miRTarBase - #MIRT666258 -
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles

Circulating MicroRNA Expression Profiling
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLC31A1   
Synonyms COPT1, CTR1
Description solute carrier family 31 member 1
Transcript NM_001859   
Putative miRNA Targets on SLC31A1
3'UTR of SLC31A1
(miRNA target sites are highlighted)
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions (Predicted by miRanda)
IDDuplex structurePositionScoreMFE
            ::|:|||||   :|||||| 
Target 5' atGGCGCCATT---GCACTCCa 3'
741 - 759 145.00 -21.90
            ::|:|||||   :|||||| 
Target 5' atGGCGCCATT---GCACTCCa 3'
3793 - 3811 145.00 -21.90
              | |||  || :||||:| 
1252 - 1273 126.00 -12.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30475795 11 COSMIC
COSN24383056 16 COSMIC
COSN30505025 17 COSMIC
COSN14366361 28 COSMIC
COSN6519752 141 COSMIC
COSN20647109 426 COSMIC
COSN22405800 466 COSMIC
COSN8293700 651 COSMIC
COSN31482231 863 COSMIC
COSN6376436 879 COSMIC
COSN17183883 1122 COSMIC
COSN2306353 1145 COSMIC
COSN21468351 1155 COSMIC
COSN30539805 1166 COSMIC
COSN30010226 1170 COSMIC
COSN1372129 1187 COSMIC
COSN31482274 1389 COSMIC
COSN26573280 1440 COSMIC
COSN2514655 1447 COSMIC
COSN28640563 1717 COSMIC
COSN31589557 1921 COSMIC
COSN20871155 2204 COSMIC
COSN14494824 2267 COSMIC
COSN31555906 2383 COSMIC
COSN28415188 2602 COSMIC
COSN31528233 2904 COSMIC
COSN6376437 2917 COSMIC
COSN6376438 2921 COSMIC
COSN8519830 2958 COSMIC
COSN31572121 2966 COSMIC
COSN31515933 3018 COSMIC
COSN30539177 3774 COSMIC
COSN32061551 3856 COSMIC
COSN31485751 3967 COSMIC
COSN26577016 3968 COSMIC
COSN19492791 3988 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776350156 7 dbSNP
rs764916976 8 dbSNP
rs761688235 9 dbSNP
rs750345035 11 dbSNP
rs573450155 18 dbSNP
rs1343495483 21 dbSNP
rs1479427988 21 dbSNP
rs765978228 23 dbSNP
rs1381357956 26 dbSNP
rs1454089246 27 dbSNP
rs751182830 28 dbSNP
rs538932235 29 dbSNP
rs752491095 30 dbSNP
rs777337410 33 dbSNP
rs1415112916 37 dbSNP
rs1026798258 40 dbSNP
rs34812385 40 dbSNP
rs1328197859 50 dbSNP
rs539215469 57 dbSNP
rs188537312 60 dbSNP
rs547031001 62 dbSNP
rs916583271 66 dbSNP
rs550882798 68 dbSNP
rs575997625 69 dbSNP
rs1367777726 73 dbSNP
rs55654647 74 dbSNP
rs544662898 78 dbSNP
rs1443972232 96 dbSNP
rs569040181 98 dbSNP
rs561078456 106 dbSNP
rs868693572 107 dbSNP
rs1163827997 108 dbSNP
rs1192612334 108 dbSNP
rs1391514324 108 dbSNP
rs1421230163 108 dbSNP
rs1473700922 108 dbSNP
rs1477963651 108 dbSNP
rs201755977 108 dbSNP
rs371477044 108 dbSNP
rs878930609 108 dbSNP
rs879000254 108 dbSNP
rs141096367 110 dbSNP
rs982349744 112 dbSNP
rs924200048 115 dbSNP
rs1450600313 116 dbSNP
rs1453072473 120 dbSNP
rs1285907890 121 dbSNP
rs935487898 137 dbSNP
rs1053941528 139 dbSNP
rs768996560 139 dbSNP
rs57266996 140 dbSNP
rs866644305 141 dbSNP
rs1331816949 154 dbSNP
rs1325545919 156 dbSNP
rs1407039136 158 dbSNP
