535 4373 dbSNP
rs913442511 4374 dbSNP
rs368933077 4378 dbSNP
rs565066682 4387 dbSNP
rs946190856 4387 dbSNP
rs145468956 4392 dbSNP
rs565941725 4395 dbSNP
rs1221475911 4396 dbSNP
rs1287364848 4401 dbSNP
rs1360465534 4401 dbSNP
rs1288678815 4405 dbSNP
rs1436227462 4408 dbSNP
rs1391115304 4410 dbSNP
rs775399783 4423 dbSNP
rs539749592 4425 dbSNP
rs373688348 4426 dbSNP
rs1450656673 4435 dbSNP
rs942907831 4442 dbSNP
rs1199084964 4449 dbSNP
rs1047849169 4451 dbSNP
rs1248839619 4452 dbSNP
rs1378320951 4453 dbSNP
rs747000170 4458 dbSNP
rs768471603 4463 dbSNP
rs373213862 4465 dbSNP
rs1418649526 4468 dbSNP
rs1039729252 4469 dbSNP
rs1451032242 4471 dbSNP
rs1413333366 4472 dbSNP
rs1393096690 4473 dbSNP
rs1202716951 4485 dbSNP
rs1034759583 4488 dbSNP
rs894918714 4492 dbSNP
rs558131672 4495 dbSNP
rs200435774 4497 dbSNP
rs1306300233 4499 dbSNP
rs397985199 4499 dbSNP
rs58330825 4499 dbSNP
rs1390336951 4501 dbSNP
rs1229621186 4503 dbSNP
rs1406202904 4505 dbSNP
rs569741636 4514 dbSNP
rs901136090 4517 dbSNP
rs1313329745 4519 dbSNP
rs967920033 4521 dbSNP
rs998320176 4524 dbSNP
rs868708755 4527 dbSNP
rs1407761871 4528 dbSNP
rs1353869920 4532 dbSNP
rs537287088 4533 dbSNP
rs886974532 4534 dbSNP
rs773346007 4537 dbSNP
rs1229743314 4542 dbSNP
rs955172562 4553 dbSNP
rs1281959078 4555 dbSNP
rs986659988 4559 dbSNP
rs1210073409 4567 dbSNP
rs1274721766 4577 dbSNP
rs1291493363 4577 dbSNP
rs1206552139 4586 dbSNP
rs1344906588 4587 dbSNP
rs866160748 4593 dbSNP
rs1244463733 4597 dbSNP
rs911972314 4598 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000254630.7 | 3UTR | CUAGGAGAGGGAGGUUGCAGUGAGCCGUGAUUGCACCACUGCACUCCAGCCUGGGCAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.627 1.1e-2 0.676 5.6e-3 13 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.394 2.6e-2 0.214 1.5e-1 25 Click to see details
GSE21849 B cell lymphoma 0.301 5.6e-2 0.192 1.6e-1 29 Click to see details
GSE19350 CNS germ cell tumors -0.429 8.2e-2 -0.094 3.9e-1 12 Click to see details
GSE17498 Multiple myeloma -0.189 1.2e-1 -0.260 5.3e-2 40 Click to see details
GSE42095 Differentiated embryonic stem cells 0.212 1.7e-1 -0.085 3.5e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.222 1.7e-1 -0.080 3.7e-1 20 Click to see details
GSE38226 Liver fibrosis 0.187 2.1e-1 -0.014 4.8e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.38 2.3e-1 0.600 1.0e-1 6 Click to see details
GSE17306 Multiple myeloma 0.074 3.1e-1 0.179 1.1e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.077 3.4e-1 0.141 2.2e-1 32 Click to see details
GSE27834 Pluripotent stem cells -0.107 3.5e-1 -0.282 1.4e-1 16 Click to see details
GSE28544 Breast cancer -0.084 3.5e-1 -0.015 4.7e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.044 3.6e-1 -0.051 3.4e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells 0.063 3.8e-1 0.138 2.6e-1 24 Click to see details
GSE14794 Lymphoblastoid cells 0.015 4.4e-1 0.057 3.0e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.021 4.6e-1 0.007 4.9e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.56 0.06 0.683 0.02 9 Click to see details
LIHC 0.224 0.06 0.255 0.04 49 Click to see details
HNSC 0.978 0.07 0.500 0.33 3 Click to see details
STAD -0.538 0.08 -0.738 0.02 8 Click to see details
THCA 0.58 0.15 0.600 0.14 5 Click to see details
KICH -0.399 0.16 -0.333 0.21 8 Click to see details
KIRP -0.134 0.37 0.350 0.18 9 Click to see details
ESCA 0.049 0.47 0.000 0.5 5 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
KIRC 0.012 0.48 0.081 0.34 29 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
534 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 3 1
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 4 2
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 4 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023396 PKM pyruvate kinase, muscle 5 3
MIRT023398 CLIC4 chloride intracellular channel 4 4 4
MIRT023403 CDK4 cyclin dependent kinase 4 2 2
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 2 2
MIRT023233 RNF170 ring finger protein 170 2 2
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 2 2
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 2 2
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 2 2