rs1397979934 162 dbSNP
rs1169840058 164 dbSNP
rs1376801892 169 dbSNP
rs1227822742 171 dbSNP
rs1465990788 193 dbSNP
rs1273872660 209 dbSNP
rs1189166263 223 dbSNP
rs1320086742 225 dbSNP
rs1246796073 243 dbSNP
rs149617740 245 dbSNP
rs540333576 250 dbSNP
rs1049547273 254 dbSNP
rs1199792686 276 dbSNP
rs889420707 280 dbSNP
rs1008317098 298 dbSNP
rs1019500007 301 dbSNP
rs181386016 304 dbSNP
rs185791269 312 dbSNP
rs551143819 314 dbSNP
rs1236239925 321 dbSNP
rs554263029 327 dbSNP
rs1376224936 330 dbSNP
rs897044466 334 dbSNP
rs994073972 349 dbSNP
rs1423801877 354 dbSNP
rs115556987 367 dbSNP
rs1173622001 367 dbSNP
rs1168157012 379 dbSNP
rs952586419 381 dbSNP
rs1425383055 382 dbSNP
rs1173937099 385 dbSNP
rs766594560 385 dbSNP
rs1379134852 390 dbSNP
rs1024144739 391 dbSNP
rs1459427901 392 dbSNP
rs1236111618 398 dbSNP
rs56267992 407 dbSNP
rs1209809214 416 dbSNP
rs530672197 428 dbSNP
rs1443326839 433 dbSNP
rs566426044 444 dbSNP
rs1238231564 445 dbSNP
rs1353162179 469 dbSNP
rs778809559 472 dbSNP
rs1240802483 473 dbSNP
rs1378957719 476 dbSNP
rs550560387 480 dbSNP
rs982537214 483 dbSNP
rs567117885 491 dbSNP
rs748444118 497 dbSNP
rs1300896000 501 dbSNP
rs1447065257 503 dbSNP
rs529821020 510 dbSNP
rs1447287714 526 dbSNP
rs1804960 534 dbSNP
rs935558410 538 dbSNP
rs1270661762 545 dbSNP
rs1342501794 548 dbSNP
rs1158674331 551 dbSNP
rs1442122185 552 dbSNP
rs546407769 558 dbSNP
rs1412320357 578 dbSNP
rs1277834900 587 dbSNP
rs1473364356 588 dbSNP
rs1239574564 593 dbSNP
rs191115659 595 dbSNP
rs772633339 597 dbSNP
rs1286854585 599 dbSNP
rs1202565380 605 dbSNP
rs533882214 606 dbSNP
rs1319971617 611 dbSNP
rs915409941 615 dbSNP
rs566559110 616 dbSNP
rs1379699512 618 dbSNP
rs1294825895 619 dbSNP
rs1397760387 623 dbSNP
rs932143006 626 dbSNP
rs1049474109 630 dbSNP
rs1421047532 631 dbSNP
rs539275045 636 dbSNP
rs1265949769 640 dbSNP
rs943695341 645 dbSNP
rs1478529774 646 dbSNP
rs1416432072 647 dbSNP
rs773697823 651 dbSNP
rs1477634927 653 dbSNP
rs1264219083 654 dbSNP
rs760859733 656 dbSNP
rs1196088179 662 dbSNP
rs144315135 663 dbSNP
rs994039965 672 dbSNP
rs766339376 676 dbSNP
rs1478184846 680 dbSNP
rs1173962689 681 dbSNP
rs1422845443 682 dbSNP
rs569571389 688 dbSNP
rs1322192414 693 dbSNP
rs1048300001 704 dbSNP
rs538113125 709 dbSNP
rs1339575549 710 dbSNP
rs1298753563 713 dbSNP
rs1362332871 714 dbSNP
rs558650746 721 dbSNP
rs578229575 722 dbSNP
rs1292380850 728 dbSNP
rs1346218222 742 dbSNP
rs139028783 746 dbSNP
rs1352081121 749 dbSNP
rs1273269782 752 dbSNP
rs1344813519 755 dbSNP
rs1465477283 756 dbSNP
rs540598972 765 dbSNP
rs1288822329 768 dbSNP
rs1487561122 771 dbSNP
rs971200115 772 dbSNP
rs1216503806 777 dbSNP
rs1261920837 778 dbSNP
rs1451644056 780 dbSNP
rs1254871034 783 dbSNP
rs1200609531 786 dbSNP
rs565675588 787 dbSNP
rs1258393309 790 dbSNP
rs1031412347 795 dbSNP
rs1158952862 796 dbSNP
rs1300032812 797 dbSNP
rs554007345 797 dbSNP
rs1382115078 799 dbSNP
rs1386883016 806 dbSNP
rs1372510312 807 dbSNP
rs1329987616 822 dbSNP
rs1417853623 825 dbSNP
rs1157970561 827 dbSNP
rs1401483626 828 dbSNP
rs1300200432 832 dbSNP
rs1464749921 833 dbSNP
rs34925791 835 dbSNP
rs956730930 839 dbSNP
rs1177034649 841 dbSNP
rs536293113 847 dbSNP
rs1391598138 848 dbSNP
rs1388570920 867 dbSNP
rs1321857046 868 dbSNP
rs1330702702 871 dbSNP
rs989692775 872 dbSNP
rs752548084 876 dbSNP
rs1457221014 877 dbSNP
rs1238587439 885 dbSNP
rs1482134901 890 dbSNP
rs1443392116 897 dbSNP
rs915506596 898 dbSNP
rs180981766 899 dbSNP
rs1240111569 903 dbSNP
rs1306365600 907 dbSNP
rs34033555 909 dbSNP
rs986723765 910 dbSNP
rs1378232878 911 dbSNP
rs372971520 920 dbSNP
rs35140377 921 dbSNP
rs912090958 933 dbSNP
rs1293112564 936 dbSNP
rs1401932512 936 dbSNP
rs1303714479 937 dbSNP
rs376563210 941 dbSNP
rs1419058977 959 dbSNP
rs768808600 962 dbSNP
rs764172679 964 dbSNP
rs1356462131 965 dbSNP
rs1158073994 973 dbSNP
rs1439044487 975 dbSNP
rs772051803 986 dbSNP
rs1380888094 997 dbSNP
rs1183872962 1000 dbSNP
rs1211065232 1005 dbSNP
rs544808615 1005 dbSNP
rs1255211457 1010 dbSNP
rs1264827126 1011 dbSNP
rs535472847 1020 dbSNP
rs929651856 1023 dbSNP
rs1215207346 1030 dbSNP
rs1353776603 1038 dbSNP
rs1281840113 1040 dbSNP
rs1243252978 1044 dbSNP
rs762100748 1047 dbSNP
rs1313810380 1052 dbSNP
rs1048269271 1057 dbSNP
rs1338660075 1069 dbSNP
rs1239855127 1072 dbSNP
rs888381238 1077 dbSNP
rs1387214878 1095 dbSNP
rs1012141340 1099 dbSNP
rs1367687893 1106 dbSNP
rs757174501 1109 dbSNP
rs1475999791 1115 dbSNP
rs1260639577 1118 dbSNP
rs1459538679 1119 dbSNP
rs1045289479 1123 dbSNP
rs1161469322 1140 dbSNP
rs906401410 1145 dbSNP
rs1266437993 1150 dbSNP
rs1390089877 1150 dbSNP
rs1004034231 1155 dbSNP
rs564698667 1156 dbSNP
rs1277864876 1179 dbSNP
rs1400830032 1195 dbSNP
rs1333580593 1205 dbSNP
rs1375207498 1221 dbSNP
rs41280225 1227 dbSNP
rs956660729 1230 dbSNP
rs1314101858 1233 dbSNP
rs1342711248 1235 dbSNP
rs1010927350 1238 dbSNP
rs1169524399 1242 dbSNP
rs544153168 1248 dbSNP
rs1475504806 1260 dbSNP
rs1243372872 1261 dbSNP
rs561217000 1262 dbSNP
rs1450509576 1268 dbSNP
rs953593346 1283 dbSNP
rs1216080157 1287 dbSNP
rs569792695 1302 dbSNP
rs1355039460 1310 dbSNP
rs56165803 1314 dbSNP
rs1198930674 1326 dbSNP
rs1341676804 1327 dbSNP
rs373224894 1343 dbSNP
rs1273186574 1344 dbSNP
rs1232676192 1357 dbSNP
rs538024354 1362 dbSNP
rs1326576492 1375 dbSNP
rs912043343 1394 dbSNP
rs774244557 1400 dbSNP
rs546567758 1407 dbSNP
rs976870921 1409 dbSNP
rs566615349 1414 dbSNP
rs763413689 1414 dbSNP
rs1256784931 1421 dbSNP
rs1425427111 1422 dbSNP
rs1185324322 1425 dbSNP
rs1237977896 1427 dbSNP
rs1368008840 1441 dbSNP
rs918348613 1445 dbSNP
rs929620577 1451 dbSNP
rs186387446 1459 dbSNP
rs1345815889 1464 dbSNP
rs142214837 1465 dbSNP
rs1236433951 1474 dbSNP
rs909579882 1477 dbSNP
rs1308407330 1479 dbSNP
rs1398324869 1480 dbSNP
rs779675188 1483 dbSNP
rs947958681 1486 dbSNP
rs575845082 1488 dbSNP
rs1045030139 1490 dbSNP