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 2 2
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 2 3
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023397 FOXK2 forkhead box K2 2 2
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 2 3
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 1 2
MIRT324745 ACER2 alkaline ceramidase 2 1 1
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 1
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 1 1
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 1 1
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 1 1
MIRT454232 OSBPL10 oxysterol binding protein like 10 1 7
MIRT454344 CDKL1 cyclin dependent kinase like 1 1 1
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 6
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 1 1
MIRT461934 TNFSF14 TNF superfamily member 14 1 1
MIRT463834 WSB1 WD repeat and SOCS box containing 1 1 1
MIRT468615 SUMO1 small ubiquitin-like modifier 1 1 1
MIRT469456 REL REL proto-oncogene, NF-kB subunit 1 3
MIRT469637 RAD21 RAD21 cohesin complex component 1 3
MIRT473432 MDM4 MDM4, p53 regulator 1 1
MIRT473872 MAFK MAF bZIP transcription factor K 1 3
MIRT476861 FHL2 four and a half LIM domains 2 1 2
MIRT476893 FBXO21 F-box protein 21 1 1
MIRT479880 CCDC43 coiled-coil domain containing 43 1 1
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT491164 LRP3 LDL receptor related protein 3 1 1
MIRT497662 PRMT3 protein arginine methyltransferase 3 1 1
MIRT499314 ZNF485 zinc finger protein 485 1 5
MIRT499759 CIRH1A UTP4, small subunit processome component 1 5
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 1 4
MIRT501090 SLC7A5 solute carrier family 7 member 5 1 2
MIRT509646 ZNF354B zinc finger protein 354B 1 5
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 1 3
MIRT510320 SLC2A3 solute carrier family 2 member 3 1 2
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 1 1
MIRT516410 COPA coatomer protein complex subunit alpha 1 1
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 1 2
MIRT522558 MCAM melanoma cell adhesion molecule 1 2
MIRT523525 GLUL glutamate-ammonia ligase 1 1
MIRT523764 FBXO27 F-box protein 27 1 2
MIRT524517 CDK19 cyclin dependent kinase 19 1 1
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 1 3
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 2
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 1 1
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 1 2
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 1 1
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 1 1
MIRT533115 YIPF4 Yip1 domain family member 4 1 2
MIRT534740 RBM47 RNA binding motif protein 47 1 1
MIRT535471 PARVB parvin beta 1 2
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 1 1
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 1 2
MIRT540438 RBM43 RNA binding motif protein 43 1 1
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 1 1
MIRT549514 HDDC2 HD domain containing 2 1 1
MIRT549663 ORC6 origin recognition complex subunit 6 1 2
MIRT555420 PPIC peptidylprolyl isomerase C 1 1
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 1 1
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 1 1
MIRT570257 PRSS16 protease, serine 16 1 1
MIRT571143 HM13 histocompatibility minor 13 1 1
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 1 1
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1 1
MIRT575302 Osbpl10 oxysterol binding protein-like 10 1 1
MIRT575323 Fbxo6 F-box protein 6 1 1
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 1 1
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 1 1
MIRT575671 Map1b microtubule-associated protein 1B 1 1
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 1 1
MIRT607490 HEBP2 heme binding protein 2 1 1
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 1 1
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT607795 RHBDL2 rhomboid like 2 1 1
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 1 1
MIRT607927 ANG angiogenin 1 1
MIRT607966 SNX22 sorting nexin 22 1 1
MIRT608074 ZFP14 ZFP14 zinc finger protein 1 1
MIRT608141 SYAP1 synapse associated protein 1 1 1
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT617444 CCS copper chaperone for superoxide dismutase 1 1
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 1 1
MIRT618772 HLA-E major histocompatibility complex, class I, E 1 1
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT620091 YME1L1 YME1 like 1 ATPase 1 1
MIRT620483 XKR6 XK related 6 1 1
MIRT620570 WBSCR27 methyltransferase like 27 1 2
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT624165 DGKE diacylglycerol kinase epsilon 1 1
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 1 1
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 1 1
MIRT625694 OPTN optineurin 1 1
MIRT626093 MKLN1 muskelin 1 1 1
MIRT626431 CHDH choline dehydrogenase 1 1
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT627077 SF3A1 splicing factor 3a subunit 1 1 1
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 1 1
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 1 1
MIRT627420 THAP2 THAP domain containing 2 1 1
MIRT627441 TAS2R5 taste 2 receptor member 5 1 1
MIRT628078 KAT7 lysine acetyltransferase 7 1 2
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT629094 F2RL1 F2R like trypsin receptor 1 1 1
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 1 1
MIRT629286 UNC13A unc-13 homolog A 1 1
MIRT629407 ADM2 adrenomedullin 2 1 1
MIRT629584 RFC2 replication factor C subunit 2 1 1
MIRT629635 WDR31 WD repeat domain 31 1 1
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 1 1
MIRT629984 NARS asparaginyl-tRNA synthetase 1 1
MIRT630043 TERF2 telomeric repeat binding factor 2 1 1
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 1 1
MIRT630252 SMTNL2 smoothelin like 2 1 1
MIRT630278 PSMB5 proteasome subunit beta 5 1 1
MIRT630347 NKAP NFKB activating protein 1 1
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 1 1
MIRT631264 CENPM centromere protein M 1 1
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 1 1
MIRT632470 RPS15A ribosomal protein S15a 1 1
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT632994 DUSP18 dual specificity phosphatase 18 1 1
MIRT633082 CXorf21 chromosome X open reading frame 21 1 1
MIRT633239 ZNF573 zinc finger protein 573 1 1
MIRT633286 SLC1A5 solute carrier family 1 member 5 1 1
MIRT633536 PGBD5 piggyBac transposable element derived 5 1 1
MIRT634338 SGOL1 shugoshin 1 1 1
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 1 1
MIRT635050 MYH11 myosin heavy chain 11 1 1
MIRT635236 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 1 1
MIRT636268 RNF157 ring finger protein 157 1 1
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 1 1
MIRT636516 FMN1 formin 1 1 1
MIRT636755 SLC16A5 solute carrier family 16 member 5 1 1
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT637188 ROMO1 reactive oxygen species modulator 1 1 1
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 1 1
MIRT637693 CEP89 centrosomal protein 89 1 1
MIRT637788 OLA1 Obg like ATPase 1 1 1
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 1 1
MIRT638449 PLXDC2 plexin domain containing 2 1 1
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 1 1
MIRT642643 PTGR2 prostaglandin reductase 2 1 1
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 1 1
MIRT644236 SLC35E3 solute carrier family 35 member E3 1 1
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 1 1
MIRT645092 SLC35E2B solute carrier family 35 member E2B 1 1
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 1 1
MIRT646508 FAM217B family with sequence similarity 217 member B 1 1
MIRT647013 ADCY2 adenylate cyclase 2 1 1
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 1 1
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 1 2
MIRT648040 FADS6 fatty acid desaturase 6 1 1
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 1 1
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT649182 DNPEP aspartyl aminopeptidase 1 1
MIRT649660 TEP1 telomerase associated protein 1 1 1
MIRT651465 XIAP X-linked inhibitor of apoptosis 1 1
MIRT652398 TMEM40 transmembrane protein 40 1 1
MIRT653691 SLC25A33 solute carrier family 25 member 33 1 1
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT654577 PXMP4 peroxisomal membrane protein 4 1 1