rs770216696 1491 dbSNP
rs906320042 1495 dbSNP
rs939206813 1498 dbSNP
rs543260192 1500 dbSNP
rs1380267670 1501 dbSNP
rs1178257705 1502 dbSNP
rs1471393277 1507 dbSNP
rs892574979 1509 dbSNP
rs1209701908 1515 dbSNP
rs1486093904 1516 dbSNP
rs1282604068 1520 dbSNP
rs146388664 1521 dbSNP
rs1353053425 1523 dbSNP
rs1351774873 1525 dbSNP
rs1022295927 1537 dbSNP
rs889158952 1542 dbSNP
rs1279734230 1543 dbSNP
rs752106441 1551 dbSNP
rs1446860516 1556 dbSNP
rs1315611600 1557 dbSNP
rs1008183513 1569 dbSNP
rs1417375445 1570 dbSNP
rs1019199265 1574 dbSNP
rs560956017 1594 dbSNP
rs966580915 1601 dbSNP
rs1256436137 1606 dbSNP
rs1402894148 1618 dbSNP
rs972275797 1621 dbSNP
rs1026463968 1637 dbSNP
rs1484093331 1640 dbSNP
rs1259939682 1642 dbSNP
rs951119922 1643 dbSNP
rs983871113 1652 dbSNP
rs909550510 1658 dbSNP
rs947748922 1660 dbSNP
rs1287502332 1677 dbSNP
rs981062307 1682 dbSNP
rs143552993 1686 dbSNP
rs1488674443 1687 dbSNP
rs1294807169 1690 dbSNP
rs1397742093 1702 dbSNP
rs1339294363 1703 dbSNP
rs1195849547 1708 dbSNP
rs538551978 1714 dbSNP
rs1433538809 1717 dbSNP
rs927918399 1723 dbSNP
rs1164669733 1729 dbSNP
rs1052251404 1731 dbSNP
rs1420472067 1733 dbSNP
rs1168803686 1735 dbSNP
rs1477583377 1747 dbSNP
rs554991793 1754 dbSNP
rs1188312192 1765 dbSNP
rs1487526687 1766 dbSNP
rs1244959194 1767 dbSNP
rs1212975139 1775 dbSNP
rs1468800360 1776 dbSNP
rs892334610 1780 dbSNP
rs139543815 1782 dbSNP
rs1379775828 1783 dbSNP
rs1464843428 1785 dbSNP
rs767988553 1790 dbSNP
rs1302803075 1792 dbSNP
rs1361690853 1793 dbSNP
rs1325906902 1806 dbSNP
rs1442200002 1811 dbSNP
rs1397154986 1815 dbSNP
rs1329665529 1818 dbSNP
rs1400084726 1824 dbSNP
rs1373892822 1825 dbSNP
rs1043834695 1826 dbSNP
rs533978084 1828 dbSNP
rs1431569915 1834 dbSNP
rs1424542144 1842 dbSNP
rs889079602 1845 dbSNP
rs1299436531 1850 dbSNP
rs1007569827 1854 dbSNP
rs772405272 1860 dbSNP
rs1254692601 1863 dbSNP
rs902074923 1872 dbSNP
rs553704326 1873 dbSNP
rs1480175077 1875 dbSNP
rs994183066 1880 dbSNP
rs1206182772 1884 dbSNP
rs1309941103 1885 dbSNP
rs1026431486 1890 dbSNP
rs1230739382 1891 dbSNP
rs1373776693 1894 dbSNP
rs1307664357 1896 dbSNP
rs114438051 1904 dbSNP
rs1354252324 1910 dbSNP
rs1300184160 1918 dbSNP
rs1464672800 1920 dbSNP
rs983796161 1964 dbSNP
rs1016648074 1988 dbSNP
rs969431830 2000 dbSNP
rs1396866200 2003 dbSNP
rs1487987784 2009 dbSNP
rs1418357249 2035 dbSNP
rs747502606 2036 dbSNP
rs980484134 2041 dbSNP
rs1482041131 2044 dbSNP
rs927646220 2048 dbSNP
rs1192045994 2062 dbSNP
rs1349387362 2063 dbSNP
rs939272140 2063 dbSNP
rs1238954414 2074 dbSNP
rs545858810 2101 dbSNP
rs988092764 2113 dbSNP
rs752219867 2114 dbSNP
rs558352779 2121 dbSNP
rs913696488 2122 dbSNP
rs1431836623 2128 dbSNP
rs1355110735 2147 dbSNP
rs946538120 2154 dbSNP
rs1175714200 2158 dbSNP
rs1381491640 2169 dbSNP
rs1287794842 2174 dbSNP
rs1422127121 2177 dbSNP
rs540351873 2184 dbSNP
rs1157348580 2192 dbSNP
rs10513202 2207 dbSNP
rs776591684 2214 dbSNP
rs1358701527 2216 dbSNP
rs1156753196 2218 dbSNP
rs1429355567 2226 dbSNP
rs1452899942 2227 dbSNP
rs910655969 2229 dbSNP
rs150651053 2234 dbSNP
rs561070841 2235 dbSNP
rs765625154 2251 dbSNP
rs1369196515 2256 dbSNP
rs1256423121 2260 dbSNP
rs532210544 2261 dbSNP
rs10759637 2272 dbSNP
rs1260323488 2275 dbSNP
rs901874022 2287 dbSNP
rs762879069 2292 dbSNP
rs1377353663 2294 dbSNP
rs1243132572 2315 dbSNP
rs1334598683 2315 dbSNP
rs1294211528 2319 dbSNP
rs993709647 2322 dbSNP
rs1338540361 2325 dbSNP
rs191190540 2325 dbSNP
rs1242283820 2327 dbSNP
rs1381609073 2331 dbSNP
rs1385629255 2333 dbSNP
rs1290531040 2334 dbSNP
rs764007127 2337 dbSNP
rs1459728318 2339 dbSNP
rs560147282 2343 dbSNP
rs1416889569 2346 dbSNP
rs532258438 2349 dbSNP
rs1047970733 2354 dbSNP
rs1370864909 2357 dbSNP
rs1191901558 2362 dbSNP
rs1447059518 2363 dbSNP
rs552273046 2365 dbSNP
rs1222352111 2375 dbSNP
rs569178111 2379 dbSNP
rs1468325684 2382 dbSNP
rs374602247 2384 dbSNP
rs1267463757 2385 dbSNP
rs1316254463 2398 dbSNP
rs1487595152 2402 dbSNP
rs1228300675 2403 dbSNP
rs529947143 2417 dbSNP
rs1006359497 2420 dbSNP
rs1239242608 2435 dbSNP
rs1326278523 2438 dbSNP
rs757154425 2439 dbSNP
rs1393943604 2442 dbSNP
rs1166949817 2445 dbSNP
rs1177335903 2449 dbSNP
rs1374229439 2463 dbSNP
rs1192325431 2465 dbSNP
rs1454185451 2469 dbSNP
rs1380182226 2475 dbSNP
rs1399620718 2479 dbSNP
rs767421922 2482 dbSNP
rs749965812 2485 dbSNP
rs756865590 2486 dbSNP
rs562547126 2489 dbSNP
rs1273090962 2490 dbSNP
rs1232018751 2507 dbSNP
rs779732387 2509 dbSNP
rs753459884 2512 dbSNP
rs988020992 2517 dbSNP
rs1327772242 2523 dbSNP
rs1448660819 2524 dbSNP
rs913830876 2530 dbSNP
rs183022238 2534 dbSNP
rs41280227 2538 dbSNP
rs1396256511 2539 dbSNP
rs778133638 2551 dbSNP
rs1228978046 2555 dbSNP
rs1468983681 2559 dbSNP
rs747342873 2571 dbSNP
rs1182814696 2574 dbSNP
rs1315011423 2581 dbSNP
rs555375835 2593 dbSNP
rs1213355446 2603 dbSNP
rs568664259 2609 dbSNP
rs1040898077 2615 dbSNP
rs139733189 2619 dbSNP
rs771349300 2620 dbSNP
rs547403419 2623 dbSNP
rs1047938180 2626 dbSNP
rs1337206930 2628 dbSNP
rs781722505 2638 dbSNP
rs1310671915 2639 dbSNP
rs1473443160 2643 dbSNP
rs888048566 2644 dbSNP
rs1176080413 2645 dbSNP
rs566490348 2653 dbSNP
rs1006454401 2654 dbSNP
rs570484659 2660 dbSNP
rs533740563 2661 dbSNP
rs1471343254 2671 dbSNP
rs12338803 2676 dbSNP
rs1187491021 2678 dbSNP
rs1466999567 2680 dbSNP
rs1035189097 2684 dbSNP
rs1259637444 2687 dbSNP
rs1353694622 2687 dbSNP
rs960331509 2687 dbSNP
rs1448755053 2694 dbSNP
rs1315017678 2723 dbSNP
rs1283440931 2732 dbSNP
rs1224182936 2735 dbSNP
rs1330926123 2742 dbSNP
rs1291124418 2746 dbSNP
rs1232227310 2748 dbSNP
rs752679830 2748 dbSNP
rs796340430 2750 dbSNP
rs1429276643 2752 dbSNP
rs1345160539 2754 dbSNP
rs1377097740 2758 dbSNP
rs775669406 2758 dbSNP
rs1232706967 2769 dbSNP
rs570544881 2774 dbSNP
rs1164498919 2780 dbSNP
rs377531557 2783 dbSNP
rs1475632080 2787 dbSNP
rs374238390 2791 dbSNP