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT658905 DPY19L4 dpy-19 like 4 1 1
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 1 2
MIRT661101 SPIB Spi-B transcription factor 1 1
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 1 1
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT662235 PGBD4 piggyBac transposable element derived 4 1 1
MIRT662544 MTAP methylthioadenosine phosphorylase 1 1
MIRT662736 LRRC3C leucine rich repeat containing 3C 1 1
MIRT662844 OMD osteomodulin 1 1
MIRT662907 MED18 mediator complex subunit 18 1 1
MIRT662956 JPH2 junctophilin 2 1 1
MIRT663340 ZNF74 zinc finger protein 74 1 1
MIRT663496 IYD iodotyrosine deiodinase 1 1
MIRT663523 MASTL microtubule associated serine/threonine kinase like 1 1
MIRT663542 CCR6 C-C motif chemokine receptor 6 1 1
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 1 1
MIRT663973 ZNF786 zinc finger protein 786 1 1
MIRT664350 C16orf45 chromosome 16 open reading frame 45 1 1
MIRT664417 TIGD6 tigger transposable element derived 6 1 1
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 1 1
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT664970 TDRD1 tudor domain containing 1 1 1
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 1 1
MIRT665359 XKR4 XK related 4 1 1
MIRT665454 WDR17 WD repeat domain 17 1 1
MIRT665486 VPS53 VPS53, GARP complex subunit 1 1
MIRT666078 SSTR2 somatostatin receptor 2 1 1
MIRT666258 SLC31A1 solute carrier family 31 member 1 1 1
MIRT666324 SLC16A10 solute carrier family 16 member 10 1 1
MIRT666486 SBNO1 strawberry notch homolog 1 1 1
MIRT666696 RBM23 RNA binding motif protein 23 1 1
MIRT666712 RBL1 RB transcriptional corepressor like 1 1 1
MIRT666762 RAB10 RAB10, member RAS oncogene family 1 1
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 1 1
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 1 1
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 1 1
MIRT667474 MAPK1 mitogen-activated protein kinase 1 1 1
MIRT667558 LRAT lecithin retinol acyltransferase 1 1
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 1 1
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 1 1
MIRT668119 GK5 glycerol kinase 5 (putative) 1 1
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT668346 STXBP2 syntaxin binding protein 2 1 1
MIRT668509 ESYT2 extended synaptotagmin 2 1 1
MIRT669291 C17orf85 nuclear cap binding subunit 3 1 1
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT669778 CNDP1 carnosine dipeptidase 1 1 1
MIRT669858 BROX BRO1 domain and CAAX motif containing 1 2
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 1 1
MIRT670177 CCDC142 coiled-coil domain containing 142 1 1
MIRT671107 ZNF841 zinc finger protein 841 1 1
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT671476 FLYWCH2 FLYWCH family member 2 1 1
MIRT671492 SLC38A9 solute carrier family 38 member 9 1 1
MIRT671554 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 1 2
MIRT672196 F2 coagulation factor II, thrombin 1 1
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT672252 SIK2 salt inducible kinase 2 1 1
MIRT672290 GP2 glycoprotein 2 1 1
MIRT672430 POLR2D RNA polymerase II subunit D 1 1
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 1 1
MIRT672901 KRBA2 KRAB-A domain containing 2 1 1
MIRT672958 ZNF655 zinc finger protein 655 1 1
MIRT673096 SYNPO2L synaptopodin 2 like 1 1
MIRT673171 TMEM56 transmembrane protein 56 1 1
MIRT673251 INO80 INO80 complex subunit 1 1
MIRT673296 RNF19B ring finger protein 19B 1 1
MIRT673574 KDELC2 KDEL motif containing 2 1 1
MIRT673586 KIF1C kinesin family member 1C 1 1
MIRT673737 TCF23 transcription factor 23 1 1
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 1 1
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 1 1
MIRT674283 NAGK N-acetylglucosamine kinase 1 1
MIRT674338 KCMF1 potassium channel modulatory factor 1 1 1
MIRT674517 PRR23A proline rich 23A 1 1
MIRT675100 SNTB2 syntrophin beta 2 1 1
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 1 2
MIRT675223 CLK4 CDC like kinase 4 1 1
MIRT675263 ZNF431 zinc finger protein 431 1 1
MIRT675577 WWC1 WW and C2 domain containing 1 1 1
MIRT676025 C9orf69 transmembrane protein 250 1 1
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3