rs1184902779 2792 dbSNP
rs1485573970 2794 dbSNP
rs576474661 2808 dbSNP
rs7032466 2809 dbSNP
rs768940219 2826 dbSNP
rs1272823934 2827 dbSNP
rs910383181 2828 dbSNP
rs964905484 2830 dbSNP
rs368109125 2833 dbSNP
rs574651338 2843 dbSNP
rs923364015 2857 dbSNP
rs1212340859 2858 dbSNP
rs1360656521 2861 dbSNP
rs1271290894 2880 dbSNP
rs929285415 2896 dbSNP
rs1325604486 2900 dbSNP
rs1462267253 2902 dbSNP
rs983400182 2907 dbSNP
rs1236183664 2911 dbSNP
rs539268624 2930 dbSNP
rs1420228247 2933 dbSNP
rs1186526837 2934 dbSNP
rs1451197537 2938 dbSNP
rs1250939844 2943 dbSNP
rs1423918672 2948 dbSNP
rs774019821 2949 dbSNP
rs1212878828 2952 dbSNP
rs1468731000 2953 dbSNP
rs761663988 2954 dbSNP
rs540496746 2958 dbSNP
rs187518939 2960 dbSNP
rs371029638 2963 dbSNP
rs905995349 2969 dbSNP
rs938860420 2974 dbSNP
rs1418580461 2983 dbSNP
rs1231301395 2986 dbSNP
rs1414772998 2988 dbSNP
rs545799686 2990 dbSNP
rs1473985724 2994 dbSNP
rs1369484518 2995 dbSNP
rs770089023 2999 dbSNP
rs1303289240 3000 dbSNP
rs190070889 3003 dbSNP
rs1056192047 3004 dbSNP
rs11556503 3036 dbSNP
rs1414260815 3039 dbSNP
rs1298939213 3048 dbSNP
rs896217134 3049 dbSNP
rs1342443613 3051 dbSNP
rs1009347540 3057 dbSNP
rs531431588 3062 dbSNP
rs1269801456 3066 dbSNP
rs1180545018 3071 dbSNP
rs1269130971 3073 dbSNP
rs1175144288 3084 dbSNP
rs1480085290 3084 dbSNP
rs1251498820 3085 dbSNP
rs75939479 3095 dbSNP
rs903559253 3096 dbSNP
rs183316838 3097 dbSNP
rs1314318287 3107 dbSNP
rs1017947895 3108 dbSNP
rs1391068852 3109 dbSNP
rs1374380060 3116 dbSNP
rs527999206 3121 dbSNP
rs976339194 3131 dbSNP
rs1374919793 3135 dbSNP
rs547713530 3139 dbSNP
rs1172952511 3143 dbSNP
rs1217974752 3145 dbSNP
rs1030145846 3147 dbSNP
rs1156719914 3151 dbSNP
rs750353101 3152 dbSNP
rs1418267494 3156 dbSNP
rs950791745 3160 dbSNP
rs187517079 3163 dbSNP
rs1484404938 3165 dbSNP
rs1190642785 3166 dbSNP
rs1212250028 3171 dbSNP
rs1484500774 3173 dbSNP
rs1259454547 3177 dbSNP
rs983537292 3190 dbSNP
rs539491402 3197 dbSNP
rs1422931080 3199 dbSNP
rs760218433 3203 dbSNP
rs1290515857 3206 dbSNP
rs942040737 3213 dbSNP
rs1354927447 3220 dbSNP
rs765907253 3226 dbSNP
rs41280229 3230 dbSNP
rs1404329785 3235 dbSNP
rs1287038424 3236 dbSNP
rs1452879579 3241 dbSNP
rs1412356320 3244 dbSNP
rs1160938490 3246 dbSNP
rs542967585 3258 dbSNP
rs570052798 3261 dbSNP
rs1057480266 3266 dbSNP
rs1425016770 3276 dbSNP
rs778563781 3278 dbSNP
rs892002244 3281 dbSNP
rs10981707 3282 dbSNP
rs572932606 3284 dbSNP
rs386737770 3287 dbSNP
rs763821725 3287 dbSNP
rs10981708 3288 dbSNP
rs371573449 3288 dbSNP
rs10981709 3289 dbSNP
rs192654273 3297 dbSNP
rs533953876 3298 dbSNP
rs1294115357 3300 dbSNP
rs1273505622 3307 dbSNP
rs1324760743 3325 dbSNP
rs1000954565 3327 dbSNP
rs1017498182 3330 dbSNP
rs1288756951 3334 dbSNP
rs1322249489 3336 dbSNP
rs1355264808 3339 dbSNP
rs900399307 3343 dbSNP
rs565079839 3347 dbSNP
rs1163463886 3356 dbSNP
rs757632471 3377 dbSNP
rs781586711 3386 dbSNP
rs1202784432 3393 dbSNP
rs1370776647 3395 dbSNP
rs1193127590 3402 dbSNP
rs532495189 3403 dbSNP
rs1283135423 3410 dbSNP
rs184495650 3418 dbSNP
rs1468306166 3425 dbSNP
rs1200539470 3437 dbSNP
rs1274111093 3438 dbSNP
rs1211786494 3439 dbSNP
rs1337540886 3441 dbSNP
rs1250787018 3448 dbSNP
rs1226647786 3451 dbSNP
rs1365896130 3461 dbSNP
rs187734512 3462 dbSNP
rs565090581 3469 dbSNP
rs1453547543 3475 dbSNP
rs192693896 3480 dbSNP
rs983462308 3481 dbSNP
rs1016313604 3486 dbSNP
rs544644310 3491 dbSNP
rs562464825 3501 dbSNP
rs1143245 3503 dbSNP
rs1393731821 3523 dbSNP
rs1158011532 3533 dbSNP
rs1166850177 3534 dbSNP
rs980489667 3541 dbSNP
rs1392629388 3546 dbSNP
rs1172306885 3559 dbSNP
rs927343003 3575 dbSNP
rs1324099668 3599 dbSNP
rs879291398 3602 dbSNP
rs1201314134 3604 dbSNP
rs1436255086 3605 dbSNP
rs879691683 3606 dbSNP
rs1250048052 3607 dbSNP
rs111976327 3608 dbSNP
rs993118836 3609 dbSNP
rs1275179214 3610 dbSNP
rs913363203 3612 dbSNP
rs879785952 3613 dbSNP
rs1333670883 3616 dbSNP
rs1327747811 3617 dbSNP
rs774831566 3620 dbSNP
rs1371794384 3624 dbSNP
rs1375253895 3625 dbSNP
rs946204666 3629 dbSNP
rs561606511 3637 dbSNP
rs1426356255 3639 dbSNP
rs780291390 3644 dbSNP
rs1042132459 3649 dbSNP
rs1363500547 3653 dbSNP
rs1183159191 3654 dbSNP
rs1484080588 3684 dbSNP
rs925044164 3687 dbSNP
rs1208667773 3689 dbSNP
rs1278512628 3691 dbSNP
rs1356394945 3698 dbSNP
rs1211314656 3699 dbSNP
rs1270825788 3702 dbSNP
rs1441810683 3702 dbSNP
rs10123211 3703 dbSNP
rs1039097356 3706 dbSNP
rs1348266465 3708 dbSNP
rs1198972824 3710 dbSNP
rs1278593065 3710 dbSNP
rs1228557789 3711 dbSNP
rs1239957831 3712 dbSNP
rs1351817887 3714 dbSNP
rs1417309965 3722 dbSNP
rs1413601915 3730 dbSNP
rs1229439096 3733 dbSNP
rs1181001982 3734 dbSNP
rs1369166818 3735 dbSNP
rs1473805782 3739 dbSNP
rs1160199750 3740 dbSNP
rs1473667805 3744 dbSNP
rs541219541 3750 dbSNP
rs1473158424 3756 dbSNP
rs997843331 3757 dbSNP
rs1300044525 3759 dbSNP
rs1267201189 3766 dbSNP
rs1208995010 3767 dbSNP
rs564489353 3774 dbSNP
rs1291037571 3778 dbSNP
rs533402585 3783 dbSNP
rs1394776777 3790 dbSNP
rs549770175 3791 dbSNP
rs1286476556 3799 dbSNP
rs1335418196 3803 dbSNP
rs931649738 3809 dbSNP
rs1429169694 3816 dbSNP
rs1344996440 3818 dbSNP
rs111495947 3820 dbSNP
rs1164472219 3821 dbSNP
rs1234543389 3822 dbSNP
rs963776332 3823 dbSNP
rs1415977325 3824 dbSNP
rs141123297 3834 dbSNP
rs1051332911 3835 dbSNP
rs566750431 3837 dbSNP
rs1218852129 3838 dbSNP
rs1189036072 3839 dbSNP
rs1034760396 3842 dbSNP
rs1291343723 3842 dbSNP
rs1321809342 3842 dbSNP
rs1340144265 3842 dbSNP
rs1466079569 3842 dbSNP
rs1213358419 3843 dbSNP
rs1259831670 3857 dbSNP
rs1479518550 3859 dbSNP
rs960070141 3860 dbSNP
rs1195210724 3861 dbSNP
rs1256714411 3863 dbSNP
rs993045078 3865 dbSNP
rs1325489771 3877 dbSNP
rs1437392028 3878 dbSNP
rs913500337 3882 dbSNP
rs967516457 3897 dbSNP
rs1409433832 3900 dbSNP
rs978907355 3901 dbSNP
rs926172074 3903 dbSNP
rs1478309548 3916 dbSNP
rs936411740 3917 dbSNP
rs1038823213 3920 dbSNP
rs184182939 3923 dbSNP
rs529387745 3925 dbSNP
rs1488580256 3927 dbSNP
rs1248063216 3940 dbSNP
rs879250936 3941 dbSNP
rs767712540 3966 dbSNP
rs549482603 3972 dbSNP
rs933011370 3978 dbSNP
rs1051606146 3979 dbSNP
rs753127732 3988 dbSNP
rs758660180 3992 dbSNP
rs1173702877 3994 dbSNP
rs1387672972 3999 dbSNP
rs878956925 4015 dbSNP
rs1004783903 4017 dbSNP
rs753602800 4020 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
IDDuplex structurePosition
            ::|:|||||   :|||||| 
Target 5' auGGCGCCAUU---GCACUCCa 3'
3 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000374212.4 | 3UTR | AGAUGGCGCCAUUGCACUCCAGCCUGGGUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.632 4.6e-4 0.728 2.8e-5 24 Click to see details
GSE38226 Liver fibrosis 0.5 1.0e-2 0.533 6.4e-3 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.424 1.7e-2 -0.465 9.6e-3 25 Click to see details
GSE28260 Renal cortex and medulla -0.476 5.0e-2 -0.181 2.8e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.301 8.1e-2 0.371 4.1e-2 23 Click to see details
GSE21849 B cell lymphoma -0.169 1.9e-1 0.180 1.8e-1 29 Click to see details
GSE32688 Pancreatic cancer -0.16 1.9e-1 -0.136 2.3e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.152 2.3e-1 -0.183 1.9e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.069 2.9e-1 0.021 4.3e-1 64 Click to see details
GSE27834 Pluripotent stem cells 0.144 3.0e-1 0.159 2.8e-1 16 Click to see details
GSE17306 Multiple myeloma -0.054 3.6e-1 0.046 3.8e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.055 4.1e-1 -0.320 8.4e-2 20 Click to see details
GSE17498 Multiple myeloma 0.02 4.5e-1 0.028 4.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.032 4.6e-1 0.294 1.8e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.02 4.6e-1 0.055 4.0e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.048 4.6e-1 -0.086 4.4e-1 6 Click to see details
GSE14794 Lymphoblastoid cells -0.006 4.8e-1 -0.003 4.9e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.654 0 0.376 0 49 Click to see details
STAD 0.803 0.01 0.667 0.04 8 Click to see details
HNSC -0.974 0.07 -0.500 0.33 3 Click to see details
KIRC 0.156 0.21 0.012 0.48 29 Click to see details
THCA 0.471 0.21 0.600 0.14 5 Click to see details
ESCA 0.452 0.22 0.300 0.31 5 Click to see details
KICH -0.309 0.23 -0.238 0.29 8 Click to see details
KIRP 0.073 0.43 0.167 0.33 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
CHOL 0.057 0.44 0.267 0.24 9 Click to see details
MiRNA Regulatory Network:
Functional analysis:
Strong evidence (reporter assay, western blot, qRT-PCR or qPCR) Other evidence
Transcription factor regulation Circular RNA sponge
539 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 4 4
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 2 2
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
Error report submission
Your e-Mail*